RT-PCR amplification of a Rhizopus oryzae lactate dehydrogenase gene fragment

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

Download Full-text

SPECIFIC DETECTION OF AMANITA PHALLOIDES MYCELIUM AND SPORES BY PCR AMPLIFICATION OF THE GPD (GLYCERALDEHYDE-3-PHOSPHATE DEHYDROGENASE) GENE FRAGMENT

Journal of Food Biochemistry ◽

10.1111/j.1745-4514.2000.tb00696.x ◽

2000 ◽

Vol 24 (3) ◽

pp. 201-212 ◽

Cited By ~ 3

Author(s):

ROMAN KOTŁOWSKI ◽

PRZEMYSŁAW MYJAK ◽

JÓZEF KUR

Keyword(s):

Pcr Amplification ◽

Amanita Phalloides ◽

Gene Fragment ◽

Specific Detection ◽

Dehydrogenase Gene

Download Full-text

Lactic acid production by Saccharomyces cerevisiae expressing a Rhizopus oryzae lactate dehydrogenase gene

Journal of Industrial Microbiology & Biotechnology ◽

10.1007/s10295-002-0004-2 ◽

2003 ◽

Vol 30 (1) ◽

pp. 22-27 ◽

Cited By ~ 63

Author(s):

Christopher D. Skory

Keyword(s):

Saccharomyces Cerevisiae ◽

Lactic Acid ◽

Lactate Dehydrogenase ◽

Acid Production ◽

Rhizopus Oryzae ◽

Lactic Acid Production ◽

Dehydrogenase Gene

Download Full-text

Isolasi fragmen gen LIPASE dari kapang Absidia corymbifera, Rhizopus oryzae dan Rhizopus oligosporus Isolation of LIPASE gene fragment from Absidia corymbifera, Rhizopus oryzae and Rhizopus oligosporus fungi

E-Journal Menara Perkebunan ◽

10.22302/ppbbi.jur.mp.v77i1.112 ◽

2016 ◽

Vol 77 (1) ◽

Author(s):

Riza A. PUTRANTO ◽

Asmini BUDIANI

Keyword(s):

Rhizopus Oryzae ◽

Efficient Production ◽

Gene Fragment ◽

Rt Pcr ◽

Rhizopus Oligosporus ◽

Lipase Gene ◽

Absidia Corymbifera ◽

Pcr Product ◽

Polymerase Chain ◽

Rhizopus Niveus

AbstractDiversification of oil palm products, suchas healthy oil, needs lipase sustainability as abiocatalist. Many attempts have beendeveloped to produce lipase, includingintensive exploration and screening of severalspecies of molds. Genetic engineering for overexpression of LIPASE gene in the selectedmold is considered to be the potentialapproach for efficient production of thisenzyme. This research was aimed to isolate theLIPASE gene fragment of Indonesianindigenous fungi, namely Absidia corymbifera,Rhizopus oryzae and R. oligosporus by meansof RT-PCR (Reverse Transcriptase PolymeraseChain Reaction) technique using heterologousprimers. The result showed that a cDNAfragment of 462 bp has been amplified andisolated from the three fungi with differentconcentration. The highest quantity was foundfrom A. corymbifera. The RT-PCR productsisolated from A. corymbifera was cloned,sequenced and analyzed for its homology to thesequence of LIPASE gene from other species.BLAST analysis showed that the DNA sequenceof the cloned RT-PCR product derived fromA. corymbifera was highly homologous withLIPASE gene from Rhizopus niveus.AbstraksDiversifikasi produk kelapa sawit, sepertiminyak sehat (healthy oil) memerlukanketersediaan lipase sebagai biokatalis. Berbagaiupaya untuk produksi lipase telah dikembang-kan, termasuk eksplorasi dan skrining terhadapbeberapa spesies kapang secara intensif.Rekayasa genetika untuk mengoverekspresi-kan gen LIPASE pada kapang hasil skriningtersebut dipandang merupakan satu pendekatanpotensial untuk produksi enzim ini secaraefisien. Penelitian ini bertujuan untukmengisolasi fragmen gen LIPASE dari tigakapang indigenous Indonesia, yaituA. corymbifera, R. oryzae dan R. oligosporus,menggunakan teknik RT-PCR (ReverseTranscriptase Polymerase Chain Reaction).Hasil penelitian menunjukkan bahwa fragmencDNA sepanjang 462 bp dari ketiga kapangtelah diisolasi, masing-masing dengankuantitas yang berbeda. Hasil tertinggidiperoleh dari kapang A. corymbifera. ProdukRT-PCR dari A. corymbifera diklon, disekuenkemudian dianalisis homologinya dengansekuen gen LIPASE dari spesies lain. AnalisisBLAST menunjukkan bahwa sekuen DNA dariproduk RT-PCR terklon yang berasal dariA. corymbifera memiliki homologi tinggidengan gen LIPASE dari Rhizopus niveus.

