scholarly journals First Report of Potato Gangrene Caused by Phoma foveata in China

Plant Disease ◽  
2012 ◽  
Vol 96 (11) ◽  
pp. 1698-1698 ◽  
Author(s):  
C.-D. Yang ◽  
X.-R. Chen ◽  
H.-X. Jiang ◽  
C.-J. Pu
Keyword(s):  
Growth Rate ◽  
Potato Tuber ◽  
Genomic Dna ◽  
Management Strategies ◽  
Morphological Characteristics ◽  
Pathogenic Fungi ◽  
Gansu Province ◽  
Potato Tubers ◽  
Black Bodies ◽  
Potato Tuber Rot

A potato tuber rot disease of unknown cause, affecting 5 to 15% of the potato tuber, was observed at Gansu Province of China in March 2010. Sunken, round, oval, or irregular lesions formed at the umbilicus or buds of potato tubers after 30 days of storage at 4°C. These lesions gradually expanded to form khaki, lavender sunken lesions ranging from 1 to 3 cm. Small black bodies were observed in the center of the lesions after 45 days. Twenty-six diseased tubers were collected and surface sterilized with 75% alcohol. Diseased tissue was then directly transferred to potato dextrose agar (PDA) medium for isolation of pathogenic fungi. Eight fungal isolates from disease tubers were obtained and pathogenicity was evaluated. Conidial suspensions (106 CFU/ml) of per isolate were sprayed on 20 potato tubers, respectively. These potato tubers were stabbed about 20 times with five wounds in a row along the tuber and maximum distance between each row. Wounds were made 2 mm deep and 0.5 mm in diameter with a no. 4 insect needle. Control tubers received water without conidia. The inoculated tubers were put in an incubator at 15°C after 72 h with relative humidity 100%. Assays were repeated three times. Typical symptoms of the disease were observed 14 days after inoculation. Pycnidia sharing the characteristics of the inoculated isolates were retrieved from new lesions after 6 weeks, whereas symptoms did not occur on control tubers. Eight isolates were cultured on PDA medium for 7 days at 20°C and then at 5°C for approximately 30 days to determine cultural and morphological characteristics. Pycnidia were black brown, spherical or oblate, scattered or clustered, and ranged from 82 to 210 × 64 to 175 μm. Conidia were unicellular and colorless, and 2.1 to 4.4 × 5.8 to 11.5 μm. Chlamydospores were spherical and 27 to 81 × 18 to 63 μm. The fungi shared morphological characteristics of P. foveata described in the literature. On oat medium (OA), yellow-green, needle-like crystals were formed. The growth rate of the pathogen on MA and OA was 1.0 cm/day. The pathogens were identified as P, foveata based on the symptoms, morphology, and growth rate (1, 2, 3). Genomic DNA was extracted with UNIQ-10 column fungal genomic DNA extraction kit and ribosomal DNA was amplified with ITS1(TCCGTAGGTGAACCTGCGG) and ITS4 (TCCTCCGCTTATTGATATGC) primers. The nucleotide sequence of the 539-bp amplicon (GenBank Accession No. JQ804843) was 99% identical to the ITS sequence from P. foveata available from GenBank (GU237742). Management strategies for potato disease control must be adjusted for the presence and control of gangrene disease in Gansu Province. References: (1) G. H. Boerema et al. Page 220 in: Phoma Identification Manual. CABI Publishing, Wallingford, UK, 2004. (2) EPPO. Quarantine pests for Europe University Press, Cambridge. 865, 1997. (3) W. R. Stevenson et al. Page 25 in: Compendium of Potato Diseases, 2nd Edition. APS Press, St. Paul, MN, 2004.

scholarly journals First Report of Fusarium ipomoeae Causing Peanut leaf Spot in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Manlin Xu ◽  
Xia Zhang ◽  
Jing Yu ◽  
zhiqing Guo ◽  
Ying Li ◽  
...  
Keyword(s):  
Leaf Spot ◽  
Genomic Dna ◽  
Block Design ◽  
Management Strategies ◽  
Morphological Characteristics ◽  
Ethanol Solution ◽  
Distilled Water ◽  
Conidial Suspension ◽  
Internal Transcribed Spacer Region ◽  
First Report

