First Report of Cherry virus A in Sweet Cherry Trees in China

Plants in the genus Prunus of the family Rosaceae are important fruit and ornamental trees in China. In June of 2007, sweet cherry (Prunus avium) trees with mottling and mosaic symptoms were observed in a private garden near Kunming, Yunnan Province. Twenty-four samples, six each from sweet cherry, sour cherry (P. cerasus), flowering cherry (P. serrulata), and peach (P. persica) were collected from trees in private and community gardens in the area. The peach and sour and flowering cherry trees did not show any symptoms. Total nucleic acids were extracted using a cetyltrimethylammoniumbromide (CTAB) extraction method, and the extracts were tested for the following eight viruses by reverse transcription (RT)-PCR: American plum line pattern virus, Apple chlorotic leaf spot virus, Cherry green ring mottle virus, Cherry necrotic rusty mottle virus, Cherry virus A (CVA), Little cherry virus 1, Prune dwarf virus, and Prunus necrotic ringspot virus. Only CVA was detected in two symptomatic sweet cherry trees by RT-PCR with forward (5′-GTGGCATTCAACTAGCACCTAT-3′) and reverse (5′-TCAGCTGCCTCAGCTTGGC-3′) primers specific to an 873-bp fragment of the CVA replicase gene (2). The CVA infection of the two trees was confirmed by RT-PCR using primers CVA-7097U and CVA-7383L that amplified a 287-bp fragment from the 3′-untranslated region (UTR) of the virus (1). Amplicons from both amplifications were cloned and sequenced. Analysis of the predicted amino acid sequences of the 873-bp fragments (GenBank Accession Nos. EU862278 and EU862279) showed that they were 98% identical with each other and 97 to 98% with the type isolate of CVA from Germany (GenBank Accession No. NC_003689). The 286-bp sequences of the 3′-UTR (GenBank Accession Nos. FJ608982 and FJ608983) were 93% identical with each other and 93 to 98% with the type isolate. The sequence indicated that the three isolates were very similar and should be considered to be the same strain. CVA is a member of the genus Capillovirus in the family Flexiviridae and has been previously reported in Europe, North America, and Japan. The contribution of CVA to the symptoms observed and its distribution in China remain to be evaluated. To our knowledge, this is the first report of CVA in sweet cherry in China. References: (1) M. Isogai et al. J. Gen. Plant Pathol. 70:288. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995.

Download Full-text

First Report of Little cherry virus 2 in Flowering and Sweet Cherry Trees in China

Plant Disease ◽

10.1094/pdis-10-10-0766 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1484-1484 ◽

Cited By ~ 4

Author(s):

W.-L. Rao ◽

F. Li ◽

R.-J. Zuo ◽

R. Li

Keyword(s):

