The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

Development of Tetra-primer Amplification Refractory Mutation System (ARMS) PCR for Detection of CHRNA3 rs8040868

BACKGROUND: Single nucleotide variations (SNV) have been mapped to be associated with several human conditions and diseases. To validate the association between SNV to certain human traits or diseases, a large number of subjects must be included. Thus, in need of a fast, relatively economic, and reliable genotyping method. This can be achieved through the use of tetra-primer amplification refractory mutation system polymerase chain reaction (Tetra-primer ARMS PCR). This study reports strategy to develop Tetra-primer ARMS PCR-based genotyping of CHRNA3 rs8040868.METHODS: The optimization of Tetra-primer ARMS PCR was done through these steps: identification of gene sequence and position of single mutation; designing outer and inner PCR primers; amplification of target gene fragments through PCR by using outer primer; confirming genotype of the PCR product by using sequencing; determining an optimum ratio of outer and inner primer; and determining optimum annealing temperature and cycles for the PCR program. The PCR products were run in 2% gel agarose electrophoresis and visualized under UV illumination.RESULTS: Outer and inner primer ratio of 1:3 with annealing temperature of 64.4°C and 40x cycles was found to be the most optimum condition. Tetra-primer ARMS PCR was able to confirm the results of the DNA sequence of 2 samples, confirming wild-type variants (TT allele) and the heterozygous mutant (CT allele).CONCLUSION: Tetra-primer ARMS PCR was able to genotype rs8040868 of the CHRNA3 gene.KEYWORDS: tetra-primer ARMS PCR, CHRNA3, rs8040868, genotyping

Molecular identification of Haemonchus contortus in goats

Haemonchus contortus commonly called the stomach worm or wire worm of ruminants inhabits the abomasum and is considered to be one of the economically important gastrointestinal strongyles in goats. In the present study, H. contortus was identified by PCR using the primers targeting partial 5.8S and partial internal transcribed spacer region 2 (ITS-2). Adult worms were identified morphologically and genomic DNA was extracted using DNeasy Blood and Tissue kit (QIAGEN, Germany). Gradient PCR protocol was standardised using the extracted genomic DNA. Ten-fold serial dilution of adult DNA was used to analyse the minimum detection limit and the products were amplified upto the tenth dilution. Cross reaction of primer sets was checked using the DNA extracted from predominant adult srongyles like Oesophagostomum columbianum and Trichostrongylus colubriformis and no cross reaction was seen at the optimum annealing temperature (60.7°C).

Thermal Annealing Surface Modification: Effect on Surface and Performance of Electrospun Nylon 6,6 Nanofiber Membrane for Wastewater Treatment

As the forefront in fiber materials development, electrospun nanofiber membrane (NFM) is potentially reliable for wastewater treatment due to its excellent properties for instance; large surface area, high porosity, tuneable pore size, and has great flux as compared to other conventional membranes. However, fouling issue will lead to degradation of membrane performance. Fouling issue can be alleviated by applying membrane surface modification. In this study, thermal annealing is applied onto nylon 6,6 nanofiber membrane with three different temperatures (60°C, 80°C and 120°C). Results show that annealing causes membrane shrinkage and reduction of membrane fiber diameter where the fiber reduced from 138.5 nm to 108.5 nm when annealed at 120°C. The optimum annealing temperature for the membrane was found to be at 60˚C as the membrane shows the highest flux at 1200 L/m2.h at 75 minutes filtration time and took longer time to get fouled (>75 minutes) compared with un-annealed membrane (55 minutes). Nylon 6,6 nanofiber membrane is also proven to give more than 90% of COD and turbidity rejection.

Integrated qPCR and Staining Methods for Detection and Quantification of Enterocytozoon hepatopenaei in Shrimp Litopenaeus vannamei

Enterocytozoon hepatopenaei (EHP) is an obligate, intracellular, spore-forming parasite, which mainly infects the gastrointestinal tract of shrimp. It significantly hinders the growth of shrimp, which causes substantial economic losses in farming. In this study, we established and optimized a SYBR Green I fluorescent quantitative PCR (qPCR) assay based on the polar tube protein 2 (PTP2) gene for the quantitative analysis of EHP-infected shrimp. The result showed that the optimum annealing temperature was 60 °C for the corresponding relation between the amplification quantitative (Cq) and the logarithmic of the initial template quantity (x), conformed to Cq = −3.2751x + 31.269 with a correlation coefficient R2 = 0.993. The amplification efficiency was 102%. This qPCR method also showed high sensitivity, specificity, and repeatability. Moreover, a microscopy method was developed to observe and count EHP spores in hepatopancreas tissue of EHP-infected shrimp using Fluorescent Brightener 28 staining. By comparing the PTP2-qPCR and microscopy method, the microscopic examination was easier to operate whereas PTP2-qPCR was more sensitive for analysis. And we found that there was a correspondence between the results of these two methods. In summary, the PTP2-qPCR method integrated microscopy could serve for EHP detection during the whole period of shrimp farming and satisfy different requirements for detecting EHP in shrimp farming.