Peanut (Arachis hypogaea L.) is one of the most economically important crops as an important source of edible oil and protein. In August 2020, circular to oval-shaped brown leaf spots (2-6 mm in diameter) with well-defined borders surrounded by a yellow margin were observed on peanut plant leaves in Laixi City, Shandong Province, China. Symptomatic plants randomly distributed in the field, the incidence was approximately 5%. Leave samples were collected consisted of diseased tissue and the adjacent healthy tissue. The samples were dipped in a 70% (v/v) ethanol solution for 30 s and then soaked in a 0.1% (w/v) mercuric chloride solution for 60 s. The surface-sterilized tissues were then rinsed three times with sterile distilled water, dried and placed on Czapek Dox agar supplemented with 100 μg/ml of chloramphenicol. The cultures were incubated in darkness at 25 °C for 3–5 days. Fungal colonies were initially white and radial, turning to orange-brown in color, with abundant aerial mycelia. Macroconidia were abundant, 4 to 7 septate, with a dorsiventral curvature, and were 3.3–4.5 × 18.5–38.1 μm (n=100) in size; microconidia were absent; chlamydospores were produced in chains or clumps, ellipsoidal to subglobose, and thick walled. The morphological characteristics of the conidia were consistent with those of Fusarium spp. To identify the fungus, an EasyPure Genomic DNA Kit (TransGEN, Beijing, China) was used to extract the total genomic DNA from mycelia. The internal transcribed spacer region (ITS rDNA) and the translation elongation factor 1-α gene (TEF1) were amplified with primers ITS1/ITS4 (White et al. 1990) and EF1/EF2 (O’Donnell et al. 1998), respectively. Based on BLAST analysis, sequences of ITS (MT928727) and TEF1 (MT952337) showed 99.64% and 100% similarity to the ITS (MT939248.1), TEF1 (GQ505636.1) of F. ipomoeae isolates. Sequence analysis confirmed that the fungus isolated from the infected peanut was F. ipomoeae (Xia et al. 2019). The pathogenicity of the fungus was tested in the greenhouse. Twenty two-week-old peanut seedlings (cv. Huayu20) grown in 20-cm pots (containing autoclaved soil) were sprayed with a conidial suspension (105 ml−1) from a 15-day-old culture. Control plants were sprayed with distilled water. The experiment was conducted as a randomized complete block design, and placed at 25 °C under a 12-h photoperiod with 90% humidity. Symptoms similar to those in the field were observed on leaves treated with the conidial suspension ten days after inoculation, but not on control plants. F. ipomoeae was re-isolated from symptomatic leaves but not from the control plants. Reisolation of F. ipomoeae from inoculated plants fulfilled Koch's postulates. To our knowledge, this is the first report of F. ipomoeae causing peanut leaf spot in China. Our report indicates the potential spread of this pathogen in China and a systematic survey is required to develop effective disease management strategies.

Encasement in plant morphology: an integrative approach from genes to organisms

2005 ◽  
Vol 83 (10) ◽  
pp. 1207-1221 ◽  
Author(s):  
Christian Lacroix ◽  
Bernard Jeune ◽  
Denis Barabé
Keyword(s):  
Growth Rate ◽  
Morphological Characteristics ◽  
Plant Morphology ◽  
Integrative Approach ◽  
Structural Level ◽  
Classical Approach ◽  
Developmental Genes ◽  
Qualitative And Quantitative ◽  
New Concepts ◽  
Dynamic Morphology

