Development of a Kit for Rapid Immunochromatographic Detection of Sacbrood Virus Infecting Apis cerana (AcSBV) Based on Polyclonal and Monoclonal Antibodies Raised against Recombinant VP1 and VP2 Expressed in Escherichia coli

A Korean isolate of the sacbrood virus infecting Apis cerana (AcSBV-Kor) is the most destructive honeybee virus, causing serious economic damage losses in Korean apiculture. To address this, here, we attempted to develop an assay for the rapid detection of AcSBV-Kor based on immunochromatographic detection of constituent viral proteins. Genes encoding VP1 and VP2 proteins of AcSBV-Kor were cloned into an expression vector (pET-28a) and expressed in Escherichia coli BL21(DE3). During purification, recombinant VP1 (rVP1) and VP2 (rVP2) proteins were found in the insoluble fraction, with a molecular size of 26.7 and 24.9 kDa, respectively. BALB/c mice immunized with the purified rVP1 and rVP2 produced polyclonal antibodies (pAbs) such as pAb-rVP1 and pAb-rVP2. Western blot analysis showed that pAb-rVP1 strongly reacted with the homologous rVP1 but weakly reacted with heterologous rVP2. However, pAb-rVP2 strongly reacted not only with the homologous rVP2 but also with the heterologous rVP1. Spleen cells of the immunized mice fused with SP2/0-Ag14 myeloma cells produced monoclonal antibodies (mAbs) such as mAb-rVP1-1 and mAb-rVP2-13. Western blot analysis indicated that pAb-rVP1, pAb-rVP2, mAb-rVP1-1, and mAb-rVP2-13 reacted with AcSBV-infected honeybees and larvae as well as the corresponding recombinant proteins. These antibodies were then used in the development of a rapid immunochromatography (IC) strip assay kit with colloidal gold coupled to pAb-rVP1 and pAb-rVP2 at the conjugate pad and mAb-rVP1-1 and mAb-rVP2-13 at the test line. One antibody pair, pAb-rVP1/mAb-VP1-1, showed positive reactivity as low as 1.38 × 103 copies, while the other pair, pAb-rVP2/mAb-VP2-13, showed positive reactivity as low as 1.38 × 104 copies. Therefore, the antibody pair pAb-rVP1/mAb-VP1-1 was selected as a final candidate for validation. To validate the detection of AcSBV, the IC strip tests were conducted with 50 positive and 50 negative samples and compared with real-time PCR tests. The results confirm that the developed IC assay is a sufficiently sensitive and specific detection method for user-friendly and rapid detection of AcSBV.

Complete Genome Sequence of Tomato Spotted Wilt Virus , a South Korean Isolate from Gerbera jamesonii

The genome sequence of Tomato spotted wilt orthotospovirus (TSWV) isolated from gerbera was determined. The genome consists of L, M, and S segments containing 8,920, 4,775, and 2,970 nucleotides, respectively.

