Different Host Plants Distinctly Influence the Feeding Ability of the Brown Citrus Aphid Toxoptera citricida

Piercing–sucking insects are important crop pests, and an understanding of their feeding behavior and population development plays a crucial role in studying insect population dynamics and crop resistance. In our study, we examined the probing behavior of the brown citrus aphid, Toxoptera citricida, using electropenetrography and assessed its population development after 8 days on seven host plants: Yuzu, Citrus junos Sieb. ex Tanaka; Rough Lemon, C. jambhiri Lush.; ‘Luofu’ kumquat, Fortunella margarita Swingle; ‘Olinda’ valencia orange, C. sinensis (L.) Osbeck; ‘Yanxiwanlu’ Ponkan, C. reticulata Blanco; ‘Rohde Red’ valencia orange, C. sinensis; and ‘Eureka’ lemon, C. limon (L.) Osbeck. The results demonstrated that probing by the brown citrus aphid differed significantly according to the target hosts. Toxoptera citricida produced significantly more pathway activities on Eureka than on Rough Lemon and Yuzu. Toxoptera citricida spent more time from the first probe to first salivation into phloem sieve elements on Eureka compared to Yuzu. In addition, the total duration of ingestion from sieve cells of each aphid in the phloem-feeding phase was shortest on Eureka, and this was significantly shorter than that on Yuzu, Rough Lemon, Luofu, and Olinda. The population number of T. citricida on Eureka after 8 days was significantly lower than that on the other hosts. Overall, Eureka was found to have obvious resistance to T. citricida, whereas Yuzu and Rough Lemon were susceptible host plants. These results provide a theoretical basis for exploring aphid-resistant fruit tree resources using resistant varieties.

Incidence of Citrus Tristeza Virus and its Vector Toxoptera citricida in Different Parts of Assam and Nagaland, India

A field survey was conducted in 2018 to study the incidence of citrus tristeza virus (CTV) and its aphid vectors, in different citrus growing regions of the states of Assam and Nagaland, India. Leaf samples of Assam lemon (Citrus limon) and Khasi mandarin (Citrus reticulata) were collected from four districts of Assam (Jorhat, Tinsukia, Sivasagar and Golaghat) and two districts of Nagaland (Mokokchung and Wokha). Citrus leaf samples were collected from a total of 190 citrus plants and were used for detection of CTV infection through Double Antibody Sandwich-Enzyme linked Immuno-Sorbent Assay (DAS-ELISA). According to the results, 75 per cent CTV disease incidence was detected in surveyed areas of Assam and 24.55 per cent CTV disease incidence was detected in surveyed areas of Nagaland. District wise, the highest CTV disease incidence (96.67 %) was detected in Tinsukia district of Assam and the lowest (21.43 %) was detected in Mokokchung district of Nagaland. Aphid samples were also collected during the survey and the presence of the vector Toxoptera citricida, in all the locations was determined.

INVASIVE PESTS DETECTED IN SOME GREENHOUSES OF EREVAN CITY

The following invasive species: Toxoptera aurantii Boyer de Fonscolombe, Toxoptera citricida Kirkaldy, Macrosiphoniteella sanborni Latr, Toxoptera , Macrosiphoniella Del Guercio), Trialeurodes vaporariorum Westwood (Aleyrodidae West., Trialeurodes Cockerell), Tetranychus viennensis Zacher (Tetranychidae Donn, Tetranychus Dufour), and Cenopalpus mespili Lufour. et Mitrofanov (Tenuipalpidae Sayed, Cenopalpus Pritchard & Baker) were identified during studying of the pest fauna of three greenhouse complexes ("Grig Garden", "Green Paradise" and "Avan") in Yerevan which are specialized on the cultivation of ornamental plants. Insecticide and acaricide resistant lines of Tetranychus viennensis and Macrosiphum rosae were found in two greenhouse complexes.

