Profiling Stem Cells Using Quantitative PCR Protein Assays

2013 ◽  
pp. 225-236 ◽  
Author(s):  
David Ruff ◽  
Pauline T. Lieu
Keyword(s):  
Stem Cells ◽  
Quantitative Pcr ◽  
Protein Assays

Kinetics of Early Donor Chimerism after Nonmyeloablative Haematopoietic Stem Cell Transplantation Monitored with High-Resolution Real Time Quantitative PCR.

Blood ◽  
2005 ◽  
Vol 106 (11) ◽  
pp. 3669-3669
Author(s):  
Tania N. Masmas ◽  
Soren L. Petersen ◽  
Hans O. Madsen ◽  
Lars Ryder ◽  
Ebbe Dickmeiss ◽  
...  
Keyword(s):  
Stem Cells ◽  
High Resolution ◽  
Real Time ◽  
Quantitative Pcr ◽  
Haematopoietic Stem Cell ◽  
Logrank Test ◽  
Post Transplant ◽  
Real Time Quantitative Pcr ◽  
Donor Chimerism ◽  
Kinetics Of

Abstract Purpose: From May 2003 to March 2005, 37 patients with haematological malignancies were transplanted with peripheral blood stem cells after nonmyeloablative conditioning with fludarabine 30 mg/m2 i.v. once daily on day −4 to −2 and 200 cGY of total body irradiation on day 0. Post-transplant immunosuppression consisted of oral cyclosporin 12.5 mg/kg/day and mycophenolate mofetil 30 mg/kg/day. Three patients were not eligible for follow-up due to lack of informed consent or informative markers for chimerism measurement. The purpose of this study was to evaluate kinetics of early chimerism of CD4+, CD8+, and, CD15+ cells immediately post transplant and furthermore to identify factors associated with rejection of graft. Methods: Blood samples were collected post transplant on day +1–3, +5–7, and then weekly. Samples were separated with immunomagnetic beads and DNA was salt extracted. Chimerism analysis was performed by automated high-resolution real-time quantitative PCR based on short insertion or deletion polymorphisms or single nucleotide polymorphisms. Results: The kinetics of CD15+ chimerism differed from that of CD4+ and CD8+ chimerism (Figure). CD15+ donor chimerism was low with a median of 0.9% donor cells on day +1–3, and remained low until around day +14. Subsequently the donor chimerism increased rapidly towards 100%. The CD4+ and CD8+ donor chimerism in contrast started higher with a median of 16.3% and 15.1% respectively on day +1–3, increased slowly, and took months to reach 100%. CD4+, CD8+ or CD15+ donor chimerism on day +1–3 did not predict later development of acute graft versus host disease. Two patients had primary rejection of the donor stem cells, while four patients had secondary rejection. The patients with primary rejection had no measurable donor chimerism in any cell lineages from day +1–3. No patient with CD15+ donor chimerism above the median (0.9%) on day +1–3 rejected, while 40% (6/15) of the patients with CD15+ donor chimerism below the median rejected (LogRank test, p=0.01). No differences were found in total number of nucleated cells, CD34+, CD3+, CD4+, or CD8+ cells in the donor harvest between patient who rejected and those who did not. Conclusions: The kinetics of early CD15+ donor chimerism differed from the kinetics of early CD4+ and CD8+ donor chimerism. Early CD15+ donor chimerism was markedly lower than CD4+ and CD8+ donor chimerism. CD15+ donor chimerism increased toward 100% donor chimerism more rapidly than the CD4+ and CD8+ chimerism. Primary rejection of donor stem cells can be identified early, as these patients have no measurable donor CD4+ or CD8+ chimerism on day +1–3. Furthermore, patients with CD15+ donor chimerism above the median on day +1–3 have a low risk for rejection. Figure Figure

scholarly journals Identification of optimal reference genes for quantitative PCR studies on human mesenchymal stem cells