First report of Tobacco ringspot virus in highbush blueberry in Washington State

Since 2015, several blueberry plants (Vaccinium corymbosum) of cvs. Draper and Top Shelf in an organic farm in eastern Washington State showed reduced growth with deformed leaves displaying chlorotic spots, rings, and red blotches and producing small and poorly ripened berries. The symptomatic plants showed gradual decline within 2 to 3 years post-planting. In ELISA using antibodies (Agdia, Inc., USA) to Blueberry leaf mottle virus, Cherry leaf roll virus, Peach rosette mosaic virus, Strawberry latent ringspot virus, Tomato black ring virus, Tomato ringspot virus, and Tobacco ringspot virus [TRSV]), leaf samples from six symptomatic plants tested positive only to TRSV (Secoviridae: Nepovirus). Subsequently, total RNA was isolated from leaves of a symptomatic plant using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, USA). High quality RNA was subjected to high-throughput sequencing (HTS) on the Illumina© NovaSeq™ platform (Huntsman Cancer Institute, UT, USA). An average of ~28 million 150-base pair (bp) paired-end reads obtained were subjected to quality filtering followed by de novo assembly using CLC Genomics Workbench (v12.0) and BLASTn analysis (http://www.ncbi.nlm.nih.gov/blast). Two contigs of 2,778 bp (average coverage: 11,031.7) and 3,589 bp (average coverage: 11,882) showed, respectively, a maximum of 97.3 and 97.6% nucleotide (nt) identity with TRSV RNA1 of a South Korean isolate (KJ556849). Another contig of 3,615 bp (average coverage: 7072.1) showed a maximum of 92.8% nt identity with TRSV RNA2 of an isolate from Iowa (MT563079). The HTS data revealed no other viral sequences reported from blueberry plants (Martin and Tzanetakis 2018). To further confirm the presence of TRSV, extracts of leaf samples from seven symptomatic and ten asymptomatic plants collected randomly from cvs. Draper and Top Shelf were tested by RT-PCR using primers specific to a region of the helicase gene of TRSV RNA1 (Forward: GACTACTGAGCAACATTGCAACTTCC, Reverse: GTCCCCTAACAGCATTGACTACC) and the coat protein gene of TRSV RNA2 (Forward: GCTGATTGGCAGTGTATTGTTAC, Reverse: GTGTTCGCATCTGGTTTCAAATTGG). An approximately 360 bp fragment specific to RNA1 and ~640 bp fragment specific to RNA2 were amplified only from symptomatic samples. Sanger sequence analysis of amplicons specific to RNA1 and RNA2 showed 98.1% and 96.8% nt identity with corresponding sequences of TRSV isolates from South Korea (KJ556849) and Iowa (MT563079), respectively. These results confirmed the presence of TRSV in symptomatic blueberry plants. The complete sequence of RNA1 (7,512 nt, MW495243) and RNA2 (3,925 nt, MW495244) genome segments of the blueberry isolate determined in this study showed 95.9 and 93.2% nt sequence identity, respectively, with corresponding TRSV sequences from South Korea (KJ556849) and Iowa (MT563079). Based on previous reports (Converse and Ramsdell 1982, Martin et al. 2012, Martin and Tzanetakis, 2018), this study represents the first report of TRSV infecting highbush blueberry in Washington State. Since the State has emerged as the national leader in blueberry production, the results will strengthen plant health certification standards to provide virus-tested propagative materials for domestic growers and export to the European Union.

First report of Cucurbit chlorotic yellows virus infecting Cucumis melo (muskmelon and oriental melon) in Korea