Recent advances in molecular genetics are prompting developmental plant morphologists to refine the theoretical context of their field. For example, at the level of the action of certain developmental genes, the distinction between recognized structural categories (i.e., stem and leaf) are not obvious. This issue has also been analyzed by morphologists from qualitative and quantitative perspectives and has lead to similar conclusions. Consequently, the classical approach to morphology with a typological view of organ categories is no longer sufficient to explain the set of all possible forms. However, within the context of a dynamic morphology, where processes of development such as growth rate, duration, and distribution are considered, a more encompassing view of the generation of form can be achieved. We therefore propose that classical morphology is a subset of dynamic morphology. The main goal of this paper is to show how new concepts and methods of viewing plant morphology allow us to build a conceptual theoretical framework that may have a predictive value with respect to morphological characteristics as well as molecular properties of organs. The main premise of this commentary, within the context of dynamic morphology, is that the plant consists of an encasement of structures or a nesting of partially similar units. Common developmental processes are in operation at each structural level and variations in the modalities of these processes lead to the development of specific structures. Repeating polymorphic sets (RPS) represent an extension of this perspective on plant development and have the potential to predict the existence of new, perhaps unknown forms. The idea of repeating polymorphic sets can also be extended to outline the activity of specific developmental genes to explain how a wide variety of those genes are interrelated during development to specify form.

Detection of oomycide-insensitive Phytophthora isolates in Maryland ornamental nurseries and Mid-Atlantic landscapes provide data for reconsidering management strategies

2021 ◽  
Author(s):  
Justine Beaulieu ◽  
Johanna Del Castillo Munera ◽  
Yilmaz Balci
Keyword(s):  
Growth Rate ◽  
Mycelial Growth ◽  
Management Strategies ◽  
Resistance Management ◽  
Phytophthora Species ◽  
Oak Forests ◽  
Relative Growth ◽  
Off Label ◽  
Potting Media ◽  
Almost All

Five Phytophthora species comprising a total of 243 isolates (77 P. cinnamomi, 23 P. citrophthora, 18 P. multivora, 18 P. pini, and 107 P. plurivora) were screened for sensitivity to mefenoxam, fosetyl-Al, dimethomorph, dimethomorph + ametoctradin and fluoxastrobin using amended agar assays. Mefenoxam-insensitive isolates were detected within P. cinnamomi (4%), P. multivora (11%), and P. plurivora (12%) even at approximately 2.5x the recommended label rate. These isolates were also insensitive to higher (off-label) concentrations of fluoxastrobin. Concentrations of dimethomorph (400 g/mL) and dimethomorph + ametoctradin (100 g/mL) were mostly effective in mycelial growth inhibition, but two P. plurivora isolates were insensitive, suggesting that resistance management is required. All mefenoxam-insensitive isolates were sensitive to fosetyl-Al at the label rate. Surprisingly, the populations of P. cinnamomi from mid-Atlantic oak forests included insensitive isolates. With almost all species, isolates recovered from asymptomatic hosts (e.g., soil/potting media collected of randomly selected asymptomatic hosts) had a significantly greater relative growth rate when compared to isolates recovered from symptomatic hosts (e.g., isolates recovered from lesions or wilted plants). These findings suggest that mefenoxam should no longer be used to manage oomycetes in Maryland ornamental nurseries and that the use of fluoxastrobin should be limited.

scholarly journals Application of the new Morphological Quality Index in the Cordevole river (BL, Italy)

2013 ◽  
Vol 44 (2s) ◽  
Author(s):  
E. Rigon ◽  
J. Moretto ◽  
F. Delai ◽  
L. Picco ◽  
D. Ravazzolo ◽  
...  
Keyword(s):  
Quality Index ◽  
Management Strategies ◽  
Morphological Characteristics ◽  
Site Investigation ◽  
Integrated Approach ◽  
Large Wood ◽  
River Types ◽  
River Corridor ◽  
The Eu

