scholarly journals Pattern preferences of DNA nucleotide motifs by polyamines putrescine2+, spermidine3+ and spermine4+

2019 ◽  
Vol 47 (12) ◽  
pp. 6084-6097 ◽  
Author(s):  
Sergiy Perepelytsya ◽  
Jozef Uličný ◽  
Aatto Laaksonen ◽  
Francesca Mocci
Keyword(s):  
Driving Force ◽  
Electrostatic Interactions ◽  
Double Helix ◽  
Minor Groove ◽  
Residence Times ◽  
Sequence Dependence ◽  
Pattern Preference ◽  
Dna Fragment ◽  
Dynamics Simulations ◽  
Dna Double Helix

Abstract The interactions of natural polyamines (putrescine2+, spermidine3+ and spermine4+) with DNA double helix are studied to characterize their nucleotide sequence pattern preference. Atomistic Molecular Dynamics simulations have been carried out for three systems consisting of the same DNA fragment d(CGCGAATTCGCGAATTCGCG) with different polyamines. The results show that polyamine molecules are localized with well-recognized patterns along the double helix with different residence times. We observed a clear hierarchy in the residence times of the polyamines, with the longest residence time (ca 100ns) in the minor groove. The analysis of the sequence dependence shows that polyamine molecules prefer the A-tract regions of the minor groove – in its narrowest part. The preferable localization of putrescine2+, spermidine3+ and spermine4+ in the minor groove with A-tract motifs is correlated with modulation of the groove width by a specific nucleotide sequences. We did develop a theoretical model pointing to the electrostatic interactions as the main driving force in this phenomenon, making it even more prominent for polyamines with higher charges. The results of the study explain the specificity of polyamine interactions with A-tract region of the DNA double helix which is also observed in experiments.

scholarly journals Positively and Negatively Hydrated Counterions in Molecular Dynamics Simulations of DNA Double Helix

2020 ◽  
Vol 65 (6) ◽  
pp. 510
Author(s):  
S. Perepelytsya
Keyword(s):  
Molecular Dynamics ◽  
Molecular Dynamics Simulations ◽  
Double Helix ◽  
Dipole Moments ◽  
Hydration Shell ◽  
Minor Groove ◽  
Water Molecules ◽  
Negative Hydration ◽  
Dynamics Simulations ◽  
Dna Double Helix

The DNA double helix is a polyanionic macromolecule that is neutralized in water solutions by metal ions (counterions). The property of counterions to stabilize the water network (positive hydration) or to make it friable (negative hydration) is important in terms of the physical mechanisms of stabilization of the DNA double helix. In the present research, the effects of positive hydration of Na+ counterions and negative hydration of K+ and Cs+ counterions incorporated into the hydration shell of the DNA double helix have been studied using molecular dynamics simulations. The results have shown that the dynamics of the hydration shell of counterions depends on the region of the double helix: minor groove, major groove, and outside the macromolecule. The longest average residence time has been observed for water molecules contacting with the counterions localized in the minor groove of the double helix (about 50 ps for Na+ and lower than 10 ps for K+ and Cs+). The estimated potentials of the mean force for the hydration shells of counterions show that the water molecules are constrained too strongly, and the effect of negative hydration for K+ and Cs+ counterions has not been observed in the simulations. The analysis has shown that the effects of counterion hydration can be described more accurately with water models having lower dipole moments.

scholarly journals Double-stranded RNA bending by AU-tract sequences

2020 ◽  
Vol 48 (22) ◽  
pp. 12917-12928
Author(s):  
Alberto Marin-Gonzalez ◽  
Clara Aicart-Ramos ◽  
Mikel Marin-Baquero ◽  
Alejandro Martín-González ◽  
Maarit Suomalainen ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Double Helix ◽  
Structural Features ◽  
Sequence Motif ◽  
Microscopy Imaging ◽  
Rna Nanotechnology ◽  
Sequence Dependent ◽  
Structural Deformations ◽  
Dynamics Simulations ◽  
Dna Double Helix

Abstract Sequence-dependent structural deformations of the DNA double helix (dsDNA) have been extensively studied, where adenine tracts (A-tracts) provide a striking example for global bending in the molecule. However, in contrast to dsDNA, sequence-dependent structural features of dsRNA have received little attention. In this work, we demonstrate that the nucleotide sequence can induce a bend in a canonical Watson-Crick base-paired dsRNA helix. Using all-atom molecular dynamics simulations, we identified a sequence motif consisting of alternating adenines and uracils, or AU-tracts, that strongly bend the RNA double-helix. This finding was experimentally validated using atomic force microscopy imaging of dsRNA molecules designed to display macroscopic curvature via repetitions of phased AU-tract motifs. At the atomic level, this novel phenomenon originates from a localized compression of the dsRNA major groove and a large propeller twist at the position of the AU-tract. Moreover, the magnitude of the bending can be modulated by changing the length of the AU-tract. Altogether, our results demonstrate the possibility of modifying the dsRNA curvature by means of its nucleotide sequence, which may be exploited in the emerging field of RNA nanotechnology and might also constitute a natural mechanism for proteins to achieve recognition of specific dsRNA sequences.

