Novel primer targeting the mitochondrial NADH dehydrogenase subunit 4 (ND4) and NADH dehydrogenase subunit 5 (ND5) for detection of porcine (Sus scrofa) DNA fragments in food products for halal authentication

In this research, a pair primer targeting NADH dehydrogenase subunit 4 (ND4) gene of porcine (Sus scrofa) mt-DNA was designed and tested for its specificity. The ND4 primer was compared for its robustness against an established primer pair designed to amplify the NADH dehydrogenase subunit 5 (ND5) gene. The samples include non-halal meat animals (dog, porcine, and rat) and halal meat animals (chicken, cow, and horse). DNA from raw meat was isolated by modified Chloroform Isoamyl-Alcohol method and then was analyzed quantitatively with NanoDrop™ spectrophotometer followed by amplification using PCR technique. The amplification results proved that the two pairs of primers were specific, resulting in amplification of 120 bp DNA target for ND4 and 227 bp for ND5. It can be concluded that the two primers can differentiate between halal and non-halal animals. However, to determine the sensitivity of each primer, further research is needed.

The Employment of Real-Time Polymerase Chain Reaction Using Species-Specific Primer Targeting on D-Loop Mitochondria for Identification of Porcine Gelatin in Soft Candy

Analysis of non-halal components, such as pork and porcine gelatin, in food and pharmaceutical products is a need for halal authentication study. This research was aimed to develop a species-specific primer (SSP) to analyze DNA in porcine gelatin in soft candy using real-time PCR. The SSP to porcine DNA primer is designed using NCBI and Primer-BLAST software. The designed primer was subjected to a validation by assessing some parameters, including specificity, sensitivity, repeatability test, and linearity. The results showed that the real-time PCR with SSP targeting on mitochondrial D-loop specifically able to identify the presence of porcine DNA at an optimum annealing temperature of 50.5 °C. The coefficient of variation (CV) on repeatability analysis of Cq was 0.53%, and the efficiency value (E) for DNA amplification was 100%. Real-time PCR using D-LOOP porcine primer (forward: ACTTCATGGAACTCATGATCCG; reverse ATGTACGTTATGTCCCGTAACC) can also be successfully used for the identification of porcine gelatin DNA in soft candy.

The Application of Molecular Spectroscopy in Combination with Chemometrics for Halal Authentication Analysis: A Review

Halal is an Arabic term used to describe any components allowed to be used in any products by Muslim communities. Halal food and halal pharmaceuticals are any food and pharmaceuticals which are safe and allowed to be consumed according to Islamic law (Shariah). Currently, in line with halal awareness, some Muslim countries such as Indonesia, Malaysia, and Middle East regions have developed some standards and regulations on halal products and halal certification. Among non-halal components, the presence of pig derivatives (lard, pork, and porcine gelatin) along with other non-halal meats (rat meat, wild boar meat, and dog meat) is typically found in food and pharmaceutical products. This review updates the recent application of molecular spectroscopy, including ultraviolet-visible, infrared, Raman, and nuclear magnetic resonance (NMR) spectroscopies, in combination with chemometrics of multivariate analysis, for analysis of non-halal components in food and pharmaceutical products. The combination of molecular spectroscopic-based techniques and chemometrics offers fast and reliable methods for screening the presence of non-halal components of pig derivatives and non-halal meats in food and pharmaceutical products.

Wild Boar-Specific PCR Assay and Sequence Analysis Based on Mitochondrial Cytochrome-B Gene for Halal Authentication Studies

Wild boar meat (WBM) is non-halal meat widely abused in Indonesia. The most common case is mixing beef with WBM either in raw or processed foods. Therefore, it is necessary to develop a detection method of WBM contamination. The objective of this study was to employ polymerase chain reaction (PCR) and sequence analysis using species specific primer (SSP) targeting on wild boar mitochondrial cytochrome-b (CYTBWB2-wb) gene for the identification of WBM in a meatball. The specificity of primer was tested, and the amplicon size was confirmed with conventional PCR and agarose electrophoresis. The base sequences were analyzed using GeneStudio software and subjected to BLAST using NCBI. CYTBWB2-wb primer was also used to test the reference meatballs made from beef and WBM using real-time PCR. The result showed that CYTBWB2-wb amplified wild boar Cyt-B mt-DNA gene specifically. The amplicon size was 194 base pair (bp) with a similarity of 93–98% toward gen Cyt-B mt-DNA of several wild boar types. The primer is able to detect WBM on the reference meatballs up to 0.1% wt/wt with efficiency value of 108.0% and coefficient of determination (R2) of 0.970. The CYTBWB2-wb primer proved to be specific and could be used as a standard method to identify the presence of WBM contamination in meatball products for halal authentication studies.