scholarly journals Molecular characterization of African orthobunyaviruses

2007 ◽  
Vol 88 (6) ◽  
pp. 1761-1766 ◽  
Author(s):  
E. Nakouné Yandoko ◽  
S. Gribaldo ◽  
C. Finance ◽  
A. Le Faou ◽  
B. H. Rihn
Keyword(s):  
Central African Republic ◽  
Reference Strain ◽  
Central Africa ◽  
Pcr Amplification ◽  
Rt Pcr ◽  
Overlapping Reading Frames ◽  
Negative Sense ◽  
Reading Frames ◽  
Complete Genomic

The genus Orthobunyavirus is composed of segmented, negative-sense RNA viruses that are responsible for mild to severe human diseases. To date, no molecular studies of bunyaviruses in the genus Orthobunyavirus from central Africa have been reported, and their classification relies on serological testing. Four new primer pairs for RT-PCR amplification and sequencing of the complete genomic small (S) RNA segments of 10 orthobunyaviruses isolated from the Central African Republic and pertaining to five different serogroups have been designed and evaluated. Phylogenetic analysis showed that these 10 viruses belong to the Bunyamwera serogroup. The S segment sequences differ from those of the Bunyamwera virus reference strain by 5–15 % at the nucleotide level, and both overlapping reading frames, encoding the nucleocapsid (N) and non-structural (NS) proteins, were evident in sequenced genomes. This study should improve diagnosis and surveillance of African bunyaviruses.

scholarly journals Reassortment of Genome Segments Creates Stable Lineages Among Strains of Orchid Fleck Virus Infecting Citrus in Mexico

2020 ◽  
Vol 110 (1) ◽  
pp. 106-120 ◽  
Author(s):  
Avijit Roy ◽  
Andrew L. Stone ◽  
Gabriel Otero-Colina ◽  
Gang Wei ◽  
Ronald H. Brlansky ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Sensu Stricto ◽  
Genome Segment ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
Orchid Fleck Virus ◽  
Reverse Transcription Pcr ◽  
Sequencing Technologies ◽  
Negative Sense

The genus Dichorhavirus contains viruses with bipartite, negative-sense, single-stranded RNA genomes that are transmitted by flat mites to hosts that include orchids, coffee, the genus Clerodendrum, and citrus. A dichorhavirus infecting citrus in Mexico is classified as a citrus strain of orchid fleck virus (OFV-Cit). We previously used RNA sequencing technologies on OFV-Cit samples from Mexico to develop an OFV-Cit–specific reverse transcription PCR (RT-PCR) assay. During assay validation, OFV-Cit–specific RT-PCR failed to produce an amplicon from some samples with clear symptoms of OFV-Cit. Characterization of this virus revealed that dichorhavirus-like particles were found in the nucleus. High-throughput sequencing of small RNAs from these citrus plants revealed a novel citrus strain of OFV, OFV-Cit2. Sequence comparisons with known orchid and citrus strains of OFV showed variation in the protein products encoded by genome segment 1 (RNA1). Strains of OFV clustered together based on host of origin, whether orchid or citrus, and were clearly separated from other dichorhaviruses described from infected citrus in Brazil. The variation in RNA1 between the original (now OFV-Cit1) and the new (OFV-Cit2) strain was not observed with genome segment 2 (RNA2), but instead, a common RNA2 molecule was shared among strains of OFV-Cit1 and -Cit2, a situation strikingly similar to OFV infecting orchids. We also collected mites at the affected groves, identified them as Brevipalpus californicus sensu stricto, and confirmed that they were infected by OFV-Cit1 or with both OFV-Cit1 and -Cit2. OFV-Cit1 and -Cit2 have coexisted at the same site in Toliman, Queretaro, Mexico since 2012. OFV strain-specific diagnostic tests were developed.

scholarly journals CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon)