In December 2018, virus-like symptoms (yellowing, vein clearing) were observed on 2% of muskmelon (Cucumis melo L.) plants in plastic houses on a farm in Gyeongsang province, Korea Total RNA from two symptomatic and two asymptomatic plants was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) for high throughput sequencing (HTS). After pre-processing and Ribo-Zero rRNA removal, a cDNA library was prepared (Illumina TruSeq Stranded Total RNA kit) and sequenced (Illumina NovaSeq 6000 system: Macrogen Inc. Korea). De novo assembly of 88,222,684 HTS reads with Trinity software (r20140717) yielded 146,269 contigs of 201-28,442 bp, which were screened against the NCBI viral genome database by BLASTn. Contigs from cucumber mosaic virus (CMV), melon necrotic spot virus (MNSV), tobacco mosaic virus (TMV) and watermelon mosaic virus (WMV) were identified, all previously reported in Korea. Two contigs (8,539 and 8,040 bp) with 99.9% sequence identity to distinct cucurbit chlorotic yellows virus (CCYV) isolates (JN641883, RNA1, Taiwan; MH819191, RNA2, China) were also identified. The ten sequences most closely related to each RNA of the Korean isolate (≥99% coverage, ≥99.6% nt identity) were from Japan, China, Taiwan, or Israel. CCYV presence was confirmed by reverse transcription-PCR (RT-PCR) using newly designed specific primers, RdRp-F/RdRp-R (5’-ACCGAACACTTGGCTATCCAA-3’/5’-CTTAATGCCGCGTATGAACTCA-3’) span style="font-family:'Times New Roman'; letter-spacing:-0.5pt">and HSP-F/HSP-R (5’-TGAACGACACTGAGTTCATTCCTA-3’/5’-CGCCAAGATCGTACATGAGGAA-3’), against RNA dependent RNA polymerase (RdRp; RNA1) and the heat shock protein 70 homolog (HSP70h; RNA2). Symptomatic samples yielded products of expected sizes (RdRp,450 bp; HSP70h, 510 bp) while asymptomatic samples did not. The amplicons were cloned, and two clones of each were sequenced (BIONEER, Korea; GenBank acc. nos. LC592226 and LC592227) showing 100% and 99.2% nt identity with RdRp and HSP70h genes of Chinese CCYV isolate SD (MH819190 and MH819191, respectively) and other Asian isolates. Primers specific for CMV, WMV, beet pseudo-yellows virus (BPYV) (Okuda et al., 2007), TMV (Kim et al., 2018), MNSV (F/R, 5ʹ-ATCTCGCATTTGGCATTACTC-3ʹ/5ʹ-ATTTGTAGAGATGCCAACGTA-3ʹ), cucurbit yellow stunting disorder virus (CYSDV; Zeng et al., 2011) and cucurbit aphid-borne yellows virus (CABYV; F/R, 5ʹ-CGGTCTATTGTCTGCAGTACCA-3ʹ/5ʹ- GTAGAGGATCTTGAATTGGTCCTCA-3ʹ) were also used. None of these viruses were detected in the symptomatic samples, but both asymptomatic plants were positive for CMV and WMV, and one also for MNSV. In June and September 2020, muskmelon and oriental melon (Cucumis melo L. var. makuwa) plants with yellowing disease (incidence 80-90%) and whiteflies were observed in all investigated plastic houses of one muskmelon and one oriental melon farm in Gyeonggi and Jeolla provinces. Symptomatic samples (14 muskmelon; 6 oriental melon) were collected and RT-PCR tested as above; 19/20 samples were positive for CCYV, but none for the other viruses. The oriental melon sequence (LC592895, LC592230) showed 99.7% and 100% nt identity with the RdRp and HSP70h genes of Chinese isolate SD, respectively. CCYV was first reported in Japan (Okuda et al., 2010), Taiwan, and China (Huang et al., 2010; Gu et al., 2011); to our knowledge, this is the first report of CCYV infecting muskmelon and oriental melon in Korea. Whitefly-transmitted CCYV could present a serious threat of yield losses to cucurbit crops in Korea, requiring control of vector populations to prevent spread of CCYV.

Phylogenetic Positioning of a Strongyloides stercoralis Isolate Recovered from a Korean Patient and Comparison with Other Asian Isolates

Strongyloidiasis is caused by <i>Strongyloides stercoralis</i> and is one of the most neglected tropical diseases in tropical and subtropical regions. Although several strongyloidiasis cases have been reported in Korea, genetic analysis of Korean isolates is still incomplete. In this study, a parasite was isolated from a 61-year-old man diagnosed with strongyloidiasis during the treatment of lymphoma on his retroperitoneal lymph node. Diffuse symmetric wall thickening from the ascending to descending colon and a nematode-infected intestine was observed following microscopic examination. Genomic DNA was isolated from a patient tissue block, and <i>S. stercoralis</i> was identified by PCR and sequencing (18S rDNA). In order to determine phylogenetic location of a Korean isolate (named KS1), we analyzed <i>cox</i>1 gene (500-bp) and compared it with that from 47 previous <i>S. stercoralis</i> isolates (28 human isolates and 19 canid isolates) from Asian countries. Our results showed that phylogenetic tree could clearly be divided into 5 different groups according to hosts and regions. KS1 was most closely related with the Chinese isolates in terms of genetic distance.