The evaluation of the morphological quality of rivers is essential to define the level of alteration and for implementing future management strategies that consider also hazards related to fluvial processes and channel dynamics. This type of evaluation is particularly significant for the Italian rivers, that, as in many other European countries, have a very high level of human pressure. Recently, in Italy, the National Institute for Environmental Protection and Research has promoted a methodology named IDRAIM for hydromorphological analysis of streams that pursues an integrated approach aimed at a harmonized implementation of both the EU Water Framework Directive (WFD, 2000/60/EC), and the EU Floods Directive (2007/60/EC). In this paper we present the application of the Morphological Quality Index (MQI) protocol, which is part of IDRAIM, to determine the assessment of the morphological quality of the Cordevole River. The water network (only collectors greater than thirdorder were considered), has been divided, through GIS software, into 132 river reaches of homogeneous morphological characteristics, according to the first phase of the method. At this stage the semi-automatic calculation of lateral confinement (defined by “degree of confinement” and a “confinement index”) was tried, in order to reduce the implementing time. The application of 28 indicators was made for 42 reaches representing the major river types and human pressures in the site investigation. The results showed that 48% of the analyzed reaches have a very good or good quality status, 38% have a moderate morphological quality, while only 14% have the characteristics of poor or very poor quality. The main causes that lead to a strong alteration of the terms of reference are linked to i) poor connectivity between hillslopes and river corridor, that is very important for the natural supply of sediment and large wood; ii) absence of vegetation in the river corridor, that is functional to a range of geomorphic processes; iii) presence of artificial elements, particularly the bedload interception structures in the catchment, bank protection along the reach, and the removal of sediment, large wood and vegetation.

scholarly journals Morphological and Molecular Diversity of Ginger (Zingiber officinale Roscoe) Pathogenic Fungi in Chilga District, North Gondar, Ethiopia

2022 ◽  
Vol 2 ◽  
Author(s):  
Sefinew Tilahun ◽  
Marye Alemu ◽  
Mesfin Tsegaw ◽  
Nega Berhane
Keyword(s):  
Causative Agent ◽  
Fungal Pathogens ◽  
Pathogenic Fungus ◽  
Management Strategies ◽  
Infected Plant ◽  
Pathogenic Fungi ◽  
Zingiber Officinale ◽  
Morphological Characterization ◽  
Molecular Techniques ◽  
Diseased Plant

Ginger diseases caused by fungal pathogens have become one of the most serious problems causing reduced production around the world. It has also caused a major problem among farmers in different parts of Ethiopia resulting in a huge decline in rhizome yield. However, the exact causative agents of this disease have not been identified in the state. Although there are few studies related to pathogenic fungus identification, molecular level identification of fungal pathogen was not done in the area. Therefore, this study was undertaken to isolate and characterized the fungal causative agent of ginger disease from the diseased plant and the soil samples collected around the diseased plant from Chilga district, Gondar, Ethiopia. Samples from infected ginger plants and the soil around the infected plant were collected. Culturing and purification of isolates were made using Potato Dextrose Agar supplemented with antibacterial agent chloramphenicol. The morphological characterization was done by structural identification of the isolates under the microscope using lactophenol cotton blue stains. Isolated fungi were cultured and molecular identification was done using an internal transcribed spacer (ITS) of ribosomal DNA (rDNA). A total of 15 fungal morphotypes including 11 Aspergillus spp. (73.3%), 2 Penicillium spp. (13.3%), and single uncultured fungus clone S23 were isolated from the samples representing all the plant organs and the soil. Aspergillus spp. (73.3%) was the most common and seems to be the major causative agent. To the best of our knowledge, this is the first report of ginger pathogenic fungi in Ethiopia identified using ITS rDNA molecular techniques. This study will lay foundation for the development of management strategies for fungal diseases infecting ginger.

scholarly journals On the potato tuber rot caused by Pratylenchus sp.