2011 ◽  
Vol 11 (3) ◽  
pp. 246-252
Author(s):  
Tri Joko Raharjo ◽  
Rosyida Azis Rizki ◽  
Stalis Norma Ethica ◽  
Elly Rustanti ◽  
L. Hartanto Nugroho
Keyword(s):  
Enzymatic Reaction ◽  
Pcr Amplification ◽  
Stilbene Synthase ◽  
Nucleotide Sequence Analysis ◽  
Dna Fragments ◽  
Gene Fragment ◽  
Rt Pcr ◽  
Gnetum Gnemon ◽  
Encoding Gene

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

scholarly journals Characterization of the Gene Cassette Required for Biosynthesis of the (α1→6)-LinkedN-Acetyl-d-Mannosamine-1-Phosphate Capsule of Serogroup A Neisseria meningitidis

1998 ◽  
Vol 180 (6) ◽  
pp. 1533-1539 ◽  
Author(s):  
John S. Swartley ◽  
Li-Jun Liu ◽  
Yoon K. Miller ◽  
Larry E. Martin ◽  
Srilatha Edupuganti ◽  
...  
Keyword(s):  
Neisseria Meningitidis ◽  
Intergenic Region ◽  
Gene Cassette ◽  
Amino Acid Identity ◽  
Open Reading Frames ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Capsule Production ◽  
Reading Frames

ABSTRACT The (α1→6)-linkedN-acetyl-d-mannosamine-1-phosphate meningococcal capsule of serogroup A Neisseria meningitidisis biochemically distinct from the sialic acid-containing capsules produced by other disease-associated meningococcal serogroups (e.g., B, C, Y, and W-135). We defined the genetic cassette responsible for expression of the serogroup A capsule. The cassette comprised a 4,701-bp nucleotide sequence located between the outer membrane capsule transporter gene, ctrA, and galE, encoding the UDP-glucose-4-epimerase. Four open reading frames (ORFs) not found in the genomes of the other meningococcal serogroups were identified. The first serogroup A ORF was separated from ctrA by a 218-bp intergenic region. Reverse transcriptase (RT) PCR and primer extension studies of serogroup A mRNA showed that all four ORFs were cotranscribed in the opposite orientation to ctrA and that transcription of the ORFs was initiated from the intergenic region by a ς-70-type promoter that overlapped the ctrA promoter. The first ORF exhibited 58% amino acid identity with the UDP-N-acetyl-d-glucosamine (UDP-GlcNAc) 2-epimerase of Escherichia coli, which is responsible for the conversion of UDP-GlcNAc into UDP-N-acetyl-d-mannosamine. Polar or nonpolar mutagenesis of each of the ORFs resulted in an abrogation of serogroup A capsule production as determined by colony immunoblots and enzyme-linked immunosorbent assay. Replacement of the serogroup A biosynthetic gene cassette with a serogroup B cassette by transformation resulted in capsule switching from a serogroup A capsule to a serogroup B capsule. These data indicate that assembly of the serogroup A capsule likely begins with monomeric UDP-GlcNAc and requires proteins encoded by three other genes found in the serogroup A N. meningitidis-specific operon located betweenctrA and galE.

Characterization of arenaviruses using a family-specific primer set for RT-PCR amplification and RFLP analysis

1997 ◽  
Vol 49 (1) ◽  
pp. 79-89 ◽  
Author(s):  
M.E Lozano ◽  
D.M Posik ◽  
C.G Albariño ◽  
G Schujman ◽  
P.D Ghiringhelli ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Rflp Analysis ◽  
Rt Pcr ◽  
Specific Primer

Molecular characterization of pear 14-3-3b gene regulated during fruit development

2016 ◽  
Vol 96 (3) ◽  
pp. 433-438
Author(s):  
Haiyan Shi ◽  
Yujing Zhao ◽  
Xuemin An ◽  
Yuxing Zhang
Keyword(s):  
Protein Interactions ◽  
Pcr Amplification ◽  
Pcr Analysis ◽  
Pyrus Pyrifolia ◽  
Biological Processes ◽  
Protein Protein Interactions ◽  
Rt Pcr ◽  
Developmentally Regulated ◽  
Amplification Technique

