Portrait of transcriptional responses to ultraviolet and ionizing radiation in human cells

AbstractThe systematic study of transcriptional responses to genetic and chemical perturbations in human cells is still in its early stages. The largest available dataset to date is the newly released L1000 compendium. With its 1.3 million gene expression profiles of treated human cells it offers many opportunities for biomedical data mining, but also data normalization challenges of new dimensions. We developed a novel and practical approach to obtain accurate estimates of fold change response profiles from L1000, based on the RUV (Remove Unwanted Variation) statistical framework. Extending RUV to a big data setting, we propose an estimation procedure, in which an underlying RUV model is tuned by feedback through dataset specific statistical measures, reflecting

Download Full-text

DNA-binding protein activated by gamma radiation in human cells

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279-5285.1990 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text

Transcriptional responses to ultraviolet and ionizing radiation: An approach based on graph curvature

2016 IEEE International Conference on Bioinformatics and Biomedicine (BIBM) ◽

10.1109/bibm.2016.7822706 ◽

2016 ◽

Author(s):

Yongxin Chen ◽

Jung Hun Oh ◽

Romeil Sandhu ◽

Sangkyu Lee ◽

Joseph O. Deasy ◽

...

Keyword(s):

Ionizing Radiation ◽

Transcriptional Responses

Download Full-text

DNA-binding protein activated by gamma radiation in human cells.

Molecular and Cellular Biology ◽

10.1128/mcb.10.10.5279 ◽

1990 ◽

Vol 10 (10) ◽

pp. 5279-5285 ◽

Cited By ~ 40

Author(s):

S P Singh ◽

M F Lavin

Keyword(s):

Dna Binding ◽

Ionizing Radiation ◽

Mammalian Cells ◽

Binding Protein ◽

Simian Virus 40 ◽

Dna Binding Protein ◽

Simian Virus ◽

Human Cells ◽

Binding Motif ◽

Binding Studies

DNA damage-inducible responses in mammalian cells tend to lack specificity and can be activated by any one of a number of damaging agents. Although a number of different induced proteins have been described, their involvement in DNA processing and transcriptional control remains unresolved. We describe the appearance of a previously unreported, specific DNA-binding protein in nuclei from human cells exposed to ionizing radiation, which was not detected in nuclear extracts from unperturbed cells. The distal part of the simian virus 40 enhancer (without the AP-1 site) and oligonucleotide sequences derived from that sequence were used in binding studies. The appearance of this activity was dose dependent and transient, reaching a maximum at 1 h postirradiation and disappearing from nuclei by 9 h. This protein was induced in cells by a mechanism not requiring de novo protein synthesis, and the response was specific for ionizing radiation and radiomimetic agents; neither UV nor heat shock invoked a response. The DNA-binding protein was present in the cytoplasm of untreated cells, apparently being translocated to the nucleus only after radiation exposure. Southwestern (DNA-protein) analysis demonstrated that the nuclear and cytoplasmic proteins were approximately the same size, 43,000 daltons. The protected DNA-binding motif, using the distal fragment of the simian virus 40 enhancer as the substrate, was shown by DNase I footprint analysis to be pTGTCAGTTAGGGTACAGTCAATCCCAp. This was confirmed by dimethyl sulfate footprinting.

Download Full-text