Sweet Cherry ◽

Sequence Data ◽

Community Gardens ◽

Economic Losses ◽

Helicase Domain ◽

Rt Pcr ◽

Viral Origin ◽

First Report ◽

Flowering Cherry ◽

Cherry Trees

Many viruses infect Prunus spp. and cause diseases on them. During a survey of stone fruit trees in 2008 and 2009, flowering cherry (Prunus serrulata) and sweet cherry (P. avium) trees with foliar chlorosis and reddening, stem deformity, and tree stunting were observed in private orchards in Anning and Fumin counties of Yunnan Province. Some sweet cherry trees with severe symptoms yielded small and few fruits and had to be removed. Leaf samples were collected from 68 flowering cherry and 30 sweet cherry trees, either symptomatic or asymptomatic, from private orchards and community gardens in Kunming and counties Anning, Chenggong, Fumin, Jinning, Ludian and Yiliang. Total nucleic acids were extracted with a CTAB extraction method and tested by reverse transcription (RT)-PCR assay using virus-specific primers. Little cherry virus 2 (LChV-2), Cherry virus A (CVA), Prunus necrotic ringspot virus (PNRSV), and Prune dwarf virus (PDV) were detected and infection rates were 68.4, 16.3, 9.2, and 7.1%, respectively. Infection of LChV-2 was common in all counties except Ludian where the orchards were healthy. Of 68 infected trees, 29 were found to be infected with LChV-2 and CVA, PDV or PNRSV. LChV-2 was detected in this study by RT-PCR using a pair of novel primers, LCV2-1 (5′-TTCAATATGAGCAGTGTTCCTAAC-3′) and LCV2-4 (5′-ACTCGTCTTGTGACATACCAGTC-3′), in 59 flowering cherry (87%) and 8 sweet cherry (27%) trees, respectively. The primer pair was designed according to alignment of three available LChV-2 sequences (GenBank Nos. NC_005065, AF416335, and AF333237) to amplify the partial RNA-dependent RNA polymerase gene (ORF1b) of 781 bp. The amplicons of selected samples (Anning26 and Yiliang60) were sequenced directly and sequences of 651 bp (GenBank No. HQ412772) were obtained from both samples. Pairwise comparisons and phylogenetic analysis of the sequences show that the two isolates are identical to one another and share 92 to 96% at the amino acid (aa) sequence level to those of other isolates available in the GenBank database. The sequence data confirm that these isolates are a strain of LChV-2 and genetic variation among different strains is relatively high (2). Biological and serological assays are not available for the LChV-2 detection; therefore, the LChV-2 infections of these trees were further confirmed by RT-PCR using primer pair LCV2-5 (5′-TGTTTGTGTCATGTTGTCGGAGAAG-3′) and LCV2-6 (5′-TGAATACCCGAGAACAAGGACTC-3′), which amplified the helicase domain (ORF1a) of ~451 bp. The amplicons from samples Anning26 and Yiliang60 were cloned and sequenced. The 408-bp sequences (excluding primer sequences) were 92 to 98% identical at the aa sequence level to those of other isolates, confirming again their viral origin. LChV-2 (genus Ampelovirus, family Closteroviridae) (4) has been associated with little cherry disease (LChD), a widespread viral disease of sweet and sour cherries (1,3). The virus is transferred between geographic areas mainly by propagated materials. Ornamental and sweet cherries are important crops in China and LChD has the potential to cause significant economic losses. Thus, certified clean stock should be used to establish new orchards. To our knowledge, this is the first report of LChV-2 in cherries in China. References: (1) N. B. Bajet et al. Plant Dis. 92:234, 2008. (2) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (3) B. Komorowska and M. Cieslińska, Plant Dis. 92:1366, 2008. (4) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005.

Download Full-text

First Report of Cherry necrotic rusty mottle virus Infecting Sweet Cherry Trees in Korea

Plant Disease ◽

10.1094/pdis-07-13-0723-pdn ◽

2014 ◽

Vol 98 (1) ◽

pp. 164-164 ◽

Cited By ~ 3

Author(s):

I. S. Cho ◽

G. S. Choi ◽

S. K. Choi ◽

E. Y. Seo ◽

H. S. Lim

Keyword(s):

