Characterization of the glyceraldehyde-3-phosphate dehydrogenase gene from the desert plant Haloxylon salicornicum using RT-PCR amplification and sequencing

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Download Full-text

Molecular characterization of African orthobunyaviruses

Journal of General Virology ◽

10.1099/vir.0.82643-0 ◽

2007 ◽

Vol 88 (6) ◽

pp. 1761-1766 ◽

Cited By ~ 8

Author(s):

E. Nakouné Yandoko ◽

S. Gribaldo ◽

C. Finance ◽

A. Le Faou ◽

B. H. Rihn

Keyword(s):

Central African Republic ◽

Reference Strain ◽

Central Africa ◽

Pcr Amplification ◽

Rt Pcr ◽

Overlapping Reading Frames ◽

Negative Sense ◽

Reading Frames ◽

Complete Genomic

The genus Orthobunyavirus is composed of segmented, negative-sense RNA viruses that are responsible for mild to severe human diseases. To date, no molecular studies of bunyaviruses in the genus Orthobunyavirus from central Africa have been reported, and their classification relies on serological testing. Four new primer pairs for RT-PCR amplification and sequencing of the complete genomic small (S) RNA segments of 10 orthobunyaviruses isolated from the Central African Republic and pertaining to five different serogroups have been designed and evaluated. Phylogenetic analysis showed that these 10 viruses belong to the Bunyamwera serogroup. The S segment sequences differ from those of the Bunyamwera virus reference strain by 5–15 % at the nucleotide level, and both overlapping reading frames, encoding the nucleocapsid (N) and non-structural (NS) proteins, were evident in sequenced genomes. This study should improve diagnosis and surveillance of African bunyaviruses.

Download Full-text

Characterization of arenaviruses using a family-specific primer set for RT-PCR amplification and RFLP analysis

Virus Research ◽

10.1016/s0168-1702(97)01458-5 ◽

1997 ◽

Vol 49 (1) ◽

pp. 79-89 ◽

Cited By ~ 37

Author(s):

M.E Lozano ◽

D.M Posik ◽

C.G Albariño ◽

G Schujman ◽

P.D Ghiringhelli ◽

...

Keyword(s):

Pcr Amplification ◽

Rflp Analysis ◽

Rt Pcr ◽

Specific Primer

Download Full-text

Molecular characterization of pear 14-3-3b gene regulated during fruit development

Canadian Journal of Plant Science ◽

10.1139/cjps-2015-0319 ◽

2016 ◽

Vol 96 (3) ◽

pp. 433-438

Author(s):

Haiyan Shi ◽

Yujing Zhao ◽

Xuemin An ◽

Yuxing Zhang

Keyword(s):

Protein Interactions ◽

Pcr Amplification ◽

Pcr Analysis ◽

Pyrus Pyrifolia ◽

Biological Processes ◽

Protein Protein Interactions ◽

Rt Pcr ◽

Developmentally Regulated ◽

Amplification Technique

Plant 14-3-3 proteins (14-3-3s) are known to function in protein–protein interactions that mediate signal transduction pathways regulating many biological processes. The cDNA encoding putative 14-3-3 protein was isolated from pear (Pyrus pyrifolia) and designated Pp14-3-3b. Using the PCR amplification technique, the genomic clone corresponding to Pp14-3-3b was isolated and shown to contain six introns. Phylogenetic analysis clearly demonstrated that Pp14-3-3b was classified into the non-ɛ class of 14-3-3 superfamilies. Quantitative RT-PCR analysis indicated that the expression of the Pp14-3-3b gene was developmentally regulated in fruit. This study suggested that Pp14-3-3b might be involved in fruit ripening and the senescence of pear.

Download Full-text

Characterization of a cDNA for Rhesus Monkey Protein C Inhibitor – Evidence for N-Terminal Involvement in Heparin Stimulation

Thrombosis and Haemostasis ◽

10.1055/s-0038-1649885 ◽

1995 ◽

Vol 74 (04) ◽

pp. 1079-1087 ◽

Cited By ~ 8

Author(s):

Klaus-P Radtke ◽

José A Fernández ◽

Bruno O Villoutreix ◽

Judith S Greengard ◽

John H Griffin

Keyword(s):

