Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4+

The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove – in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

Pattern Preference Analysis of Black-and-White Plaid Shirts

The market economy has shifted the decision-making power of the garment industry from the enterprise to the consumer. Research on consumer clothing preferences is an essential part of sustainable development of the garment industry. Based on data statistics from eight fast fashion brands, black and white are most commonly used in two-color plaid shirts. This paper carried out a psychophysical experiment to investigate factors affecting pattern preferences for black-and-white shirts and the differences and similarities between male and female pattern preferences. Twenty-eight different representative patterns of plaid shirts were selected by five fashion designers together from 190 different black-and-white plaid shirts from eight fast fashion brands, which were then classified into three categories: gingham, tartans, and windowpane. Based on these patterns, 28 male and female shirts were simulated in three dimensions and presented on a calibrated computer display. The simulations were assessed by 42 observers (consisting of 21 males and 21 females) in terms of four semantic scales, including light–dark, delicate–rough, simple–complex, and like–dislike. The experimental results revealed that there was no significant difference of pattern preference between females and males for 89.29% of the black-and-white plaid shirts, and also described features of the patterns that the females and males liked or disliked. Furthermore, the study also demonstrated the formulation between the four semantic scales and three pattern features (including the percentage of black region, the size of the minimum repeat unit, and the descriptor of the pattern complexity). The findings could be used to develop a more robust and comprehensive theory of pattern preferences and provide a reference for pattern design for black-and-white plaid shirts. More comprehensive pattern preference theory is not only an effective tool to solve the problem of plaid shirt inventory in the garment industry but also an important theoretical basis for the “sustainable design” of clothing, which is of great significance to the sustainable development of the garment industry.

Development of habitat suitability criteria for Neotropical stream fishes and an assessment of their transferability to streams with different conservation status

We assessed the preference of 10 fish species for depth and velocity conditions in forested streams from southeastern Brazil using habitat suitability criteria (HSC curves). We also tested whether preference patterns observed in forested streams can be transferred to deforested streams. We used data from fish sampled in 62 five-meter sites in three forested streams to construct preference curves. Astyanax altiparanae, A. fasciatus, Knodus moenkhausii, and Piabina argentea showed a preference for deep slow habitats, whereas Aspidoras fuscoguttatus, Characidium zebra, Cetopsorhamdia iheringi, Pseudopimelodus pulcher, and Hypostomus nigromaculatus showed an opposite pattern: preference for shallow fast habitats. Hypostomus ancistroides showed a multimodal pattern of preference for depth and velocity. To evaluate whether patterns observed in forested streams may be transferred to deforested streams, we sampled 64 five-meters sites in three deforested streams using the same methodology. The preference for velocity was more consistent than for depth, as success in the transferability criterion was 86% and 29% of species, respectively. This indicates that velocity is a good predictor of species abundance in streams, regardless of their condition