Porta-enxertos híbridos de citros tolerantes ao Citrus tristeza vírus (CTV) / Hybrid Citrus Rootstocks Tolerant to Citrus Tristeza Virus (CTV)

A citricultura brasileira lidera o mercado de exportação mundial. A tristeza dos citros é uma doença endêmica causada pelo Citrus tristeza virus (CTV), que é transmitido pelo pulgão preto dos citros, Toxoptera citricida (Kirkaldy). O controle da tristeza é feito, principalmente, pela utilização de porta-enxertos tolerantes ao CTV. Este trabalho teve como objetivo avaliar o comportamento de 50 híbridos de porta-enxerto de citros, gerados pelo Programa de Melhoramento Genético de Citros da Embrapa Mandioca e Fruticultura, quanto à infecção natural pelo CTV. Amostras de cada híbrido foram coletadas no campo experimental e casas teladas da Embrapa em Cruz das Almas. A mostra estava composta por 10 ramos novos, coletados em diferentes quadrantes da planta, que foram avaliados quanto à presença de caneluras por escala de notas: 1. Ausência de caneluras; 2. Presença de caneluras esparsas; 3. Número intermediário de caneluras; 4. Várias caneluras superficiais ou poucas caneluras profundas; 5. Toda a superfície do ramo coberta por caneluras superficiais ou profundas. A avaliação da infecção pelo CTV foi realizada no Laboratório de Biologia Molecular do Campo Avançado da Embrapa no CETAB/Seagri-BA. As amostras inicialmente foram avaliadas por sorologia, utilizando a técnica de ELISA indireto, com antissoro policlonal contra o CTV. Entretanto, as amostras que apresentaram resultados negativos no teste sorológico, foram também avaliadas por RT-PCR. Para tanto, foi realizada a extração de dsRNA a partir da casca de ramos de cada amostra. A extração de dsRNA foi feita com nitrogênio líquido e o precipitado final foi ressuspendindo em 50ul de água livre de RNAse, tratados com DNAse (Promega®). Na reação de transcrição reversa (RT) foi utilizada a enzima M-MLV (Promega®), de acordo com as recomendações do fabricante. Utilizou-se nessa etapa 5ul do dsRNA obtido, primer randômico (250ng/ul), dNTP (10mM), tampão M-MLV, RNase out e M- MLV, totalizando um volume de 25ul. Para PCR, utilizou-se 3ul do DNA obtido na RT, dNTP (2,5mM), tampão Tris/KCl (10x), MgCl2 (50mM), Taq polimerase (5U/ul) e os primers específicos para o CTV F- CN119 (5’ AGATCTACCATGGACGACGAAACAAAG3’) e R-CN120 (5’ GAATTCGCGGCCGCTCAACGTGTGTTAAATTTCC 3’), para um volume final de 25ul. O ciclo de reação adotado foi de 94°C/2min, 55°C/30seg e 72°C/1min, respectivamente. A maioria dos híbridos avaliados foi suscetível ao CTV, mas não desenvolveram os sintomas de canelura, sendo considerados tolerantes ao patógeno. Significado e impacto do trabalho: Apesar de atualmente controlada, a tristeza dos citros constitui ainda uma ameaça aos produtores de citros, já que é endêmica no Brasil. Diante desse fato, a avaliação do comportamento de híbridos gerados pelo Programa de Melhoramento Genético de Citros da Embrapa em relação ao CTV, é uma etapa determinante na seleção de novas variedades.

