scholarly journals CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon)

2011 ◽  
Vol 11 (3) ◽  
pp. 246-252
Author(s):  
Tri Joko Raharjo ◽  
Rosyida Azis Rizki ◽  
Stalis Norma Ethica ◽  
Elly Rustanti ◽  
L. Hartanto Nugroho
Keyword(s):  
Enzymatic Reaction ◽  
Pcr Amplification ◽  
Stilbene Synthase ◽  
Nucleotide Sequence Analysis ◽  
Dna Fragments ◽  
Gene Fragment ◽  
Rt Pcr ◽  
Gnetum Gnemon ◽  
Encoding Gene

Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS) encoding gene from melinjo plant (Gnetum gnemon L.) has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction) was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3') and GGR2 (5' CTGGATCGCACATCC TGGTG 3') primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

scholarly journals Characterization of the New Metallo-β-Lactamase VIM-13 and Its Integron-Borne Gene from a Pseudomonas aeruginosa Clinical Isolate in Spain

2008 ◽  
Vol 52 (10) ◽  
pp. 3589-3596 ◽  
Author(s):  
Carlos Juan ◽  
Alejandro Beceiro ◽  
Olivia Gutiérrez ◽  
Sebastián Albertí ◽  
Margalida Garau ◽  
...  
Keyword(s):  
Pseudomonas Aeruginosa ◽  
Pcr Amplification ◽  
Class 1 Integron ◽  
Negative Results ◽  
New Variant ◽  
Class B ◽  
Class 1 ◽  
Encoding Gene ◽  
Good Agreement

ABSTRACT During a survey conducted to evaluate the incidence of class B carbapenemase (metallo-β-lactamase [MBL])-producing Pseudomonas aeruginosa strains from hospitals in Majorca, Spain, five clinical isolates showed a positive Etest MBL screening test result. In one of them, strain PA-SL2, the presence of a new bla VIM derivative (bla VIM-13) was detected by PCR amplification with bla VIM-1-specific primers followed by sequencing. The bla VIM-13-producing isolate showed resistance to all β-lactams (except aztreonam), gentamicin, tobramycin, and ciprofloxacin. VIM-13 exhibited 93% and 88% amino acid sequence identities with VIM-1 and VIM-2, respectively. bla VIM-13 was cloned in parallel with bla VIM-1, and the resistance profile conferred was analyzed both in Escherichia coli and in P. aeruginosa backgrounds. Compared to VIM-1, VIM-13 conferred slightly higher levels of resistance to piperacillin and lower levels of resistance to ceftazidime and cefepime. VIM-13 and VIM-1 were purified in parallel as well, and their kinetic parameters were compared. The k cat/K m ratios for the antibiotics mentioned above were in good agreement with the MIC data. Furthermore, EDTA inhibited the activity of VIM-13 approximately 25 times less than it inhibited the activity of VIM-1. VIM-13 was harbored in a class 1 integron, along with a new variant (Ala108Thr) of the aminoglycoside-modifying enzyme encoding gene aacA4, which confers resistance to gentamicin and tobramycin. Finally, the VIM-13 integron was apparently located in the chromosome, since transformation and conjugation experiments consistently yielded negative results and the bla VIM-13 probe hybridized only with the genomic DNA.

scholarly journals Characterization of the Serpin-Encoding Gene of Bifidobacterium breve 210B

2010 ◽  
Vol 76 (10) ◽  
pp. 3206-3219 ◽  
Author(s):  
Francesca Turroni ◽  
Elena Foroni ◽  
Mary O'Connell Motherway ◽  
Francesca Bottacini ◽  
Vanessa Giubellini ◽  
...  
Keyword(s):  
Transcriptional Start Site ◽  
Northern Hybridization ◽  
Rt Pcr ◽  
Significant Similarity ◽  
Bifidobacterium Breve ◽  
Polycistronic Mrna ◽  
Reverse Transcription Pcr ◽  
Number Of Genes ◽  
Encoding Gene

ABSTRACT Members of the serpin (serine protease inhibitor) superfamily have been identified in higher multicellular eukaryotes, as well as in bacteria, although examination of available genome sequences has indicated that homologs of the bacterial serpin-encoding gene (ser) are not widely distributed. In members of the genus Bifidobacterium this gene appears to be present in at least 5, and perhaps up to 9, of the 30 species tested. Moreover, phylogenetic analysis using available bacterial and eukaryotic serpin sequences revealed that bifidobacteria produce serpins that form a separate clade. We characterized the ser 210B locus of Bifidobacterium breve 210B, which encompasses a number of genes whose deduced protein products display significant similarity to proteins encoded by corresponding loci found in several other bifidobacteria. Northern hybridization, primer extension, microarray, reverse transcription-PCR (RT-PCR), and quantitative real-time PCR (qRT-PCR) analyses revealed that a 3.5-kb polycistronic mRNA encompassing the ser 210B operon with a single transcriptional start site is strongly induced following treatment of B. breve 210B cultures with some proteases. Interestingly, transcription of other bifidobacterial ser homologs appears to be triggered by different proteases.

