Adaptation to Ionizing Radiation in Mammalian Cells

Author(s):  
R. E. J. Mitchel ◽  
E. I. Azzam ◽  
S. M. De Toledo
1988 ◽  
Vol 13 (4) ◽  
pp. 285-299 ◽  
Author(s):  
Lloyd R. Kelland ◽  
G.Gordon Steel

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285
Author(s):  
S P Singh ◽  
M F Lavin

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.


Antioxidants ◽  
2019 ◽  
Vol 8 (1) ◽  
pp. 15 ◽  
Author(s):  
Mars G. Sharapov ◽  
Vladimir I. Novoselov ◽  
Sergey V. Gudkov

Peroxiredoxin 6 (Prdx6) is a member of an evolutionary ancient family of peroxidase enzymes with diverse functions in the cell. Prdx6 is an important enzymatic antioxidant. It reduces a wide range of peroxide substrates in the cell, thus playing a leading role in the maintenance of the redox homeostasis in mammalian cells. Beside peroxidase activity, Prdx6 has been shown to possess an activity of phospholipase A2, an enzyme playing an important role in membrane phospholipid metabolism. Moreover, Prdx6 takes part in intercellular and intracellular signal transduction due to its peroxidase and phospholipase activity, thus facilitating the initiation of regenerative processes in the cell, suppression of apoptosis, and activation of cell proliferation. Being an effective and important antioxidant enzyme, Prdx6 plays an essential role in neutralizing oxidative stress caused by various factors, including action of ionizing radiation. Endogenous Prdx6 has been shown to possess a significant radioprotective potential in cellular and animal models. Moreover, intravenous infusion of recombinant Prdx6 to animals before irradiation at lethal or sublethal doses has shown its high radioprotective effect. Exogenous Prdx6 effectively alleviates the severeness of radiation lesions, providing normalization of the functional state of radiosensitive organs and tissues, and leads to a significant elevation of the survival rate of animals. Prdx6 can be considered as a potent and promising radioprotective agent for reducing the pathological effect of ionizing radiation on mammalian organisms. The radioprotective properties and mechanisms of radioprotective action of Prdx6 are discussed in the current review.


1993 ◽  
Vol 1 (2) ◽  
pp. 81-93 ◽  
Author(s):  
Zvi Fuks ◽  
Adriana Haimovitz-Friedman ◽  
Dennis E. Hallahan ◽  
Donald W. Kufe ◽  
Ralph R. Weichselbaum

1990 ◽  
Vol 10 (10) ◽  
pp. 5279-5285 ◽  
Author(s):  
S P Singh ◽  
M F Lavin

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.


1965 ◽  
Vol 25 (1) ◽  
pp. 103-107 ◽  
Author(s):  
Susumu Kishimoto ◽  
Irving Lieberman

When kidney cells are cultured directly from the rabbit, the nuclear membranes undergo a change that can be measured as an increase in electrophoretic mobility. The change appears to begin immediately upon culture and is maximal 2 hours later, after which the mobility remains constant at the elevated level. Actinomycin D and p-fluorophenylalanine, but not EDTA or ionizing radiation, suppress the increase in nuclear electrophoretic mobility. With synchronously growing L cells, no change was detected in nuclei from cells taken during various parts of the division cycle.


Sign in / Sign up

Export Citation Format

Share Document