Sweet Cherry ◽

Mottle Virus ◽

Post Inoculation ◽

Rt Pcr ◽

First Report ◽

Coat Protein Region ◽

Pcr Products ◽

Leafroll Virus ◽

Leaf Virus ◽

Cherry Trees

Cherry necrotic rusty mottle virus (CNRMV), an unassigned member in the family Betaflexiviridae, has been reported in sweet cherry in North America, Europe, New Zealand, Japan, China, and Chile. The virus causes brown, angular necrotic spots, shot holes on the leaves, gum blisters, and necrosis of the bark in several cultivars (1). During the 2012 growing season, 154 sweet cherry trees were tested for the presence of CNRMV by RT-PCR. Samples were randomly collected from 11 orchards located in Gyeonggi and Gyeongsang provinces in Korea. RNA was extracted from leaves using the NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands). The primer pair CGRMV1/2 (2) was used to amplify the coat protein region of CNRMV. Although none of the collected samples showed any notable symptoms, CNRMV PCR products of the expected size (949 bp) were obtained from three sweet cherry samples from one orchard in Gyeonggi province. The PCR products were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced. BLAST analyses of the three Korean sequences obtained (GenBank Accession Nos. AB822635, AB822636, and AB822637) showed 97% nucleotide sequence identity with a flowering cherry isolate from Japan (EU188439), and shared 98.8 to 99.6% nucleotide and 99.6 to 100% amino acid similarities to each other. The CNRMV positive samples were also tested for Apple chlorotic leaf spot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry rasp leaf virus (CRLV), Cherry leafroll virus (CLRV), Cherry virus A (CVA), Little cherry virus 1 (LChV-1), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV) by RT-PCR. One of the three CNRMV-positive samples was also infected with CVA. To confirm CNRMV infection by wood indexing, Prunus serrulata cv. Kwanzan plants were graft-inoculated with chip buds from the CNRMV-positive sweet cherry trees. At 3 to 4 weeks post-inoculation, the Kwanzan plants showed quick decline with leaves wilting and dying; CNRMV infection of the indicators was confirmed by RT-PCR. To our knowledge, this is the first report of CNRMV infection of sweet cherry trees in Korea. Screening for CNRMV in propagation nurseries should minimize spread of this virus within Korea. References: (1) R. Li and R. Mock. Arch. Virol. 153:973, 2008. (2) R. Li and R. Mock. J. Virol. Methods 129:162, 2005.

Download Full-text

First Report of Little cherry virus 1 Infecting Sweet Cherry in Ontario, Canada

Plant Disease ◽

10.1094/pdis-04-21-0798-pdn ◽

2021 ◽

Author(s):

Aaron Simkovich ◽

Susanne Kohalmi ◽

Aiming Wang

Keyword(s):

San Diego ◽

Sweet Cherry ◽

The United States ◽

Eastern Region ◽

Rt Pcr ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Blastn Search ◽

Cherry Trees

The Niagara fruit belt is one of the richest fruit-producing areas in Canada, contributing to 90% of Ontario's tender fruits such as peach, plum and sweet cherry. Little cherry virus 1 (LCV1) of the genus Velarivirus is a causal agent of little cherry disease which has devastated cherry crops in many regions (Eastwell and Bernardy 1998, Jelkmann and Eastwell, 2011). From 2013 to 2018, foliar symptoms indicative of viral infection such as leaf deformation, ringspot, mottling, vein clearing, and reddening were found on sweet cherry trees grown in the Niagara region. To determine if these trees were infected by a virus, small RNAs (sRNAs) were isolated from separately pooled asymptomatic and symptomatic leaves using the mirPremier microRNA isolation kit (Sigma Aldrich Canada, Oakville, ON). The sRNAs were used to create two libraries (four leaves per library) with the TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA). The sRNA libraries were separately sequenced with the MiSeq Desktop Sequencer (Illumina, San Diego, CA). In total, 5,380,196 reads were obtained and Trimmomatic (Bolger et al. 2014) was used to remove adaptors. The remaining 4,733,804 clean reads were assembled into contigs using Velvet 0.7.31 (Zerbino and Birney, 2008) and Oases 0.2.09 (Schulz et al. 2012) with minimum length of 75 nt (Supplementary Table 1). A BLASTn search (Altschul et al. 1997) of the contigs identified the presence of Cherry virus A (genus: Capillovirus), two members of the Ilarvirus genus (Prunus necrotic ringspot virus and Prune dwarf virus) in both libraries. LCV1 was only found in contigs derived from the symptomatic library. Of the clean reads, 22,016 were assembled into six contigs (with lengths ranging from 86 to 116 nt, Supplementary Table 1) mapping to LCV1, covering 7.07% of the viral genome. To confirm LCV1 infection, primers were designed from the assembled contigs and used for reverse transcription polymerase chain reaction (RT-PCR). Amplicons were sequenced and the terminal sequences were determined using 5’ and 3’ RACE Systems (Invitrogen, Burlington, ON). Degenerate primers were designed from multiple sequence alignments of published LCV1 genomes for amplification and primer walking to obtain the sequence of LCV1 (Table S2). The complete genome sequence of LCV1 has a length of 16,934 nt and was deposited in GenBank (accession no. MN508820). A BLASTn search showed that this isolate is nearly identical (99.6% sequence identity) to an isolate from California (accession no. MN131067). To determine the incidence of infection, a field survey was performed at the same location during spring months of 2014 to 2018 using RT-PCR with primers specific to the viral coat protein gene (Supplementary Tale 2). Among 46 cherry trees sampled, two (4.3%) trees were infected with LCV1 and showed negative results with CVA, PNRSV and PDV. Both trees displayed mild suturing of primary and secondary veins (Supplementary Figure 1). LCV1 has been identified in Western stone fruit producing regions (British Columbia in Canada, and Washington, California, and Oregon in the United States of America). To the best of our knowledge, this is the first report of LCV1 in any eastern region of Canada. The low incidence of LCV1 suggests that this virus is not widespread in this region. Routine monitoring and detection of LCV1 is required to prevent this devastating cherry disease from spreading in this region.