Effect of Thermomechanical Cycling on Martensitic Transformation and Shape Memory Effect in 304 Austenitic Steel

To improve the shape memory effect (SME) of 304 austenitic steel effectively and efficiently, thermomechanical cycling, comprising deformation at room temperature and annealing, was applied. The influences of cycle number and annealing temperature on the SME and microstructures in 304 austenitic steel were investigated by light microscope (LM), X-ray diffraction (XRD), and transmission electron microscope (TEM). The shape recovery ratio was remarkably improved from 16% to 40% after two thermomechanical cycles. The optimum annealing temperature was 833 K in the process of thermomechanical cycling. The improved SME by thermomechanical cycling was mainly related to stress-induced ε martensite rather than stress-induced α’ martensite. The reason is that thermomechanical cycling can not only promote the occurrence of the stress-induced γ→ε martensitic transformation, but also suppress the subsequently stress-induced ε→α′ transformation.

A Two-Step Annealing Method to Enhance the Pyroelectric Properties of Mn:PIMNT Chips for Infrared Detectors

Mn:0.15Pb(In1/2Nb1/2)O3-0.55Pb(Mg1/3Nb2/3)O3-0.30PbTiO3 (Mn:PIMNT) pyroelectric chips were prepared by a two-step annealing method. For the two steps, annealing temperatures dependence of microstructure, defects, surface stress, surface roughness, dielectric properties and pyroelectric properties were studied comprehensively. The controlling factors influencing the pyroelectric properties of the Mn:PIMNT crystals were analyzed and the optimum annealing temperature ranges for the two steps were determined: 600–700 °C for the first step and 500–600 °C for the second step. The pyroelectric properties of the thin Mn:PIMNT chips were significantly enhanced by the two-step annealing method via tuning oxygen vacancies and eliminating surface stress. Based on Mn:PIMNT pyroelectric chips annealed at the most favorable conditions (annealed at 600 °C for the first step and 500 °C for the second step), infrared detectors were prepared with specific detectivity D* = 1.63 × 109 cmHz1/2W−1, nearly three times higher than in commercial LiTaO3 detectors.

Short Communication: DNA barcodes and phylogenetic of striped snakehead and ocellated snakehead fish from South Sumatra, Indonesia

Syaifudin M, Wijayanti M, Dwinanti SH, Muslim, Mahendra M, Marliana S. 2020. DNA barcodes and phylogenetic of striped snakehead and ocellated snakehead fish from South Sumatra, Indonesia. Biodiversitas 21: 1227-1235. This research aimed to identify the sequences of cytochrome c oxidase subunit I gene mitochondrial DNA (COI mtDNA), to construct a phylogenetic tree of striped snakehead (Channa striata) and ocellated snakehead (Channa pleuropthalma), and to measure water quality of Kelekar River, Indralaya, Ogan Ilir District and Danau Burung Besar River, Penukal Abab Lematang Ilir (PALI) District in South Sumatra, Indonesia. The research procedures consisted of DNA isolation, amplification by PCR (Polymerase Chain Reaction) and sequencing of fragment COI mtDNA. The length of nucleotide was 604 bp for striped snakehead and 587-604 bp for ocellated snakehead. Optimum annealing temperature was 500C for 15 seconds with 30 cycles. The result of BLAST analysis showed that striped snakehead from Kelekar and Danau Burung Besar River had 100% identity to striped snakehead from Java-Bali and furthest (97%) with striped snakehead from India. Ocellated snakehead had 100% similarity with the same species from Musi Banyuasin and Banjarmasin; and furthest (83%) with Channa limbata from Myanmar. Water quality in Kelekar River were temperature 31-31.60C, pH 4.76-4.96, dissolved oxygen 2.7-3.0 mg/L, ammonia <0.009 mg/L, total alkalinity 20 mg/L, and turbidity 62.5-63 cm. Meanwhile in Danau Burung Besar River showed temperature (29.3-30.70C), pH (3.6-6.7), dissolved oxygen (1.31-3.76 mg/L), ammonia (0.17-0.20 mg/L), and turbidity (50-90 cm).

