scholarly journals The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

2021 ◽  
Vol 21 (4) ◽  
pp. 852
Author(s):  
Nina Salamah ◽  
Yuny Erwanto ◽  
Sudibyo Martono ◽  
Abdul Rohman
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Dna Amplification ◽  
Pharmaceutical Products ◽  
Specific Primer ◽  
D Loop ◽  
Halal Authentication ◽  
Polymerase Chain ◽  
Optimum Annealing Temperature ◽  
Species Specific

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

The Use of Real-Time Polymerase Chain Reaction Combined with Specific-Species Primer for Analysis of Dog Meat DNA in Meatball

2020 ◽  
Vol 21 (1) ◽  
pp. 225
Author(s):  
Abdul Rohman ◽  
Wiranti Sri Rahayu ◽  
Sudjadi Sudjadi ◽  
Sudibyo Martono
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Dna Analysis ◽  
Limit Of Detection ◽  
Specific Primer ◽  
Chain Reaction ◽  
Relative Standard ◽  
Polymerase Chain ◽  
Species Specific

The presence of dog meat is a crucial issue because dog meat is non-halal meat for Muslims. The objective of this study was to design and validate species-specific primer for the identification of dog meat DNA in meatball using real-time polymerase chain reaction (real-time PCR). The specific primer targeting mitochondrial cytochrome c oxidase subunit 1 (CO1) was validated. The specific primers used were designed using Integrated DNA Technologies (IDT) software and subjected to NCBI BLAST procedure. The candidate primers were tested for specificity study using several DNAs from fresh meat of pork, chicken, beef, lamb, and rat. The method was also validated by determining several parameters of linearity, sensitivity, precision, and efficiency. The results showed that primer could amplify specifically DNA target at an optimized annealing temperature of 56.6 °C. The limit of detection (LoD) obtained was 5 ng DNA, corresponding to 2.5% of dog meat in a meatball. The repeatability evaluation, expressed with relative standard deviation (RSD), and efficiency value was in the acceptable range (RSD < 25% and efficiency (90–105%). This method was successfully used for the analysis of marketed samples. Real-time PCR can be used as a standard method in halal authentication analysis through DNA analysis.

Rapid, specific and quantitative polymerase chain reaction (PCR) detection of pathogenic protozoa Entamoeba histolytica for drinking water supply

2011 ◽  
Vol 11 (4) ◽  
pp. 418-425 ◽  
Author(s):  
S. W. Lam ◽  
H. B. Zhang ◽  
L. Yu ◽  
C. H. Woo ◽  
K. N. Tiew ◽  
...  
Keyword(s):  
Real Time ◽  
Water Samples ◽  
Real Time Pcr ◽  
Genomic Dna ◽  
Tap Water ◽  
Pcr Detection ◽  
Raw Water ◽  
Conventional Pcr ◽  
Polymerase Chain ◽  
Species Specific

In this study, a quantitative species-specific polymerase chain reaction (PCR) method to rapidly detect E. histolytica in water is developed. First, the specificity of E. histolytica PCR detection was verified by using species-specific primers of 16S-like rRNA genes to clearly differentiate it from the closely related amoebae species E. dispar and E. moshkovskii. The sensitivity of this method was subsequently determined using purified E. histolytica genomic DNA and culture cells as PCR reaction templates. Results indicated that conventional PCR visualized on 1% agarose gel was able to detect as low as 0.02 pg genomic DNA and 5 cells, while real-time PCR could detect 0.01 pg genomic DNA and 2 cells of E. histolytica. The protocols for E. histolytica PCR detection in real water samples were then optimized by spiking E. histolytica cells into tap water and reservoir raw water samples. A two-round centrifugation treatment to concentrate amoeba cells directly as a PCR template was the most effective way to detect E. histolytica in spiked tap water samples, while DNA extraction after concentrating amoeba cells was required for spiked reservoir raw water samples. The detection limit of 50 E. histolytica cells in 100 ml tap water was achieved in 2 h from sample collection to real-time PCR data readout. With these established protocols, 78 tap water samples, 11 reservoir raw water samples and 4 feed water samples from Singapore water supply systems were analyzed by both conventional PCR and real-time PCR methods. No E. histolytica cell was detected in tested samples.