2014 ◽  
Vol 11 (2) ◽  
pp. 1304-1311 ◽  
Author(s):  
XIUYING LI ◽  
QIWEI YANG ◽  
JINPING BAI ◽  
YANYAN YANG ◽  
LINGZHI ZHONG ◽  
...  
Keyword(s):  
Stem Cells ◽  
Mesenchymal Stem Cells ◽  
Quantitative Pcr ◽  
Reference Genes ◽  
Human Mesenchymal Stem Cells

Telomere length analysis of human mesenchymal stem cells by quantitative PCR

Gene ◽  
2013 ◽  
Vol 519 (2) ◽  
pp. 348-355 ◽  
Author(s):  
Rebekah M. Samsonraj ◽  
Michael Raghunath ◽  
James H. Hui ◽  
Ling Ling ◽  
Victor Nurcombe ◽  
...  
Keyword(s):  
Stem Cells ◽  
Mesenchymal Stem Cells ◽  
Telomere Length ◽  
Quantitative Pcr ◽  
Human Mesenchymal Stem Cells ◽  
Length Analysis

Abstract 3887: Wnt11 Overexpression in MSCs Protects Myocardium Against Ischemic Reperfusion Injury via Upregulation of GATA-4

Circulation ◽  
2008 ◽  
Vol 118 (suppl_18) ◽  
Author(s):  
Ying Dai ◽  
Shi Zuo ◽  
Xu Ning ◽  
Yigang Wang ◽  
Muhammad Ashraf ◽  
...  
Keyword(s):  
Stem Cells ◽  
Mesenchymal Stem Cells ◽  
Coronary Artery ◽  
Cardiac Function ◽  
Reperfusion Injury ◽  
Quantitative Pcr ◽  
Annexin V ◽  
Adenoviral Vectors ◽  
Low Oxygen ◽  
Rat Hearts

We have studied the augmented effect of Wnt11 transfected mesenchymal stem cells (MSCs Wnt11 ) which show upregulation of GATA-4 on cardioprotection. We hyothesize that GATA-4 overexpression mediates cardioprotection. Cardioprotection by MSCs was investigated by 1) co-culture CM with MSCs and 2) transplantation of MSCs (1.5×10 6 /50μl) into the border area of ischemic rat hearts after ligation of the left anterior descending coronary artery. GATA-4 was overexpressed by transfection of GATA-4 gene via adenoviral vectors to MSCs (MSCs GATA-4 ). Loss of GATA-4 in MSCs Wnt11 was carried out by transfecting GATA-4-siRNA into MSCs Wnt11 using oligofectamine. Expression of GATA-4 in MSCs Wnt11 was assayed by quantitative PCR. GATA-4 was significantly upregulated in MSCs Wnt11 compared to MSCs GFP , especially, when cells were exposed to low oxygen microenvironment (Fig. 1 ). Hearts transplanted with MSCs Wnt11 showed a significant improvement in cardiac function compared to those transplanted with MSCs GFP . TUNEL positive cells in hearts treated with MSCs Wnt11 were significantly reduced (0.57±0.17%) compared to MSCs GFP (1.84±0.38% VS 6.51±1.00%, p<0.05). Moreover, annexin-V + CM were significantly less when co-cultured with MSCs Wnt11 and MSCs GATA-4 than those co-cultured with MSCs GFP ( Fig. 2 ). The effect of MSCs Wnt11 was abolished by GATA-4-siRNA-MSCs Wnt11 ( Tab. 1 ). These results suggest that MSCs Wnt11 exert a powerful cardioprotective effect via overexpression of GATA-4. Figure 1. Figure 2. Table 1. Cardiacfunction aftertransplantation of various MSCS

scholarly journals A gold standard method for human cell quantification after xenotransplantation