scholarly journals Destabilization of DNA duplexes by oxidative damage at guanine: implications for lesion recognition and repair

2008 ◽  
Vol 5 (suppl_3) ◽  
pp. 191-198 ◽  
Author(s):  
Supat Jiranusornkul ◽  
Charles A Laughton
Keyword(s):  
Oxidative Damage ◽  
Structural Changes ◽  
Double Helix ◽  
Dependent Manner ◽  
Dna Duplexes ◽  
Lesion Site ◽  
Base Pairs ◽  
Energetic Analysis ◽  
Dynamics Simulations ◽  
Dna Double Helix

We have used molecular dynamics simulations to study the structure and dynamics of a range of DNA duplexes containing the 2,6-diamino-4-hydroxy-5-formamidopyrimidine (FapydG) lesion that can result from oxidative damage at guanine. Compared to the corresponding undamaged DNA duplexes, FapydG-containing duplexes show little gross structural changes—the damaged base remains stacked in to the DNA double helix and retains hydrogen bonds to its cytosine partner. However, the experimentally observed reduction in DNA stability that accompanies lesion formation can be explained by a careful energetic analysis of the simulation data. Irrespective of the nature of the base pairs on either side of the lesion site, conversion of a guanine to a FapydG base results in increased dynamical flexibility in the base (but not in the DNA as a whole) that significantly weakens its hydrogen-bonding interactions. Surprisingly, the stacking interactions with its neighbours are not greatly altered. The formamido group adopts a non-planar conformation that can interact significantly and in a sequence-dependent manner with its 3′-neighbour. We conclude that the recognition of FapydG lesions by the repair protein formamidopyrimidine-DNA glycosylase probably does not involve the protein capturing an already-extrahelical FapydG base, but rather it relies on detecting alterations to the DNA structure and flexibility created by the lesion site.

Atomistic account of structural and dynamical changes induced by small binders in the double helix of a short DNA

2014 ◽  
Vol 16 (27) ◽  
pp. 14070-14082 ◽  
Author(s):  
Barbara Fresch ◽  
F. Remacle
Keyword(s):  
Molecular Dynamics ◽  
Molecular Dynamics Simulations ◽  
Double Helix ◽  
Drug Molecules ◽  
Conformational Freedom ◽  
Dna Fragment ◽  
Dynamics Simulations

How drug molecules perturb the conformational freedom of a helical DNA fragment is investigated by molecular dynamics simulations.

scholarly journals Base sequence specificity of counterion binding to DNA: what can MD simulations tell us?

2016 ◽  
Vol 94 (12) ◽  
pp. 1181-1188 ◽  
Author(s):  
Alessio Atzori ◽  
Sonia Liggi ◽  
Aatto Laaksonen ◽  
Massimiliano Porcu ◽  
Alexander P. Lyubartsev ◽  
...  
Keyword(s):  
Electrostatic Interactions ◽  
Md Simulations ◽  
Water Model ◽  
Sequence Specificity ◽  
Major Groove ◽  
Sequence Dependence ◽  
Counterion Binding ◽  
Sequence Recognition ◽  
Solvent Molecules ◽  
Dynamics Simulations

Nucleic acids are highly charged biopolymers whose secondary structure is strongly dependent on electrostatic interactions. Solvent molecules and ions are also believed to play an important role in mediating and directing both sequence recognition and interactions with other molecules, such as proteins and a variety of ligands. Therefore, to fully understand the biological functions of DNA, it is necessary to understand the interactions with the surrounding counterions. It is well known that monovalent counterions can bind to the minor groove of DNA with consecutive sequences of four, or more, adenine and thymine (A-tracts) with relatively long residence times. However, much less is known about their binding to the backbone and to the major groove. In this work, we used molecular dynamics simulations to both investigate the interactions between the backbone and major groove of DNA and one of its physiological counterions (Na+) and evaluate the relationship between these interactions and the nucleotide sequence. Three dodecamers, namely CGAAAATTTTCG, CGCTCTAGAGCG, and CGCGAATTCGCG, were simulated using the Toukan–Rahman flexible SPC water model and Smith and Dang parameters for Na+, revealing a significant sequence dependence on the ion binding to both backbone and major groove. In the absence of experimental data on the atomistic details of the studied interactions, the reliability of the results was evaluated performing the simulations with additional sets of potential parameters for ions and solvent, namely the Ȧqvist or the Joung and Cheatham ion parameters and the TIP3P water model. This allowed us to evaluate the results by verifying which features are preserved independently from the parameters adopted.