Download Full-text

First Report of Transmission of Little cherry virus 2 to Sweet Cherry by Pseudococcus maritimus (Ehrhorn) (Hemiptera: Pseudococcidae)

Plant Disease ◽

10.1094/pdis-12-12-1115-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 851-851 ◽

Cited By ~ 15

Author(s):

T. A. Mekuria ◽

T. J. Smith ◽

E. Beers ◽

G. W. Watson ◽

K. C. Eastwell

Keyword(s):

Sweet Cherry ◽

Prunus Avium ◽

Washington State ◽

Replicase Gene ◽

Insect Vector ◽

Significant Finding ◽

Rt Pcr ◽

First Report ◽

Plant Pathol ◽

Pseudococcus Maritimus

Little cherry virus 2 (LChV2; genus Ampelovirus, family Closteroviridae) is associated with Little Cherry Disease (LCD), one of the most economically destructive diseases of sweet cherry (Prunus avium (L.)) in North America (1). Since 2010, incidence of LCD associated with LChV2 confirmed by reverse transcription (RT)-PCR assays has increased in orchards of Washington State. LChV2 was known to be transmitted by the apple mealybug (Phenacoccus aceris (Signoret)) (3). However, the introduction of Allotropus utilis, a parasitoid platygastrid wasp (2) for biological control, contributed to keeping insect populations below the economic threshhold. In recent years, the population of grape mealybug (Pseudococcus maritimus (Ehrhorn)) increased in cherry orchards of Washington State (Beers, personal observation). Since grape mealybug is reported to transmit Grapevine leafroll associated virus 3 (Ampelovirus) in grapevine (4), this study investigated whether this insect would also transmit LChV2. A colony of grape mealybugs on Myrobalan plum (Prunus cerasifera Ehrh.) trees was identified visually and morphologically from slide mounts. In a growth chamber, first and second instar crawlers were fed on fresh cut shoots of sweet cherry infected with a North American strain (LC5) of LChV2. After an acquisition period of 7 days, 50 crawlers were transferred to each young potted sweet cherry trees, cv. Bing, confirmed free from LChV2 by RT-PCR. This process was repeated in two trials to yield a total of 21 potted trees exposed to grape mealybug. One additional tree was left uninfested as a negative control. After 1 week, the trees were treated with pesticide to eliminate the mealybugs. Two to four months after the inoculation period, leaves were collected from each of the recipient trees and tested by RT-PCR for the presence of LChV2. To reduce the possibility of virus contamination from residual mealybug debris on leaf surfaces, the trees were allowed to defoliate naturally. After a 3-month dormant period, the new foliage that emerged was then tested. Two sets of primers: LC26L (GCAGTACGTTCGATAAGAG) and LC26R (AACCACTTGATAGTGTCCT) (1); and LC2.13007F (GTTCGAAAGTGTTTCTTGA) and LC2.14545R (CATTATYTTACTAATGGTATGAC) (this study) were used to amplify a partial segment of the replicase gene (409 bp) and the complete (1,080 bp) coat protein gene of LChV2, respectively. Of 21 trees tested, 18 yielded positive results for LChV2. The reaction products from six randomly selected trees were cloned and the virus identity was verified by sequencing. The sequences of RT-PCR amplicons from both primer pairs showed ≥99% identity to LChV2, strain LC5 (GenBank Accession No. AF416335). The result confirmed that P. maritimus transmits LChV2, a significant finding for this cherry production region. Grape mealybug is of increasing concern in the tree fruit industry because it is difficult to control in established orchards. The presence of infested orchards that serve as reservoirs of both LCD and this insect vector present a challenge for management. To the best of our knowledge this is the first report to show transmission of LChV2 by grape mealybug. References: (1) K. C. Eastwell and M. G. Bernardy. Phytopathology 91:268, 2001. (2) C. F. W. Muesbeck. Can Entomol. 71:158, 1939. (3) J. R. D. Raine et al. Can. J. Plant Pathol. 8:6, 1986. (4) R. Sforza et al. Eur. J. Plant Pathol. 109:975, 2003.