2019 ◽  
Author(s):  
Mona Bensalah ◽  
Pierre Klein ◽  
Ingo Riederer ◽  
Soraya Chaouch ◽  
Laura Muraine ◽  
...  
Keyword(s):  
Stem Cells ◽  
Real Time ◽  
Quantitative Pcr ◽  
Gold Standard ◽  
Human Cells ◽  
Muscle Fibres ◽  
Human Stem Cells ◽  
Gold Standard Method ◽  
Immunodeficient Mice ◽  
Real Time Quantitative Pcr

AbstractXenotransplantation of human cells into immunodeficient mouse models is a very powerful tool and an essential step for the pre-clinical evaluation of therapeutic cell-and gene-based strategies. Here we describe an optimized protocol combining immunofluorescence and real-time quantitative PCR to both quantify and visualize the fate and localization of human myogenic cells after injection in regenerating muscles of immunodeficient mice. Whereas real-time quantitative PCR-based method provides an accurate quantification of human cells, it does not document their specific localization. The addition of an immunofluorescence approach using human-specific antibodies recognizing engrafted human cells gives information on the localization of the human cells within the host muscle fibres, in the stem cell niche or in the interstitial space.These two combined approaches offer an accurate evaluation of human engraftment including cell number and localization and should provide a gold standard to compare results obtained either using different types of human stem cells or comparing healthy and pathological muscle stem cells between different research laboratories worldwide.

207 Editing of prostaglandin E2 gene receptors EP2 and EP4 by CRISPR/Cas9 technology in equine adipose mesenchymal stem cells

2020 ◽  
Vol 32 (2) ◽  
pp. 232
Author(s):  
A. C. Furlanetto Mançanares ◽  
J. Cabezas ◽  
D. Rojas ◽  
J. Manriquez ◽  
L. Rodriguez ◽  
...  
Keyword(s):  
Stem Cells ◽  
Mesenchymal Stem Cells ◽  
Cell Migration ◽  
Prostaglandin E2 ◽  
Quantitative Pcr ◽  
Dna Sequences ◽  
Transduction Efficiency ◽  
Self Renewal ◽  
High Background ◽  
Adipose Mesenchymal Stem Cells

Prostaglandin E2 (PGE2) is an important mediator of cellular responses, playing a key role in limiting inflammation. PGE2 acts distinctly through one of four EP receptors. In MSCs, it PGE2 stimulation of EP2 and EP4 receptors triggers processes such as migration, self-renewal, survival, and proliferation, and their activation is involved in homing. PGE2 has been proposed as a key factor of MSC immunomodulation. The CRISPR-Cas9 system has been adapted successfully to edit the genome of animals. Loss of EP2 and EP4 receptors in equine adipose mesenchymal stem cells (eAT-MSC) could help us understand their role in cell migration, homing, and self-renewal capacities. Here, we aimed to edit these receptors in eAT-MSC to test their function. The eAT-MSC were obtained from three Chilean breed horses and cultured in Dulbecco's modified Eagle's medium-high glucose with 10% fetal bovine serum. Guide RNAs (sgRNA) for CRISPR-Cas 9 editing were designed based on EP2 and EP4 DNA sequences. The sgRNA and PAM sequence targeting exon 1 of the equine genes (EP2-sgRNA: TGGTGCTGGCTTCGTACGCG; PAM:CGG and EP4-sgRNA: GGAGACGACCTTCTACACGT;PAM:TGG) were cloned into linearized LentiCRISPRv2GFP vector (#82416; Addgene). The lentiviral vector plus helping packaging plasmids was co-transfected into HEK293FT cells. The produced viral particles were harvested and transduced into eAT-MSC. After 48h, cells were sorted and green fluorescent protein (GFP)-positive cells were expanded to obtain individual clones. Genomic DNA was extracted for PCR amplification, and the frequency of site directed-mutation was assessed by T7 endonuclease assay. Because of the high background (e.g. excessive banding) produced by the T7E1 assay, the PCR products were cloned into a pUC57 vector, and sequenced. Quantitative PCR and immunocytochemistry staining examined expression of EP2 and EP4. The statistical analyses were performed using GraphPad Prism 6 (GraphPad Inc.) with unpaired t-test; P-values&lt;0.05 were considered statistically significant. Transduction efficiency of eAT-MSC/EP2ko and eAT-MSC/EP4ko was 31 and 38%, respectively. A total of 15 clones for each lineage obtained from a single cell culture were subjected to T7EI assay to identify the frequency of mutation. Eight eAT-MSC/EP2ko and 7 eAT-MSC/EP4ko clones showed mutations; DNA sequencing confirmed mutations in 3 eAT-MSC/EP2ko clones and 3 eAT-MSC/EP4ko clones. Immunostaining with specific anti-EP2 and anti-EP4 antibodies showed diminished expression of the particular receptors in the knockout cells. Decreased expression was quantitatively confirmed by quantitative PCR analysis, showing downregulation of PTGER2 (4.3-fold) and PTGER4 (2.7-fold) in the edited clones compared with eAT-MSC naïve cells (P&lt;0.05). This CRISPR/Cas9 design allows the possibility of using these mutant cell lines as a model system to elucidate the role of EP2 and EP4 in cell migration, homing, and self-renewal. Research was supported by FONDECYT 3170390 to ACFM, Ministry of Education, Chile.

