The detection of commercial duck species in food using a single probe-multiple species-specific primer real-time PCR assay

2005 ◽  
Vol 221 (3-4) ◽  
pp. 559-563 ◽  
Author(s):  
Heather Hird ◽  
James Chisholm ◽  
Joy Brown
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Specific Primer ◽  
Pcr Assay ◽  
Single Probe ◽  
Duck Species ◽  
Multiple Species ◽  
Species Specific

Molecular diagnostics of the pigeon pea cyst nematode, Heterodera cajani Koshy, 1967, using real-time PCR

Nematology ◽  
2021 ◽  
pp. 1-6
Author(s):  
Tatiana V. Roubtsova ◽  
Sergei A. Subbotin
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pigeon Pea ◽  
Cyst Nematode ◽  
Taqman Probe ◽  
28S Rrna ◽  
Specific Primer ◽  
Pcr Assay ◽  
Species Specific ◽  
Heterodera Cajani

Summary The pigeon pea cyst nematode, Heterodera cajani, is an important nematode pest of pigeon pea that is present in all major growing regions of this crop in India and reported from Pakistan, Egypt and Myanmar. In this study, a new real-time PCR assay for detection of H. cajani using a species-specific primer and a TaqMan probe was developed. The primers and a probe were designed to amplify the COI gene fragment. The specificity of the primer-probe set was tested in singleplex or multiplex reactions against target and non-target nematodes. In multiplex real-time PCR experiments with the specific and universal primer-probe sets, the signals were simultaneously observed for COI and D3 of 28S rRNA target genes. The results showed that the real-time PCR assay with species-specific primer and probe was sensitive enough to detect H. cajani DNA extracted from 0.003 egg or second-stage juvenile.

scholarly journals Characterization of Plasmodium ovale curtisi and P. ovale wallikeri in Western Kenya Utilizing a Novel Species-specific Real-time PCR Assay

2015 ◽  
Vol 9 (1) ◽  
pp. e0003469 ◽  
Author(s):  
Robin H. Miller ◽  
Clifford O. Obuya ◽  
Elizabeth W. Wanja ◽  
Bernhards Ogutu ◽  
John Waitumbi ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Novel Species ◽  
Plasmodium Ovale ◽  
Pcr Assay ◽  
Western Kenya ◽  
Plasmodium Ovale Curtisi ◽  
Species Specific

scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Species-specific identification of variola, monkeypox, cowpox, and vaccinia viruses by multiplex real-time PCR assay

2011 ◽  
Vol 175 (2) ◽  
pp. 163-169 ◽  
Author(s):  
Sergei N. Shchelkunov ◽  
Dmitrii N. Shcherbakov ◽  
Rinat A. Maksyutov ◽  
Elena V. Gavrilova
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Specific Identification ◽  
Vaccinia Viruses ◽  
Species Specific

scholarly journals Detection of Dientamoeba fragilis in animal faeces using species specific real time PCR assay

2016 ◽  
Vol 227 ◽  
pp. 42-47 ◽  
Author(s):  
Douglas Chan ◽  
Joel Barratt ◽  
Tamalee Roberts ◽  
Owen Phillips ◽  
Jan Šlapeta ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Dientamoeba Fragilis ◽  
Species Specific

scholarly journals Development of a species-specific TaqMan-MGB real-time PCR assay to quantify Olsenella scatoligenes in pigs offered a chicory root-based diet

AMB Express ◽  
2018 ◽  
Vol 8 (1) ◽  
Author(s):  
Xiaoqiong Li ◽  
Bent Borg Jensen ◽  
Ole Højberg ◽  
Samantha Joan Noel ◽  
Nuria Canibe
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Chicory Root ◽  
Species Specific

Development of a real-time PCR assay for detection of Mytilus species specific alleles: Application to a sampling survey in Scotland

2008 ◽  
Vol 367 (2) ◽  
pp. 253-258 ◽  
Author(s):  
P.J. Dias ◽  
L. Sollelis ◽  
E.J. Cook ◽  
S.B. Piertney ◽  
I.M. Davies ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Pcr Assay ◽  
Species Specific ◽  
Sampling Survey

Species-specific real-time PCR assay for the detection of Streptococcus suis from clinical specimens

2016 ◽  
Vol 85 (2) ◽  
pp. 131-132 ◽  
Author(s):  
Velusamy Srinivasan ◽  
Lesley McGee ◽  
Berthe-Marie Njanpop-Lafourcade ◽  
Jennifer Moïsi ◽  
Bernard Beall
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Streptococcus Suis ◽  
Pcr Assay ◽  
Clinical Specimens ◽  
Species Specific

scholarly journals A novel, species-specific, real-time PCR assay for the detection of the emerging zoonotic parasite Ancylostoma ceylanicum in human stool

2017 ◽  
Vol 11 (7) ◽  
pp. e0005734 ◽  
Author(s):  
Marina Papaiakovou ◽  
Nils Pilotte ◽  
Jessica R. Grant ◽  
Rebecca J. Traub ◽  
Stacey Llewellyn ◽  
...  
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Novel Species ◽  
Pcr Assay ◽  
Ancylostoma Ceylanicum ◽  
Zoonotic Parasite ◽  
Species Specific ◽  
Human Stool

Optimisation of a species-specific primer set to quantify the soybean cyst nematode, Heterodera glycines, in soil using real-time PCR

Nematology ◽  
2019 ◽  
Vol 21 (10) ◽  
pp. 1037-1042 ◽  
Author(s):  
Sayo Shirai ◽  
Koki Toyota
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Related Species ◽  
Soybean Cyst Nematode ◽  
Heterodera Glycines ◽  
Cyst Nematode ◽  
Specific Primer ◽  
Soybean Production ◽  
Species Specific ◽  
Pcr Primer

Summary We previously reported a real-time PCR primer set (SCN) that is specific to the soybean cyst nematode Heterodera glycines, a major nematode pest in soybean production in Japan. However, the primer set also amplified the related species H. trifolii and H. schachtii, whose presence was recently reported in Japan. The objective of this study was to optimise a primer set to be more specific for quantification of H. glycines. The newly optimised primer set (SCNnew) amplified H. trifolii and H. schachtii at amplification efficiencies less than 1% of H. glycines. Surveys for H. glycines in different green soybean fields in Japan demonstrated that most fields judged to contain low densities of H. glycines based on the SCN primer set were not actually infested with H. glycines. The SCNnew primer set quantifies H. glycines in soil more precisely.

Sign in / Sign up

Export Citation Format

Share Document