1956 ◽  
Vol 2 ◽  
pp. 5-7
Author(s):  
I. TANAKA ◽  
K. MIYAMOTO ◽  
H. FUJII ◽  
H. AIKAWA
Keyword(s):  
Potato Tuber ◽  
Potato Tuber Rot ◽  
Tuber Rot

scholarly journals First report of Leptosphaeria biglobosa ‘canadensis’ causing blackleg on oilseed rape (Brassica napus) in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Tao Luo ◽  
Guoqing Li ◽  
Long Yang
Keyword(s):  
Brassica Napus ◽  
Oilseed Rape ◽  
Southern China ◽  
Disease Incidence ◽  
Morphological Characteristics ◽  
Gansu Province ◽  
Bootstrap Support ◽  
First Report ◽  
Fungal Isolates ◽  
Leptosphaeria Biglobosa

Oilseed rape (Brassica napus L.) is one of the most important oilseed crops in China. It is widely cultivated in China, with winter oilseed rape in Yangtze River basin and in southern China, and spring oilseed rape in northern China. In August 2017, a survey for Leptosphaeria spp. on spring oilseed rape was conducted in Minle county, Zhangye city, Gansu Province, China. The symptoms typical of blackleg on basal stems of oilseed rape were observed in the field. A large number of black fruiting bodies (pycnidia) were present on the lesions (Fig. 1A). The disease incidence of basal stem infection in the surveyed field was 19%. A total of 19 diseased stems were collected to isolate the pathogen. After surface sterilizing (75% ethanol for 30 s, 5% NaOCl for 60 s, followed by rinsing in sterilized water three times), diseased tissues were cultured on acidified potato dextrose agar (PDA) plates at 20°C for 7 days. Twelve fungal isolates were obtained. All fungal isolates produced typical tan pigment on PDA medium, and produced pycnidia after two weeks (Fig. 1B). Colony morphological characteristics indicated that these isolates might belong to Leptosphaeria biglobosa. To confirm identification, multiple PCR was conducted using the species-specific primers LmacF, LbigF, LmacR (Liu et al. 2006). Genomic DNA of each isolate was extracted using the cetyltrimethylammonium bromide (CTAB) method. DNA samples of L. maculans isolate UK-1 and L. biglobosa isolate W10 (Cai et al. 2015) were used as references. Only a 444-bp DNA band was detected in all 12 isolates and W10, whereas a 333-bp DNA band was detected only in the UK-1 isolate (Fig. 1C). PCR results suggested that these 12 isolates all belong to L. biglobosa. In addition, the internal transcribed spacer (ITS) region of these 12 isolates was analyzed for subspecies identification (Vincenot et al. 2008). Phylogenetic analysis based on ITS sequence showed that five isolates (Lb1134, Lb1136, Lb1138, Lb1139 and Lb1143) belonged to L. biglobosa ‘brassicae’ (Lbb) with 78% bootstrap support, and the other seven isolates (Lb1135, Lb1137, Lb1140, Lb1141, Lb1142, Lb1144 and Lb1145) belonged to L. biglobosa ‘canadensis’ (Lbc) with 95% bootstrap support (Fig. 1D). Two Lbb isolates (Lb1134 and Lb1136) and two Lbc isolates (Lb1142 and Lb1144) were randomly selected for pathogenicity testing on B. napus cultivar Zhongshuang No. 9 (Wang et al. 2002). Conidial suspensions (10 μL, 1 × 107 conidia mL-1) of these four isolates were inoculated on needle-wounded cotyledons (14-day-old seedling), with 10 cotyledons (20 wounded sites) per isolate. A further 10 wounded cotyledons were inoculated with water and served as controls. Seedlings were maintained in a growth chamber at 20°C with 100% relative humidity and a 12-h photoperiod. After 7 days, cotyledons inoculated with the four isolates showed necrotic lesions in the inoculated wounds. Control cotyledons had no symptoms (Fig. 2). Fungi re-isolated from the infected cotyledons showed similar colony morphology as the original isolates. Therefore, L. biglobosa ‘brassicae’ and L. biglobosa ‘canadensis’ appear to be the pathogens causing the observed blackleg symptoms on spring oilseed rape in Gansu, China. In previous studies, L. biglobosa ‘brassicae’ has been found in many crops in China, including oilseed rape (Liu et al. 2014; Cai et al. 2015), Chinese radish (Raphanus sativus) (Cai et al. 2014a), B. campestris ssp. chinensis var. purpurea (Cai et al. 2014b), broccoli (B. oleracea var. italica) (Luo et al. 2018), ornamental kale (B. oleracea var. acephala) (Zhou et al. 2019a), B. juncea var. multiceps (Zhou et al. 2019b), B. juncea var. tumida (Deng et al. 2020) and Chinese cabbage (B. rapa subsp. pekinensis) (Yu et al. 2021 accepted). To the best of our knowledge, this is the first report of L. biglobosa ‘canadensis’ causing blackleg on B. napus in China.