Plant 14-3-3 proteins (14-3-3s) are known to function in protein–protein interactions that mediate signal transduction pathways regulating many biological processes. The cDNA encoding putative 14-3-3 protein was isolated from pear (Pyrus pyrifolia) and designated Pp14-3-3b. Using the PCR amplification technique, the genomic clone corresponding to Pp14-3-3b was isolated and shown to contain six introns. Phylogenetic analysis clearly demonstrated that Pp14-3-3b was classified into the non-ɛ class of 14-3-3 superfamilies. Quantitative RT-PCR analysis indicated that the expression of the Pp14-3-3b gene was developmentally regulated in fruit. This study suggested that Pp14-3-3b might be involved in fruit ripening and the senescence of pear.

scholarly journals Complete Genomic Characterization of Plum bark necrosis stem pitting–associated virus Infecting Sweet Cherry in China

2016 ◽  
Vol 4 (3) ◽  
Author(s):  
Jiawei Wang ◽  
Ying Zhai ◽  
Weizhen Liu ◽  
Dongzi Zhu ◽  
Hanu R. Pappu ◽  
...  
Keyword(s):  
Deep Sequencing ◽  
Small Rna ◽  
Sweet Cherry ◽  
Rt Pcr ◽  
Rna Deep Sequencing ◽  
Genomic Characterization ◽  
Small Rna Deep Sequencing ◽  
Stem Pitting ◽  
Complete Genomic

Plum bark necrosis stem pitting–associated virus (PBNSPaV) causes the plum bark necrosis stem pitting–associated disease. We obtained the complete genome of a PBNSPaV isolate (PBNSPaV-TA) using small RNA deep sequencing followed by overlapping RT-PCR. To our knowledge, this is the first report of a completed genome of PBNSPaV identified from cherry trees.

scholarly journals First Report of Rice yellow mottle virus in Rice in the Central African Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 162-162 ◽  
Author(s):  
D. R. S. Longué ◽  
A. Galzi-Pinel ◽  
S. Semballa ◽  
I. Zinga ◽  
D. Fargette ◽  
...  
Keyword(s):  
Central African Republic ◽  
Disease Incidence ◽  
Central Africa ◽  
Rice Production ◽  
Mottle Virus ◽  
Cultivated Plants ◽  
Rice Yellow Mottle Virus ◽  
Rt Pcr ◽  
Serotype 1 ◽  
Yellow Mottle

Rice yellow mottle virus (RYMV, genus Sobemovirus) is a major biotic constraint to rice production in Africa. First reported in Kenya in 1966, RYMV was later found in most countries in Africa where rice (Oryza sativa, O. glaberrima) is grown (4). In the Central African Republic, the disease has never been reported in rice fields. In October 2011, plants with leaf yellowing and mottling symptoms were observed in large irrigated rice production schemes about 30 km west of Bangui, the capital of the Central African Republic, and in lowland subsistence fields in Bangui outskirts. Disease incidence was estimated at 5 to 10%, causing small patches in the fields. Mechanical inoculation with extracts of symptomatic leaves reproduced the typical yellow mottle symptoms on the susceptible O. sativa cultivar BG90-2 6 to 9 days after inoculation. Symptomatic leaves of 12 cultivated plants collected in seed beds or in fields reacted positively when tested by ELISA with polyclonal antisera raised against a Madagascan isolate of RYMV (1). Discriminating monoclonal antibodies showed that the samples contained RYMV serotype 1, a serotype found in West and Central Africa (1). Total RNA was extracted by the RNeasy Plant Mini kit (QIAGEN, Hilden, Germany) from six samples. The 720-nt RYMV coat protein gene was amplified by reverse transcriptase (RT)-PCR with primers 5′CTCCCCCACCCATCCCGAGAATT3′ and 5′CAAAGATGGCCAGGAA3′ (2). RT-PCR products were directly sequenced and sequences were deposited in GenBank (Accession Nos. KF054740 through KF054745). These six sequences showed over 98% identity with each other, and were found to be closely related to sequences of isolates from Chad and Cameroon in Central Africa (3). Knowledge of the presence of RYMV in the Central African Republic is important since rice cultivation has intensified in this country. In addition, rice is also increasingly considered as one of the main staple crops in the country. References: (1) D. Fargette et al. Arch. Virol. 147:583, 2002. (2) A. Pinel et al. Arch. Virol. 145:1621, 2000. (3) O. Traoré et al. Plant Dis. 96:1230, 2001. (4) O. Traoré et al. Virus Res. 141:258, 2009.