ANNEALING EFFECT ON STRUCTURAL AND OPTICAL PROPERTIES OF COPPER-DOPED BISMUTH TRIOXIDE Cu:Bi2O3 THIN FILMS

In this work, we have examined the effect of annealing temperature on Cu-doped Bi2O3 thin films at 1%, 3% and 5% doping rate successfully prepared by spray pyrolysis technique onto glass substrates. The obtained films were subsequently annealed at different temperature for 4[Formula: see text]h. GIXRD analysis reveals the polycrystalline nature of deposited films and shows the formation of mixed [Formula: see text]- and [Formula: see text]-Bi2O3 phases. With the increase of doping rate, [Formula: see text]-phase of Bi2O3 was identified at medium temperature. The average grain size of thin films at different doping rate of Cu decreases with the increase of annealing temperature. The optical characterization shows that the optical transmittance of the films decreases with the increase of annealing temperature in the range (70–50%) and (40–10%) for 1% and 5% doping rate of Cu, respectively. The evaluation of the optical bandgap energy reveals that the indirect transition is controlling the optical response of the films. The optimum annealing temperature to reduce Bi2O3 energy bandgap to be 3.09[Formula: see text]eV, is 450∘C and 550∘C for 3% and 5% doping rate of Cu.

DETEKSI DINI Enterocytozoon hepatopenaei (EHP) PADA UDANG VANAME (Litopenaeus vannamei) MENGGUNAKAN METODE PCR (POLYMERASE CHAIN REACTION)

Sejak akhir tahun 2014, wabah kotoran putih atau yang sering disebut juga WFD (White Feces Disease), merupakan salah satu masalah yang sering terjadi pada petambak udang di Indonesia. Wabah ini diketahui disebabkan oleh Enterocytozoon hepatopenaei (EHP) dan telah mengakibatkan retardasi pertumbuhan hingga kematian pada udang. Hingga saat ini, penyakit WFD dapat dideteksi dengan cara uji histologi, hibridisasi in situ, dan PCR. Penelitian ini bertujuan untuk mendapatkan metode deteksi dini penyakit EHP pada udang vaname dengan metode PCR melalui perancangan primer yang spesifik dan sensitif. Pada penelitian ini dilakukan isolasi EHP pada udang vaname yang terinfeksi, kemudian dideteksi dengan metode PCR yang mentarget SWP (spore wall protein) dari EHP serta pengujian spesifitas dan sensitivitasnya. Hasil yang diperoleh menunjukkan bahwa EHP dapat diisolasi dari udang yang terinfeksi dan dapat didesain dua pasang primer yaitu SWP-EHP1 dan SWP-EHP3 yang mentarget spore wall protein EHP. Kedua primer ini dapat digunakan untuk deteksi EHP menggunakan PCR, dengan produk PCR pada primer SWP-EHP1 yaitu 398 bp dan primer SWP-EHP3 sebesar 415 bp, serta nilai suhu annealing optimal pada 48oC.Hasil pengujian sensitivitas primer, diketahui bahwa primer SWP-EHP1 dapat mendeteksi EHP hingga jumlah DNA target sebanyak 7,74 x 102 kopi sedangkan primer SWP-EHP3 dapat mendeteksi hingga 16,2 x 102 kopi.Since 2014, white feces disease (WFD) is one of the emerging problems for whiteleg shrimp farming industries in Indonesia. This outbreak is known to be caused by Enterocytozoon hepatopenaei (EHP) infection to shrimp. EHP infection resulted in growth retardation to a mass mortality in shrimp. To date, WFD can be detected by histology, in situ hybridization and PCR. This study aimed to obtain an early detection method of EHP on whiteleg shrimp by PCR method through specific and sensitive primers design. In this study, we isolated the DNA of EHP from infected whiteleg shrimp, then detected by PCR method which targeted spore wall protein (SWP) from EHP as well as sensitivity and specificity testing. As a result, EHP can be isolated from infected shrimp and can be designed 2 pairs of primers (SWP-EHP1 and SWP-EHP3) targeting spore wall protein of EHP. These primers could be used for EHP detection using PCR, with PCR products from primers SWP-EHP1 was 398 bp and from SWP-EHP3 primers was 415 bp, with an optimum annealing temperature of 48oC. Primers sensitivity test results revealed that primers SWP-EHP1 could detect EHP to 7.74 x 102 copies while the primers SWP-EHP3 could detect up to 16.2 x 102 copies.