Isolation and characterization of chalcone synthase (CHS) gene from Phalaenopsis and Doritaenopsis orchids

2020 ◽  
Vol 21 (11) ◽  
Author(s):  
Dewi Sukma ◽  
Aline Sisi Handini ◽  
Sudarsono Sudarsono
Keyword(s):  
Nucleotide Sequence ◽  
Chalcone Synthase ◽  
Pcr Amplification ◽  
Nucleotide Sequence Analysis ◽  
Degenerate Primers ◽  
Multiple Sequence ◽  
Isolation And Characterization ◽  
Key Enzyme ◽  
Young Leaves

Abstract. Sukma D, Handini AS, Sudarsono. 2020. Isolation and characterization of chalcone synthase (CHS) gene from Phalaenopsis and Doritaenopsis orchids. Biodiversitas 21: 5054-5064. Chalcone synthase (CHS) is a key enzyme in flavonoid biosynthesis. The research aims to isolate and characterize the CHS gene nucleotide sequence diversity of nine Phalaenopsis and one Doritaenopsis genotypes. Genomic DNA was isolated from young leaves and used to PCR amplify the gene using CHS specific degenerate primers. Results of PCR amplification yielded DNA fragments of 700 bp. Upon sequencing and nucleotide sequence analysis, we found that the genomic fragments were partial CHS gene from Phalaenopsis and Doritaenopsis genotypes and deposited the sequences in the NCBI Genebank Database accession numbers of KR184089-KR184098. More analysis of the sequences confirmed they shared ranged from 81-99% sequence identities to known CHS genes from Phalaenopsis deposited in the NCBI Database. They also shared 84-100% amino acid residues identity to CHS polypeptides. Multiple sequence alignment (MSA) and phylogenetic analysis further revealed the determined CHS nucleotide sequences from Phalaenopsis and Doritaenopsis genotypes were closely related to CHS genes from other orchid species.

scholarly journals Molecular characterization of African orthobunyaviruses

2007 ◽  
Vol 88 (6) ◽  
pp. 1761-1766 ◽  
Author(s):  
E. Nakouné Yandoko ◽  
S. Gribaldo ◽  
C. Finance ◽  
A. Le Faou ◽  
B. H. Rihn
Keyword(s):  
Central African Republic ◽  
Reference Strain ◽  
Central Africa ◽  
Pcr Amplification ◽  
Rt Pcr ◽  
Overlapping Reading Frames ◽  
Negative Sense ◽  
Reading Frames ◽  
Complete Genomic

The genus Orthobunyavirus is composed of segmented, negative-sense RNA viruses that are responsible for mild to severe human diseases. To date, no molecular studies of bunyaviruses in the genus Orthobunyavirus from central Africa have been reported, and their classification relies on serological testing. Four new primer pairs for RT-PCR amplification and sequencing of the complete genomic small (S) RNA segments of 10 orthobunyaviruses isolated from the Central African Republic and pertaining to five different serogroups have been designed and evaluated. Phylogenetic analysis showed that these 10 viruses belong to the Bunyamwera serogroup. The S segment sequences differ from those of the Bunyamwera virus reference strain by 5–15 % at the nucleotide level, and both overlapping reading frames, encoding the nucleocapsid (N) and non-structural (NS) proteins, were evident in sequenced genomes. This study should improve diagnosis and surveillance of African bunyaviruses.

scholarly journals Evidence for airborne transmission of Norwalk-like virus (NLV) in a hotel restaurant

2000 ◽  
Vol 124 (3) ◽  
pp. 481-487 ◽  
Author(s):  
P. J. MARKS ◽  
I. B. VIPOND ◽  
D. CARLISLE ◽  
D. DEAKIN ◽  
R. E. FEY ◽  
...  
Keyword(s):  
Electron Microscopy ◽  
Polymerase Chain Reaction ◽  
Inverse Relationship ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Virus Particles ◽  
Stool Samples ◽  
Polymerase Chain