Rhesus Monkey ◽

Protein C ◽

Activated Protein C ◽

Pcr Amplification ◽

Amino Acid Sequences ◽

Heparin Binding ◽

Reactive Center ◽

Protein C Inhibitor ◽

Polymerase Chain

SummarycDNAs for protein C inhibitor (PCI) were cloned from human and rhesus monkey 1 liver RNAs by reverse transcription and polymerase chain reaction (PCR) amplification. Sequencing showed that rhesus monkey and human PCI cDNAs were 93% identical. Predicted amino acid sequences differed at 26 of 387 residues. Pour of these differences (T352M, N359S, R362K, L3631) were in the reactive center loop that is important for inhibitory specificity, and two were in the N-terminal helix (M8T, E13K) that is implicated in glycosaminoglycan binding. PCI in human or rhesus monkey plasma showed comparable inhibitory activity towards human activated protein C in the presence of 10 U/ml heparin. However, maximal acceleration of the inhibition of activated protein C required 5-fold lower heparin concentration for rhesus monkey than for human plasma, consistent with the interpretation that the additional positive charge (E13K) in a putative-heparin binding region increased the affinity for heparin.

Download Full-text

Cloning and characterization of an aldehyde dehydrogenase gene GmALDH3-1 from soybean

Hereditas (Beijing) ◽

10.3724/sp.j.1005.2010.00492 ◽

2010 ◽

Vol 32 (5) ◽

pp. 492-497 ◽

Cited By ~ 1

Author(s):

Fang HUANG ◽

Ying-Jun CHI ◽

Hui HE ◽

De-Yue YU

Keyword(s):

Aldehyde Dehydrogenase ◽

Dehydrogenase Gene

Download Full-text

Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in Mexico

Phytopathology ◽

10.1094/phyto-07-19-0253-fi ◽

2020 ◽

Vol 110 (1) ◽

pp. 106-120 ◽

Cited By ~ 1

Author(s):

Avijit Roy ◽

Andrew L. Stone ◽

Gabriel Otero-Colina ◽

Gang Wei ◽

Ronald H. Brlansky ◽

...

Keyword(s):

High Throughput Sequencing ◽

Sensu Stricto ◽

Genome Segment ◽

Rt Pcr ◽

Sequence Comparisons ◽

Orchid Fleck Virus ◽

Reverse Transcription Pcr ◽

Sequencing Technologies ◽

Negative Sense

The genus Dichorhavirus contains viruses with bipartite, negative-sense, single-stranded RNA genomes that are transmitted by flat mites to hosts that include orchids, coffee, the genus Clerodendrum, and citrus. A dichorhavirus infecting citrus in Mexico is classified as a citrus strain of orchid fleck virus (OFV-Cit). We previously used RNA sequencing technologies on OFV-Cit samples from Mexico to develop an OFV-Cit–specific reverse transcription PCR (RT-PCR) assay. During assay validation, OFV-Cit–specific RT-PCR failed to produce an amplicon from some samples with clear symptoms of OFV-Cit. Characterization of this virus revealed that dichorhavirus-like particles were found in the nucleus. High-throughput sequencing of small RNAs from these citrus plants revealed a novel citrus strain of OFV, OFV-Cit2. Sequence comparisons with known orchid and citrus strains of OFV showed variation in the protein products encoded by genome segment 1 (RNA1). Strains of OFV clustered together based on host of origin, whether orchid or citrus, and were clearly separated from other dichorhaviruses described from infected citrus in Brazil. The variation in RNA1 between the original (now OFV-Cit1) and the new (OFV-Cit2) strain was not observed with genome segment 2 (RNA2), but instead, a common RNA2 molecule was shared among strains of OFV-Cit1 and -Cit2, a situation strikingly similar to OFV infecting orchids. We also collected mites at the affected groves, identified them as Brevipalpus californicus sensu stricto, and confirmed that they were infected by OFV-Cit1 or with both OFV-Cit1 and -Cit2. OFV-Cit1 and -Cit2 have coexisted at the same site in Toliman, Queretaro, Mexico since 2012. OFV strain-specific diagnostic tests were developed.

