First Report of Potato Gangrene Caused by Phoma foveata in China

A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 μm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 μm. Chlamydospores were spherical and 27 to 81 × 18 to 63 μm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.

Sensitivity of North American Isolates of Phytophthora erythroseptica and Pythium ultimum to Mefenoxam (Metalaxyl)

A 4-year study (1997 to 2000) was conducted to determine the sensitivities of the potato tuber rot pathogens, Phytophthora erythroseptica and Pythium ultimum, to mefenoxam (metalaxyl). A total of 2,277 tubers showing symptoms of “water rot” were collected from 16 states and 2 Canadian provinces. From these, 849 isolates of P. erythroseptica and 213 isolates of P. ultimum were obtained, and 805 and 190 isolates, respectively, were tested for their ability to grow on V8 medium amended at 0.01 to 100 μg/ml with fungicide. Isolates ranged widely in their responses to mefenoxam. The presence of resistant isolates (EC50 > 100 μg ml-1) of P. erythroseptica in the potato producing areas of Maine was confirmed. The presence of P. erythroseptica isolates in Idaho and Minnesota resistant to mefenoxam is reported for the first time. The proportion of P. erythroseptica isolates resistant to mefenoxam varied from 2.9 to 36.2% between 1997 and 2000. The proportion of resistant P. ultimum isolates represented only a small proportion of the isolates tested (3.7%). A single resistant P. ultimum isolate was recovered from Washington, whereas most of the resistant isolates obtained (5 of 7) were collected in Minnesota during the final year of the study. This is the first report of resistance in P. ultimum pathogenic to potato tubers. These observations suggest that pink rot and leak could become significant problems in the future, particularly in those areas where resistance has been detected. Our results have implications for the effective management of water rot. Monitoring the sensitivity of the pathogen population to mefenoxam in all production areas should be considered and integrated as a part of the overall disease management strategy.

Variation in Aggressiveness of Canadian Isolates of Phytophthora infestans as Indicated by Their Relative Abilities to Cause Potato Tuber Rot

Studies were conducted in 1995, 1996, and 1997 to determine the ability of Canadian isolates of Phytophthora infestans to cause tuber disease in a variety of potato cultivars. Most isolates of recently introduced multilocus genotypes (US-7, US-8, g11, g26, g29, and g40) were more aggressive on tuber tissue than isolates of the traditional US-1 genotype, based on surface necrosis (SN), lesion depth (LD), and compound aggressiveness index (CAI = SN × LD) components. Other multilocus genotypes (g30, g41, g42, and UN-3) were similar in aggressiveness to US-1. The g11 (US-11) genotype consistently displayed aggressiveness that was intermediate to that of the US-8 and US-1 genotypes. Variation also occurred within a multilocus genotype, and an isolate of the US-8 genotype from New Brunswick was consistently less aggressive than other US-8 isolates. Cvs. Dorita and Island Sunshine were consistently the most resistant to infection, regardless of isolate, relative to the more susceptible responses of Green Mountain, Russet Bur-bank, Kennebec, Superior, Shepody, Red Pontiac, Sebago, and Bintje. Even so, isolates of the newly introduced US-8 genotype were able to cause significantly more disease on these resistant cultivars than isolates of the US-1 genotype. The predominant genotypes currently found in potato production areas in Canada (US-8 and g11) have higher fitness on tuber tissue than displaced, preexisting strains (US-1).