Myocardial Patch Formation by Three-Dimensional Culture of Bone Marrow Mesenchymal Stem Cells with 3-Hydroxybutyrate-Co-4-Hydroxybutyrate Under Hypoxia

2020 ◽  
Vol 10 (7) ◽  
pp. 922-929
Author(s):  
Mu Junsheng ◽  
Tian Kun ◽  
Zhou Fan ◽  
Bo Ping
Keyword(s):  
Stem Cells ◽  
Bone Marrow ◽  
Mesenchymal Stem Cells ◽  
Real Time ◽  
Quantitative Pcr ◽  
Troponin T ◽  
Mouse Bone Marrow ◽  
Real Time Quantitative Pcr ◽  
Marrow Mesenchymal Stem Cells ◽  
Hypoxic Group

Herein we researched the effects of a hypoxic microenvironment on bone marrow mesenchymal stem cells (BM-MSCs) on poly 3-hydroxybutyrate-co-4-hydroxybutyrate [P(3HB-co-4HB)] and present a theoretical basis for development of cell transplantation. Mouse bone marrow mesenchymal stem cells were isolated by whole bone marrow culture and surface antigens were analyzed by flow cytometry of passage 5 cells. P(3HB-co-4HB) and bone marrow mesenchymal stem cells were prepared as stem cell patches randomly divided into normoxia (control, 20% oxygen) and hypoxia (3% oxygen) groups. After 24 h, the patch was used for experiments. Cell proliferation was determined by CCK-8 assays. Adhesion, survival, and growth of cells on patches were observed by scanning electron microscopy. Expression of hypoxia-inducible factor-1α (HIF-1α) was tested by real-time quantitative PCR and western blotting. At 2 weeks after addition of cardiomyocyte differentiation inducer 5-azacytidine, cardiac troponin T (cTnT) expression was detected by immunofluorescence. After 24 h, the proliferation of the hypoxic group was considerably greater compared with the normoxic group (n = 12,P < 0 05). SEM demonstrated that the number of viable cells in the hypoxic group was higher than that in the normoxic group. Adhesion between cells and the patch was firm and cell morphology was normal in the hypoxic group. Significant upregulation of HIF-1α mRNA was observed by real-time quantitative PCR after 12 h (P < 0 05). HIF-1αprotein expression in the hypoxia group was considerably higher than that in the normoxia group. cTnT expression in the hypoxic group was more pronounced than that in the normoxic group. Our results show that a hypoxic microenvironment promotes the adhesion, survival, proliferation, and myocardial differentiation of bone marrow mesenchymal stem cells on a P(3HB-co-4HB) patch, which may be mediated by the HIF-1α; pathway.

Sign in / Sign up

Export Citation Format

Share Document