Optimisation of a species-specific primer set to quantify the soybean cyst nematode, Heterodera glycines, in soil using real-time PCR

Nematology ◽  
2019 ◽  
Vol 21 (10) ◽  
pp. 1037-1042 ◽  
Author(s):  
Sayo Shirai ◽  
Koki Toyota
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Related Species ◽  
Soybean Cyst Nematode ◽  
Heterodera Glycines ◽  
Cyst Nematode ◽  
Specific Primer ◽  
Soybean Production ◽  
Species Specific ◽  
Pcr Primer

Summary We previously reported a real-time PCR primer set (SCN) that is specific to the soybean cyst nematode Heterodera glycines, a major nematode pest in soybean production in Japan. However, the primer set also amplified the related species H. trifolii and H. schachtii, whose presence was recently reported in Japan. The objective of this study was to optimise a primer set to be more specific for quantification of H. glycines. The newly optimised primer set (SCNnew) amplified H. trifolii and H. schachtii at amplification efficiencies less than 1% of H. glycines. Surveys for H. glycines in different green soybean fields in Japan demonstrated that most fields judged to contain low densities of H. glycines based on the SCN primer set were not actually infested with H. glycines. The SCNnew primer set quantifies H. glycines in soil more precisely.

scholarly journals Detection and Monitoring of Greeneria uvicola and Colletotrichum acutatum Development on Grapevines by Real-Time PCR

Plant Disease ◽  
2011 ◽  
Vol 95 (3) ◽  
pp. 298-303 ◽  
Author(s):  
Suren K. Samuelian ◽  
Lindsay A. Greer ◽  
Sandra Savocchia ◽  
Christopher C. Steel
Keyword(s):  
Real Time ◽  
Real Time Pcr ◽  
Epidemiological Studies ◽  
Colletotrichum Acutatum ◽  
Internal Transcribed Spacer Region ◽  
Bitter Rot ◽  
Pcr Method ◽  
Polymerase Chain ◽  
Species Specific ◽  
And Control

Bitter rot (Greeneria uvicola) and ripe rot (Colletotrichum acutatum, syn. C. simmondsii) occur frequently in subtropical grape-growing regions of Australia, where they cause yield loss and bitter taints in wine. To further advance the epidemiological studies of G. uvicola and C. acutatum and contribute toward their effective management and control, a rapid and reliable species-specific real-time polymerase chain reaction (PCR) method was developed based on the polymorphic portion of the internal transcribed spacer region of the two fungi. It was found that, within 6 to 8 h postinoculation, the assay could detect as little as 20 fg of genomic DNA and 10 conidia for both species. Artificially and naturally infected grape inflorescences and mature berries were analyzed by both conventional plating methods and real-time PCR. Fungal presence was demonstrated on all plant material but development was observed only on mature berries. The results demonstrate that the real-time PCR technique is a highly specific, rapid, and sensitive method that can be used to detect and study the dynamics of G. uvicola and C. acutatum during different stages of infection and on different grape tissues.

scholarly journals Validation of a Real-Time Polymerase Chain Reaction Assay for the Identification of Meloidogyne arenaria

Plant Disease ◽  
2011 ◽  
Vol 95 (7) ◽  
pp. 835-838 ◽  
Author(s):  
Paula Agudelo ◽  
Stephen A. Lewis ◽  
Bruce A. Fortnum
Keyword(s):  
Polymerase Chain Reaction ◽  
Real Time ◽  
Real Time Pcr ◽  
Soil Samples ◽  
Meloidogyne Arenaria ◽  
Chain Reaction ◽  
Pcr Assay ◽  
The Real ◽  
Polymerase Chain ◽  
Species Specific

Meloidogyne arenaria is an economically important parasite of many crops worldwide. Identification and detection of this species in soil samples is necessary for the design of crop rotation systems, selection of resistant cultivars, and potential use of biological control options. The objective of this study was to develop and validate a real-time polymerase chain reaction (PCR) assay, using species-specific primers and SYBR Green I Dye, for identification of M. arenaria. The specificity of the assay was confirmed by testing for amplification of DNA from other Meloidogyne spp. and from M. arenaria populations of different geographic origins. Field soil samples containing a mixture of M. arenaria and M. incognita were used to compare identification by the real-time PCR assay with identification by esterase phenotype analysis of mature females and by morphometrics of juveniles. The real-time PCR assay provided an accurate and sensitive means for the identification of single juveniles from soil samples.

scholarly journals Perbandingan deteksi Plasmodium falciparum dengan metode pemeriksaan mikroskopik dan teknik real-time polymerase chain reaction

2016 ◽  
Vol 4 (1) ◽  
Author(s):  
Elril T. Langi ◽  
Janno B. B. Bernadus ◽  
Greta J. P. Wahongan
Keyword(s):  
Polymerase Chain Reaction ◽  
Plasmodium Falciparum ◽  
Real Time ◽  
Real Time Pcr ◽  
Gold Standard ◽  
Dna Amplification ◽  
World Health ◽  
Chain Reaction ◽  
Blood Samples ◽  
Polymerase Chain