scholarly journals Molecular characterization of a novel cytorhabdovirus with a unique genomic organization infecting yerba mate (Ilex paraguariensis) in Argentina

2020 ◽  
Author(s):  
Nicolás Bejerman ◽  
Raúl Maximiliano Acevedo ◽  
Soledad de Breuil ◽  
Oscar A. Ruiz ◽  
Pedro Sansberro ◽  
...  
Keyword(s):  
Genomic Organization ◽  
Open Reading Frames ◽  
Ilex Paraguariensis ◽  
Yerba Mate ◽  
Sequence Identity ◽  
Distinct Evolutionary Lineage ◽  
A Genome ◽  
Negative Sense ◽  
Reading Frames

AbstractThe genome of a novel rhabdovirus was detected in yerba mate (Ilex paraguariensis St. Hil.). The newly identified virus, tentatively named yerba mate virus A (YmVA), has a genome of 14,961 nucleotides. Notably, eight open reading frames were identified in the antigenomic orientation of the negative-sense, single-stranded viral RNA, including two novel accessory genes, in the order 3’-N-P-3-4-M-G-L-8-5’. Sequence identity of the encoded proteins as well as phylogenetic analysis suggest that YmVA is a new member of the genus Cytorhabdovirus, family Rhabdoviridae. YmVA unique genomic organization and phylogenetic relationships indicate that this virus likely represents a distinct evolutionary lineage within the cytorhabdoviruses.

Characterization of a cDNA for Rhesus Monkey Protein C Inhibitor – Evidence for N-Terminal Involvement in Heparin Stimulation

1995 ◽  
Vol 74 (04) ◽  
pp. 1079-1087 ◽  
Author(s):  
Klaus-P Radtke ◽  
José A Fernández ◽  
Bruno O Villoutreix ◽  
Judith S Greengard ◽  
John H Griffin
Keyword(s):  
Rhesus Monkey ◽  
Protein C ◽  
Activated Protein C ◽  
Pcr Amplification ◽  
Amino Acid Sequences ◽  
Heparin Binding ◽  
Reactive Center ◽  
Protein C Inhibitor ◽  
Polymerase Chain

SummarycDNAs for protein C inhibitor (PCI) were cloned from human and rhesus monkey 1 liver RNAs by reverse transcription and polymerase chain reaction (PCR) amplification. Sequencing showed that rhesus monkey and human PCI cDNAs were 93% identical. Predicted amino acid sequences differed at 26 of 387 residues. Pour of these differences (T352M, N359S, R362K, L3631) were in the reactive center loop that is important for inhibitory specificity, and two were in the N-terminal helix (M8T, E13K) that is implicated in glycosaminoglycan binding. PCI in human or rhesus monkey plasma showed comparable inhibitory activity towards human activated protein C in the presence of 10 U/ml heparin. However, maximal acceleration of the inhibition of activated protein C required 5-fold lower heparin concentration for rhesus monkey than for human plasma, consistent with the interpretation that the additional positive charge (E13K) in a putative-heparin binding region increased the affinity for heparin.

Sign in / Sign up

Export Citation Format

Share Document