scholarly journals First report of Diaporthe ueckerae causing stem canker on soybean (Glycine max L.) in Colombia

Plant Disease ◽  
2021 ◽  
Author(s):  
Nathali López-Cardona ◽  
YUDY ALEJANDRA GUEVARA ◽  
Lederson Gañán-Betancur ◽  
Carol Viviana Amaya Gomez
Keyword(s):  
Management Strategies ◽  
Elongation Factor ◽  
Morphological Characteristics ◽  
Aerial Mycelium ◽  
Stem Canker ◽  
Growth Stages ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Glycine Max L ◽  
Soybean Plants

In October 2018, soybean plants displaying elongated black to reddish-brown lesions on stems were observed in a field planted to the cv. BRS Serena in the locality of Puerto López (Meta, Colombia), with 20% incidence of diseased plants. Symptomatic stems were collected from five plants, and small pieces (∼5 mm2) were surface sterilized, plated on potato dextrose agar (PDA) and incubated for 2 weeks at 25°C in darkness. Three fungal isolates with similar morphology were obtained, i.e., by subculturing single hyphal tips, and their colonies on PDA were grayish-white, fluffy, with aerial mycelium, dark colored substrate mycelium, and produced circular black stroma. Pycnidia were globose, black, occurred as clusters, embedded in tissue, erumpent at maturity, with an elongated neck, and often had yellowish conidial cirrus extruding from the ostiole. Alpha conidia were observed for all isolates after 30 days growth on sterile soybean stem pieces (5 cm) on water agar, under 25ºC and 12 h light/12h darkness photoperiod. Alpha conidia (n = 50) measured 6.0 – 7.0 µm (6.4 ± 0.4 µm) × 2.0 – 3.0 µm (2.5± 0.4 µm), were aseptate, hyaline, smooth, ellipsoidal, often biguttulate, with subtruncate base. Beta conidia were not observed. Observed morphological characteristics of these isolates were similar to those reported in Diaporthe spp. by Udayanga et al. (2015). DNA from each fungal isolate was used to sequence the internal transcribed spacer region (ITS), and the translation elongation factor 1-α (TEF1) gene, using the primer pairs ITS5/ITS4 (White et al. 1990) and EF1-728F/EF1- 986R (Carbone & Kohn, 1999), respectively. Results from an NCBI-BLASTn, revealed that the ITS sequences of the three isolates (GenBank accessions MW566593 to MW566595) had 98% (581/584 bp) identity with D. miriciae strain BRIP 54736j (NR_147535.1), whereas the TEF1 sequences (GenBank accessions MW597410 to MW597412) had 97 to 100% (330-339/339 bp) identity with D. ueckerae strain FAU656 (KJ590747). The species Diaporthe miriciae R.G. Shivas, S.M. Thomps. & Y.P. Tan, and Diaporthe ueckerae Udayanga & Castl. are synonymous, with the latter taking the nomenclature priority (Gao et al. 2016). According to a multilocus phylogenetic analysis, by maximum likelihood, the three isolates clustered together in a clade with reference type strains of D. ueckerae (Udayanga et al. 2015). Soybean plants cv. BRS Serena (growth stages V3 to V4) were used to verify the pathogenicity of each isolate using a toothpick inoculation method (Mena et al. 2020). A single toothpick colonized by D. ueckerae was inserted directly into the stem of each plant (10 plants per isolate) approximately 1 cm below the first trifoliate node. Noncolonized sterile toothpicks, inserted in 10 soybean plants served as the non-inoculated control. Plants were arbitrarily distributed inside a glasshouse, and incubated at high relative humidity (>90% HR). After 15 days, inoculated plants showed elongated reddish-brown necrosis at the inoculated sites, that were similar to symptoms observed in the field. Non-inoculated control plants were asymptomatic. Fungal cultures recovered from symptomatic stems were morphologically identical to the original isolates. This is the first report of soybean stem canker caused by D. ueckerae in Colombia. Due to the economic importance of this disease elsewhere (Backman et al. 1985; Mena et al. 2020), further research on disease management strategies to mitigate potential crop losses is warranted.