Abstract: Plasmodium falciparum is one of the species of parasites causing tropical malaria disease. Plasmodium falciparum was reported as often being the major source of pain and even death in most cases. The data released by WHO shows that, globally, 198 millions of malaria cases occurred in 2013 with 548 thousands as cause of death. Microscopic examination is a gold standard for detecting Plasmodium falciparum. Although this method has certain limitations in diagnosing complication infection, phases of parasitemia, and also the capability of laboratory's medical staff factor. Nowadays, there has been innovation in biomolecular department, that is examination using PCR which can accurately detect the plasmodium, due to the DNA amplification. This method however, has not often used by doctors in diagnose malaria disease. The aim of this research is to determine the comparison of malaria detection using microscopic verification of plasmodium falciparum with real-time PCR verification. The method used in this research is diagnostic with 35 blood samples of patient suffering malaria disease. The blood samples from patient's vena were then divided into thick and thin microscopic sample, and some were putted into EDTA tube for DNA extraction in the laboratory using real-time PCR verification. The result of this research shown that sensitivity and specificity rate of PCR is 100% accurate. Conclusion: detection result of plasmodium falciparum using real-time PCR verification produced equal result as microscopic verification.Keywords: Plasmodium falciparum, Microscopic method, Real-time Polymerase Chain Reaction (PCR)Abstrak: Plasmodium falciparum adalah salah satu spesies parasit penyebab penyakit malaria, yaitu malaria tropika. Plasmodium falciparum dilaporkan sebagai spesies yang paling banyak menyebabkan angka kesakitan dan kematian pada manusia akibat penyakit malaria. World Health Organization (WHO) melaporkan secara global, diperkirakan 198 juta kasus malaria terjadi secara keseluruhan pada tahun 2013 dan menyebabkan 584 ribu kematian. Pemeriksaan mikroskopik adalah pemeriksaan gold standard untuk mendeteksi Plasmodium falciparum. Namun pemeriksaan ini memiliki keterbatasan dalam hal mendiagnosis infeksi campuran, infeksi dengan keadaan parasitemia, dan tidak terlatihnya tenaga kesehatan laboratorium. Saat ini dalam bidang biomolekuler telah dikembangkan pemeriksaan real-time polymerase chain reaction (PCR) yang akurat untuk mendeteksi plasmodium, karena didasarkan pada amplifikasi DNA plasmodium, namun pemeriksaan ini belum rutin digunakan untuk mendiagnosis malaria. Penelitian ini bertujuan untuk mengetahui perbandingan deteksi Plasmodium falciparum dengan pemeriksaan mikroskopik dan pemeriksaan real-time PCR. Metode penelitian ini ialah uji diagnostik. Sampel pada penelitian ini yaitu 35 sampel darah pasien suspek malaria. Sampel darah vena yang diambil langsung dibuat sedian darah tipis dan sediaan darah tebal untuk diperiksa di mikroskop, sedangkan darah yang tersisa dimasukkan dalam tabung EDTA, dan dibawa ke Laboratorium untuk dibuat ekstraksi DNA dan dilanjutkan dengan pemeriksaan real-time PCR. Hasil penelitian menunjukkan tingkatsensitivitas dan spesifisitas real-time PCR sebesar 100%. Simpulan: Hasil deteksi Plasmodium falciparum dengan pemeriksaan real-time PCR memiliki efektivitas yang setara dengan metode pemeriksaan mikroskopik sebagai gold standart.Kata kunci: Plasmodium falciparum, Pemeriksaan Mikroskopik, Real-time Polymerase Chain Reaction (PCR)

scholarly journals Multiple Camera Fluorescence Detection for Real-Time PCR

2021 ◽  
Vol 6 (1) ◽  
pp. 71
Author(s):  
Seul-Bit-Na Koo ◽  
Hyeon-Gyu Chi ◽  
Ji-Sung Park ◽  
Jong-Dae Kim ◽  
Chan-Young Park ◽  
...  
Keyword(s):  
Real Time ◽  
Fluorescence Detection ◽  
Real Time Pcr ◽  
Detection System ◽  
Low Cost ◽  
Dna Amplification ◽  
Multiple Camera ◽  
Open Platform ◽  
Polymerase Chain ◽  
Fluorescence Detection System

The general polymerase chain reaction (PCR) amplifies DNA and analyzes the amplification results of the quantified DNA. Recently, real-time PCR has been developed to detect DNA amplification in various ways. The conventional camera-based system is too expensive and difficult to reduce device size. In this paper, we propose a low-cost, compact fluorescence detection system for real-time PCR systems using an open platform camera. To simplify the optics, four low-cost small cameras were fixedly placed, and the entire tube was divided into four quadrants to minimize the field of view. In addition, an effective image processing method was used to compensate. The proposed system measured the fluorescence detection performance on the basis of the amount of DNA using various fluorescent substances.

Sign in / Sign up

Export Citation Format

Share Document