The Complete Chloroplast Genome of Arabidopsis thaliana Isolated in Korea (Brassicaceae): An Investigation of Intraspecific Variations of the Chloroplast Genome of Korean A. thaliana

Arabidopsis thaliana (L.) Heynh. is a model organism of plant molecular biology. More than 1,700 whole genome sequences have been sequenced, but no Korean isolate genomes have been sequenced thus far despite the fact that many A. thaliana isolated in Japan and China have been sequenced. To understand the genetic background of Korean natural A. thaliana (named as 180404IB4), we presented its complete chloroplast genome, which is 154,464 bp long and has four subregions: 85,164 bp of large single copy (LSC) and 17,781 bp of small single copy (SSC) regions are separated by 26,257 bp of inverted repeat (IRs) regions including 130 genes (85 protein-coding genes, eight rRNAs, and 37 tRNAs). Fifty single nucleotide polymorphisms (SNPs) and 14 insertion and deletions (INDELs) are identified between 180404IB4 and Col0. In addition, 101 SSRs and 42 extendedSSRs were identified on the Korean A. thaliana chloroplast genome, indicating a similar number of SSRs on the rest five chloroplast genomes with a preference of sequence variations toward the SSR region. A nucleotide diversity analysis revealed two highly variable regions on A. thaliana chloroplast genomes. Phylogenetic trees with three more chloroplast genomes of East Asian natural isolates show that Korean and Chinese natural isolates are clustered together, whereas two Japanese isolates are not clustered, suggesting the need for additional investigations of the chloroplast genomes of East Asian isolates.

Effects of Different Nutrient and Trace Metal Concentrations on Growth of the Toxic Dinoflagellate Gymnodinium catenatum Isolated from Korean Coastal Waters

The effects of the addition of nutrients (nitrate: N; phosphate: P; and vitamin B1) and trace metals (iron: Fe; Copper: Cu; and selenium: Se) on the growth of Gymnodinium catenatum, which was isolated from Korean coastal waters, were investigated. The Korean isolate of G. catenatum grew under a wide range of concentrations of N and P. Whilst high concentrations of N (> N: P ratio of 23.5) did not stimulate the growth rate, an enhanced growth rate and cell density were observed with the addition of P. The experimental addition of vitamin B1 revealed that G. catenatum is not dependent on vitamin B1 for growth. Moreover, the addition of Fe and Cu resulted in no significant differences in the growth patterns and rates of G. catenatum between the controls and treatments. It is thus possible that growth of the Korean isolate of G. catenatum does not require high concentrations of Fe and Cu. However, the cell densities were enhanced in the stationary phases of treatments upon addition of Se, and the maximum cell densities were higher than those in the culture experiments upon additions of other nutrient and trace metals. Our findings indicate that G. catenatum prefers P and Se for proliferation, rather than other nutritional sources.

Identification and Genome Analysis of Vibrio coralliilyticus Causing Mortality of Pacific Oyster (Crassostrea gigas) Larvae

Vibrio coralliilyticus is known as a coral pathogen that also infects marine bivalve larvae worldwide. It is considered to be one of the major constraints in artificial marine bivalve seed production as it causes mortality. In this study, we first isolated and characterized a high virulent of V. coralliilyticus designated as SNUTY-1 that was the cause of Pacific oyster larvae mortality in Korea. In the pathogenicity test, exposure to 2.14 × 105 CFU/mL for 24 h caused mortality to 88.65 ± 2.4% of the tested healthy Pacific oyster larvae. SNUTY-1 showed anti-microbial resistance to β-lactams, such as penicillins, cephalosporins, and carbapenems. We sequenced and assembled the complete genome of SNUTY-1 (5,842,676 bp), consisting of two chromosomes (Chr I and Chr II) and two plasmids (pSNUTY1 and pSNUTY2). The COG functional analysis confirmed that Chr I had more genes associated with basic cellular functions in comparison to Chr II. The results of the phylogenetic trees based on OrthoANI values indicated that the SNUTY-1 was closely related to V. coralliilyticus strains. SNUTY-1 had a unique plasmid (pSNUTY2), which could mean that the Korean isolate is different from other sequenced V. coralliilyticus strains from different geographical origins. Toxic proteins such as cytolysin/hemolysin and extracellular metalloprotease genes were encoded on Chr I and Chr II of SNUTY-1. These data facilitate the control of V. coralliilyticus infections in aquaculture by providing valuable insights into the biodiversity of this organism and valuable information for the study of virulence factors.