scholarly journals Double-stranded RNA bending by AU-tract sequences

2020 ◽  
Author(s):  
Alberto Marin-Gonzalez ◽  
Clara Aicart-Ramos ◽  
Mikel Marin-Baquero ◽  
Alejandro Martín-González ◽  
Maarit Suomalainen ◽  
...  
Keyword(s):  
Double Helix ◽  
Persistence Length ◽  
Arbitrary Sequence ◽  
Sequence Motif ◽  
Double Stranded Rna ◽  
Force Microscopy ◽  
Structural Deformations ◽  
Quaternary Structures ◽  
Dynamics Simulations ◽  
Dna Double Helix

ABSTRACTSequence-dependent structural deformations of the DNA double helix (dsDNA) have been extensively studied, where adenine tracts (A-tracts) provide a striking example for global bending in the molecule. In contrast to dsDNA, much less is known about how the nucleotide sequence affects bending deformations of double-stranded RNA (dsRNA). Using all-atom microsecond long molecular dynamics simulations we found a sequence motif consisting of alternating adenines and uracils, or AU-tracts, that bend the dsRNA helix by locally compressing the major groove. We experimentally tested this prediction using atomic force microscopy (AFM) imaging of long dsRNA molecules containing phased AU-tracts. AFM images revealed a clear intrinsic bend in these AU-tracts molecules, as quantified by a significantly lower persistence length compared to dsRNA molecules of arbitrary sequence. The bent structure of AU-tracts here described might play a role in sequence-specific recognition of dsRNAs by dsRNA-interacting proteins or impact the folding of RNA into intricate tertiary and quaternary structures.

scholarly journals Understanding the Origin of Structural Diversity of DNA Double Helix

Computation ◽  
2021 ◽  
Vol 9 (9) ◽  
pp. 98
Author(s):  
Valeri Poltev ◽  
Victor M. Anisimov ◽  
Veronica Dominguez ◽  
Andrea Ruiz ◽  
Alexandra Deriabina ◽  
...  
Keyword(s):  
Double Helix ◽  
3D Structure ◽  
Structural Diversity ◽  
Local Energy ◽  
Single Chain ◽  
Sequence Dependence ◽  
Torsion Angles ◽  
Sequence Dependent ◽  
Phosphate Backbone ◽  
Dna Double Helix

Deciphering the contribution of DNA subunits to the variability of its 3D structure represents an important step toward the elucidation of DNA functions at the atomic level. In the pursuit of that goal, our previous studies revealed that the essential conformational characteristics of the most populated “canonic” BI and AI conformational families of Watson–Crick duplexes, including the sequence dependence of their 3D structure, preexist in the local energy minima of the elemental single-chain fragments, deoxydinucleoside monophosphates (dDMPs). Those computations have uncovered important sequence-dependent regularity in the superposition of neighbor bases. The present work expands our studies to new minimal fragments of DNA with Watson–Crick nucleoside pairs that differ from canonic families in the torsion angles of the sugar-phosphate backbone (SPB). To address this objective, computations have been performed on dDMPs, cdDMPs (complementary dDMPs), and minimal fragments of SPBs of respective systems by using methods of molecular and quantum mechanics. These computations reveal that the conformations of dDMPs and cdDMPs having torsion angles of SPB corresponding to the local energy minima of separate minimal units of SPB exhibit sequence-dependent characteristics representative of canonic families. In contrast, conformations of dDMP and cdDMP with SPB torsions being far from the local minima of separate SPB units exhibit more complex sequence dependence.

Protamine-DNA interaction

1978 ◽  
Vol 36 (2) ◽  
pp. 200-201
Author(s):  
D.P. Bazett-Jones ◽  
F.P. Ottensmeyer
Keyword(s):  
Small Volume ◽  
Double Helix ◽  
Dna Interaction ◽  
Dark Field ◽  
Sperm Head ◽  
Nuclear Proteins ◽  
Field Electron Microscopy ◽  
Dark Field Electron ◽  
Dna Double Helix ◽  
Positively Charged

Dark field electron microscopy has been used for the study of the structure of individual macromolecules with a resolution to at least the 5Å level. The use of this technique has been extended to the investigation of structure of interacting molecules, particularly the interaction between DNA and fish protamine, a class of basic nuclear proteins of molecular weight 4,000 daltons.Protamine, which is synthesized during spermatogenesis, binds to chromatin, displaces the somatic histones and wraps up the DNA to fit into the small volume of the sperm head. It has been proposed that protamine, existing as an extended polypeptide, winds around the minor groove of the DNA double helix, with protamine's positively-charged arginines lining up with the negatively-charged phosphates of DNA. However, viewing protamine as an extended protein is inconsistent with the results obtained in our laboratory.

Sign in / Sign up

Export Citation Format

Share Document