Alternative insecticides in the control of the brown citrus aphid Toxoptera citricida (Hemiptera: Aphididae)

The objective of this study was to evaluate the efficacy of alternative insecticides to control the brown citrus aphid Toxoptera citricida (Hemiptera: Aphididae). The treatments consisted of neem oil Azadirachta indica (Sapindales: Meliaceae); smoke syrup Nicotiana tabacum (Solanales: Solanaceae); coconut soap solution (commercial product); black pepper extract Piper nigrum (Piperales: Piperaceae); chemical insecticide Decis® 25 EC; and distilled water. Ten adult insects were placed on a filter paper in a Petri dish, applying 1.5 mL of each treatment to each dish, kept in a BOD-type air-conditioned chamber at a temperature of 25 ± 1 °C and a photophase of 12 hours. The experimental design used was completely randomized, using six treatments with six repetitions, consisting of 10 aphids. Survival assessment were performed at 6, 12, 18 and 24 hours after application of treatments. The alternative insecticides coconut soap and the smoke syrup caused the mortality of 45% and 38.3%, respectively, of the T. citricida at 24 hours after application, showing promising in the control of this pest.

Asymmetric Interaction between Aphis spiraecola and Toxoptera citricida on Sweet Orange Induced by Pre-Infestation

Indirect interactions between herbivorous insects that share the same host have been focused on insects feeding on herbaceous plants, while few studies investigate similar interactions on woody plants. We investigated performance and feeding behavior of two citrus aphids, Aphis spiraecola Patch and Toxoptera citricida Kirkaldy, on sweet orange as affected by prior infestation of conspecifics and heterospecifics. Results showed that pre-infestation-induced interactions between A. spiraecola and T. citricida were asymmetric, with A. spiraecola gaining more fitness. In detail, pre-infestation by A. spiraecola decreased adult weight, enhanced survival rate and accelerated phloem sap acceptance of conspecifics. However, A. spiraecola pre-infestation did not affect performance or feeding behavior of T. citricida. In another infestation sequence, the pre-infestation of T. citricida did not affect conspecifics, but positively affected heterospecifics, indicated as a decreased pre-reproductive period, enhanced survival rate, adult weight, fecundity, and feeding efficiency, i.e., faster access and acceptance of phloem sap, and longer phloem sap ingestion duration. Furthermore, we found A. spiraecola pre-infestation enhanced amino acid concentration, amino acid to sugar ratio, activated salicylic acid and jasmonic acid marker gene expression, while T. citricida pre-infestation only depressed jasmonic acid marker gene expression. Changes in nutrient and phytohormone-dependent defense probably underlie the asymmetric effect.

Titer Variation of Citrus Tristeza Virus in Aphids at Different Acquisition Access Periods and Its Association with Transmission Efficiency

Tristeza, caused by citrus tristeza virus (CTV; Closterovirus, Closteroviridae), is of significant economic importance. Tristeza epidemics have caused severe declines in productivity, and even death, of millions of citrus trees on sour orange rootstock in many regions all over the world. In the field, CTV is most efficiently vectored by the brown citrus aphid (Toxoptera citricida (Kirkaldy)) in a semipersistent manner. The transmission efficiency of the vector is influenced by its acquisition access period (AAP) for CTV. A real-time RT-PCR assay using SYBR Green fluorescent dye was used to estimate the CTV titers in groups of 15 aphids under AAPs after 0.5 to 48 h for three CTV isolates (CT11A, CT16-2, and CTLJ). Similar trends for CTV titer in viruliferous aphids were displayed for the three isolates. The maximum CTV titer was at AAP 6 h for isolates CT11A and CT16-2, and at 4 h for isolate CTLJ. During the AAPs from 0.5 to 6 h, the mean CTV titer of CT16-2 increased from 7.8 × 104 to 1.71 × 107 copies per 15 aphids, and was correlated with an increase in transmission rate from 20 to 90.9%. This suggests that the transmission efficiency is positively correlated with viral titer in the insect from 0.5 h until 6 h AAPs. While a downward trend in CTV titer was observed after a 6-h AAP, the transmission rate remained higher than 90% up to 48 h. These results indicate that factors other than the virus titer in the vector contribute to successful transmission under long acquisition conditions. This is the first detailed quantitative analysis of CTV in its main vector species following different AAPs and its association with transmission efficiency, and should enhance our understanding of T. citricida-CTV interactions.