An outbreak of gastroenteritis followed a meal in a large hotel during which one of the diners vomited. The clinical features of the illness suggested Norwalk-like virus (NLV, small round structured virus) infection, and this was confirmed by electron microscopy and reverse transcriptase polymerase chain reaction (RT–PCR) of stool samples. Further characterization of the virus by nucleotide sequence analysis of the PCR amplicons revealed identical strains in all the affected individuals. The foods served at the meal could not be demonstrated to be the cause of the outbreak. Analysis of attack rates by dining table showed an inverse relationship with the distance from the person who vomited. No one eating in a separate restaurant reported illness. Transmission from person-to-person or direct contamination of food seems unlikely in this outbreak. However, the findings are consistent with airborne spread of NLV with infection by inhalation with subsequent ingestion of virus particles.

Characterization of arenaviruses using a family-specific primer set for RT-PCR amplification and RFLP analysis

1997 ◽  
Vol 49 (1) ◽  
pp. 79-89 ◽  
Author(s):  
M.E Lozano ◽  
D.M Posik ◽  
C.G Albariño ◽  
G Schujman ◽  
P.D Ghiringhelli ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Rflp Analysis ◽  
Rt Pcr ◽  
Specific Primer

Detection and molecular characterization of ascarid nematode infection (Toxascaris leonina and Toxocara cati) in captive Asiatic lions (Panthera leo persica)

2012 ◽  
Vol 57 (1) ◽  
Author(s):  
Rahul Pawar ◽  
Uthandaraman Lakshmikantan ◽  
Shakir Hasan ◽  
Anantula Poornachandar ◽  
Sisinthy Shivaji
Keyword(s):  
Sequence Analysis ◽  
Molecular Characterization ◽  
Ribosomal Rna ◽  
Pcr Amplification ◽  
Microscopic Analysis ◽  
Toxocara Canis ◽  
Nucleotide Sequence Analysis ◽  
Toxocara Cati ◽  
Toxascaris Leonina

AbstractThe objective of this study was to investigate the ascarid infection in Asiatic lions using scat samples, based on microscopic analysis, PCR amplification of the ITS-2 region of ribosomal DNA and sequence analysis of the amplicons. Microscopic analysis indicated the presence of eggs of Toxascaris leonina in eleven of the sixteen scat samples analysed and in one of these eleven scats eggs of Toxocara cati were also detected. In five of the scats eggs were not detectable. The presence of T. leonina in all the infected samples was also confirmed by PCR amplification of the ITS-2 of ribosomal RNA gene and five of these also showed amplicons corresponding to T. cati, respectively. Toxocara canis infection was not observed in any of the scat samples. Nucleotide sequence analysis of the ITS-2 region indicated 97% to 99% similarity with T. leonina and T. cati, respectively. To our knowledge, this is the first molecular characterization of ascarid infection in captive Asiatic lions from a zoological garden of India. This study also indicates that Asiatic lions are more prone to infection either with T. leonina or T. cati and the parasite is not host specific.

Molecular characterization of pear 14-3-3b gene regulated during fruit development

2016 ◽  
Vol 96 (3) ◽  
pp. 433-438
Author(s):  
Haiyan Shi ◽  
Yujing Zhao ◽  
Xuemin An ◽  
Yuxing Zhang
Keyword(s):  
Protein Interactions ◽  
Pcr Amplification ◽  
Pcr Analysis ◽  
Pyrus Pyrifolia ◽  
Biological Processes ◽  
Protein Protein Interactions ◽  
Rt Pcr ◽  
Developmentally Regulated ◽  
Amplification Technique

Plant 14-3-3 proteins (14-3-3s) are known to function in protein–protein interactions that mediate signal transduction pathways regulating many biological processes. The cDNA encoding putative 14-3-3 protein was isolated from pear (Pyrus pyrifolia) and designated Pp14-3-3b. Using the PCR amplification technique, the genomic clone corresponding to Pp14-3-3b was isolated and shown to contain six introns. Phylogenetic analysis clearly demonstrated that Pp14-3-3b was classified into the non-ɛ class of 14-3-3 superfamilies. Quantitative RT-PCR analysis indicated that the expression of the Pp14-3-3b gene was developmentally regulated in fruit. This study suggested that Pp14-3-3b might be involved in fruit ripening and the senescence of pear.

Sign in / Sign up

Export Citation Format

Share Document