scholarly journals Management of Postharvest Diseases of Vegetables in a Tropical and Sub-tropical Environment of the Kingdom of Eswatini

2020 ◽  
pp. 1-13
Author(s):  
Diana M. Earnshaw ◽  
Michael T. Masarirambi ◽  
Bonginkhosi E. Dlamini ◽  
Kwanele A. Nxumalo
Keyword(s):  
Management Strategies ◽  
Pathogenic Fungi ◽  
Essential Amino Acids ◽  
Point Of View ◽  
Postharvest Diseases ◽  
Household Level ◽  
Post Harvest ◽  
Side Dish ◽  
Opportunistic Pathogenic ◽  
And Storage

Vegetables are important in human diets as a side dish eaten either cooked or raw as in salads. They are important for their nutritional contribution as major sources of minerals, vitamins, nine essential amino acids, beneficial phytochemicals, fibre and interesting colour from an aesthetic point of view. Despite the immerse health benefits offered by vegetables there are challenges encountered in their post-harvest handling and storage up to consumption. Challenges include post-harvest losses due to diseases. Some losses occur even at household level when vegetables are not stored appropriately when stored under the sink where humidity can be high leading to an environment which promotes diseases. Diseases in the post-harvest chain are caused by bacteria and opportunistic pathogenic fungi. Post-harvest losses of vegetables are not only a threat to nutritional security but a threat to food security as well. The aim of this research study was to document major post-harvest diseases of vegetables found in the Kingdom of Eswatini and to suggest appropriate management strategies or ways of alleviating them.

Consistent patterns of maturity and density-dependent growth among populations of walleye (Sander vitreus): application of the growing degree-day metric

2010 ◽  
Vol 67 (7) ◽  
pp. 1057-1067 ◽  
Author(s):  
Paul A. Venturelli ◽  
Nigel P. Lester ◽  
Terry R. Marshall ◽  
Brian J. Shuter
Keyword(s):  
Growth Rate ◽  
Explanatory Power ◽  
Management Strategies ◽  
Fold Increase ◽  
Fish Growth ◽  
Growing Degree Days ◽  
Sander Vitreus ◽  
Degree Days ◽  
Regional Management ◽  
Dependent Growth

Growing degree-days (GDD, °C·days) are an index of ambient thermal energy that relates directly to an ectotherm’s cumulative metabolism but is rarely used to describe growth and development in fish. We applied GDD to length and maturity data from 416 populations of walleye ( Sander vitreus ) from Ontario and Quebec, Canada (mean annual GDD = 1200 to 2300 °C·days). On average, males matured after they had experienced 6900 °C·days and reached 350 mm total length (L) (n = 77 populations), and females matured after 10 000 °C·days and at 450 mm L (n = 70). Across 143 populations, GDD accounted for up to 96% of the variation in the length of immature walleye but also revealed a twofold difference in growth rate that was indicative of variation in food availability. When applied to data from eight populations in which walleye abundances have changed dramatically over time, GDD revealed a 1.3-fold increase in immature growth rate when abundance was low compared with when it was high. Our results both demonstrate the explanatory power of GDD with respect to fish growth and maturity and inform the development of regional management strategies for walleye.

Sign in / Sign up

Export Citation Format

Share Document