Download Full-text

Isolasi fragmen gen LIPASE dari kapang Absidia corymbifera, Rhizopus oryzae dan Rhizopus oligosporus Isolation of LIPASE gene fragment from Absidia corymbifera, Rhizopus oryzae and Rhizopus oligosporus fungi

E-Journal Menara Perkebunan ◽

10.22302/iribb.jur.mp.v77i1.112 ◽

2016 ◽

Vol 77 (1) ◽

Author(s):

Riza A. PUTRANTO ◽

Asmini BUDIANI

Keyword(s):

Rhizopus Oryzae ◽

Efficient Production ◽

Gene Fragment ◽

Rt Pcr ◽

Rhizopus Oligosporus ◽

Lipase Gene ◽

Absidia Corymbifera ◽

Pcr Product ◽

Polymerase Chain ◽

Rhizopus Niveus

AbstractDiversification of oil palm products, suchas healthy oil, needs lipase sustainability as abiocatalist. Many attempts have beendeveloped to produce lipase, includingintensive exploration and screening of severalspecies of molds. Genetic engineering for overexpression of LIPASE gene in the selectedmold is considered to be the potentialapproach for efficient production of thisenzyme. This research was aimed to isolate theLIPASE gene fragment of Indonesianindigenous fungi, namely Absidia corymbifera,Rhizopus oryzae and R. oligosporus by meansof RT-PCR (Reverse Transcriptase PolymeraseChain Reaction) technique using heterologousprimers. The result showed that a cDNAfragment of 462 bp has been amplified andisolated from the three fungi with differentconcentration. The highest quantity was foundfrom A. corymbifera. The RT-PCR productsisolated from A. corymbifera was cloned,sequenced and analyzed for its homology to thesequence of LIPASE gene from other species.BLAST analysis showed that the DNA sequenceof the cloned RT-PCR product derived fromA. corymbifera was highly homologous withLIPASE gene from Rhizopus niveus.AbstraksDiversifikasi produk kelapa sawit, sepertiminyak sehat (healthy oil) memerlukanketersediaan lipase sebagai biokatalis. Berbagaiupaya untuk produksi lipase telah dikembang-kan, termasuk eksplorasi dan skrining terhadapbeberapa spesies kapang secara intensif.Rekayasa genetika untuk mengoverekspresi-kan gen LIPASE pada kapang hasil skriningtersebut dipandang merupakan satu pendekatanpotensial untuk produksi enzim ini secaraefisien. Penelitian ini bertujuan untukmengisolasi fragmen gen LIPASE dari tigakapang indigenous Indonesia, yaituA. corymbifera, R. oryzae dan R. oligosporus,menggunakan teknik RT-PCR (ReverseTranscriptase Polymerase Chain Reaction).Hasil penelitian menunjukkan bahwa fragmencDNA sepanjang 462 bp dari ketiga kapangtelah diisolasi, masing-masing dengankuantitas yang berbeda. Hasil tertinggidiperoleh dari kapang A. corymbifera. ProdukRT-PCR dari A. corymbifera diklon, disekuenkemudian dianalisis homologinya dengansekuen gen LIPASE dari spesies lain. AnalisisBLAST menunjukkan bahwa sekuen DNA dariproduk RT-PCR terklon yang berasal dariA. corymbifera memiliki homologi tinggidengan gen LIPASE dari Rhizopus niveus.

Download Full-text

The Alcohol Dehydrogenase Gene Is Nested in the outspread Locus of Drosophila melanogaster

Genetics ◽

10.1093/genetics/143.2.897 ◽

1996 ◽

Vol 143 (2) ◽

pp. 897-911 ◽

Cited By ~ 1

Author(s):

S McNabb ◽

S Greig ◽

T Davis

Keyword(s):

Drosophila Melanogaster ◽

Alcohol Dehydrogenase ◽

Pcr Amplification ◽

Transcription Unit ◽

Adjacent Gene ◽

Dehydrogenase Gene ◽

Chromosomal Breakpoints ◽

Splicing Patterns ◽

Somatic Musculature

Abstract This report describes the structure and expression of the outspread (osp) gene of Drosophila melanogaster. Previous work showed that chromosomal breakpoints associated with mutations of the osp locus map to both sides of the alcohol dehydrogenase gene (Adh), suggesting that Adh and the adjacent gene Adh' are nested in osp. We extended a chromosomal walk and mapped additional osp mutations to define the maximum molecular limit of osp as 119 kb. We identified a 6-kb transcript that hybridizes to osp region DNA and is altered or absent in osp mutants. Accumulation of this RNA peaks during embryonic and pupal periods. The osp cDNAs comprise two distinct classes based on alternative splicing patterns. The 5′ end of the longest cDNA was extended by PCR amplification. When hybridized to the osp walk, the 5′ extension verifies that Adh and Adh' are nested in osp and shows that osp has a transcription unit of ≥74 kb. In situ hybridization shows that osp is expressed both maternally and zygotically. In the ovary, osp is transcribed in nurse cells and localized in the oocyte. In embryos, expression is most abundant in the developing visceral and somatic musculature.

Download Full-text