Download Full-text

Presenting White Blood Cell Count and Kinetics of Molecular Remission Predict Prognosis in Acute Promyelocytic Leukemia Treated With All-Trans Retinoic Acid: Result of the Randomized MRC Trial

Blood ◽

10.1182/blood.v93.12.4131 ◽

1999 ◽

Vol 93 (12) ◽

pp. 4131-4143 ◽

Cited By ~ 290

Author(s):

Alan K. Burnett ◽

David Grimwade ◽

Ellen Solomon ◽

Keith Wheatley ◽

Anthony H. Goldstone

Keyword(s):

Retinoic Acid ◽

Promyelocytic Leukemia ◽

Rt Pcr ◽

Blood Cell Count ◽

Relapse Risk ◽

Trans Retinoic Acid ◽

All Trans Retinoic Acid ◽

To Receive ◽

Risk Of Relapse

Abstract All-trans retinoic acid (ATRA) is an essential component of the treatment of acute promyelocytic leukemia (APL), but the optimal timing and duration remain to be determined. Molecular characterization of this disease can refine the diagnosis and could be potentially useful in monitoring response to treatment. Patients defined morphologically to have APL were randomized to receive a 5-day course of ATRA before commencing chemotherapy or to receive daily ATRA commencing with chemotherapy and continuing until complete remission (CR). The chemotherapy was that used in current MRC Leukaemia Trials. Outcome comparisons were by intention to treat with additional analysis for relevant risk factors. Patients were characterized by molecular techniques for the fusion products of the t(15;17) and monitored by reverse transcriptase-polymerase chain reaction (RT-PCR) during and after treatment. Two hundred thirty-nine patients were randomized. Treatment with extended ATRA resulted in a superior remission rate (87% v 70%, P < .001), due to fewer early and induction deaths (12% v 23%, P = .02), and less resistant disease (2% v 7%, P = .03), which was associated with a significantly more rapid recovery of neutrophils and platelets. Extended ATRA reduced relapse risk (20%v 36% at 4 years, P = .04) and resulted in superior survival (71% v 52% at 4 years, P = .005). Presenting white blood cell count (WBC) was a key determinant of outcome. The 70% of patients who presented with a WBC less than 10 × 109/L had a better CR (85% v62%, P = .0001) and reduced relapse risk (22% v42%, P = .002) and superior survival (69%v 43%, P < .0001). Within the low count group, extended ATRA resulted in a better CR (94% v 76%, P= .001), reduced relapse risk (13% v 35%, P = .04), and improved survival (80% v 57%, P = .0009). There was no evidence of benefit in patients presenting with a higher WBC (>10 × 109/L). Molecular monitoring after the third chemotherapy course had a correlation with risk of relapse. The relapse risk was 57% if the RT-PCR was positive versus 27% if the RT-PCR was negative (P = .006). APL patients who present with a low WBC derive substantial benefit from combining ATRA with induction chemotherapy until remission is achieved, whereas patients with a higher WBC did not benefit. Molecular characterization of disease can improve diagnostic precision and a positive RT-PCR after consolidation identifies patients at a higher risk of relapse.

Download Full-text

The Alcohol Dehydrogenase Gene Is Nested in the outspread Locus of Drosophila melanogaster

Genetics ◽

10.1093/genetics/143.2.897 ◽

1996 ◽

Vol 143 (2) ◽

pp. 897-911 ◽

Cited By ~ 1

Author(s):

S McNabb ◽

S Greig ◽

T Davis

Keyword(s):

Drosophila Melanogaster ◽

Alcohol Dehydrogenase ◽

Pcr Amplification ◽

Transcription Unit ◽

Adjacent Gene ◽

Dehydrogenase Gene ◽

Chromosomal Breakpoints ◽

Splicing Patterns ◽

Somatic Musculature

Abstract This report describes the structure and expression of the outspread (osp) gene of Drosophila melanogaster. Previous work showed that chromosomal breakpoints associated with mutations of the osp locus map to both sides of the alcohol dehydrogenase gene (Adh), suggesting that Adh and the adjacent gene Adh' are nested in osp. We extended a chromosomal walk and mapped additional osp mutations to define the maximum molecular limit of osp as 119 kb. We identified a 6-kb transcript that hybridizes to osp region DNA and is altered or absent in osp mutants. Accumulation of this RNA peaks during embryonic and pupal periods. The osp cDNAs comprise two distinct classes based on alternative splicing patterns. The 5′ end of the longest cDNA was extended by PCR amplification. When hybridized to the osp walk, the 5′ extension verifies that Adh and Adh' are nested in osp and shows that osp has a transcription unit of ≥74 kb. In situ hybridization shows that osp is expressed both maternally and zygotically. In the ovary, osp is transcribed in nurse cells and localized in the oocyte. In embryos, expression is most abundant in the developing visceral and somatic musculature.

Download Full-text