Download Full-text

First Report of Little cherry virus 2 from Sweet Cherry in Poland

Plant Disease ◽

10.1094/pdis-92-9-1366a ◽

2008 ◽

Vol 92 (9) ◽

pp. 1366-1366 ◽

Cited By ~ 3

Author(s):

B. Komorowska ◽

M. Cieślińska

Keyword(s):

Coat Protein ◽

Sweet Cherry ◽

Prunus Avium ◽

Late Summer ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

Nontranslated Region ◽

Methyltransferase Gene ◽

Cherry Trees

Little cherry disease (LChD) is a serious viral disease of sweet (Prunus avium) and sour (P. cerasus) cherry trees. Infection of sensitive cultivars results in small, angular, and pointed fruits with reduced sweetness. In late summer, leaves show a characteristic red coloration or bronzing of the surfaces. One Ampelovirus species, Little cherry virus 2 (LChV-2) (2), and one unassigned species in the Closteroviridae, Little cherry virus 1 (LChV-1) (3), have been associated with LChD. Twenty-seven sour and sweet cherry trees of six varieties from orchards located in several regions of Poland were tested for LChV-1 and LChV-2. Leaf samples were taken either from trees showing fruit symptoms or from asymptomatic trees during the summer of the 2006 growing season. RNA was isolated from the leaves with an RNeasy Kit (Qiagen, Hilden, CA), and reverse transcription (RT)-PCR was performed using primer pairs LCV1U/LCV1L and LCV2UP2/LCV2LO2, which are specific for a 419-bp fragment of the LChV-1 3′ nontranslated region and a 438-bp fragment of the LChV-2 methyltransferase gene, respectively (1). The primer pair L2CPF (5′-GTTCGAAAGTGTTTCTTGAT-3′) and L2CPR (5′-GCAACAGAAAAACATATGACTCA-3′) was designed from existing LChV-2 sequences (GenBank Accession Nos. AF416335 and NC_005065) to amplify the entire LChV-2 coat protein (CP) gene (nucleotides 13,007 to 14,134). The amplified cDNA fragments of LChV-2 genome were ligated to the bacterial vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA), which was used to transform Escherichia coli TOP10 competent cells following the manufacturer's protocol. Both strands of three clones for each amplified LChV-2 genome fragment were sequenced with an automated nucleotide sequencer at the Institute of Biochemistry and Biophysics in Warsaw. RT-PCR results showed that 6 of 27 trees were infected, with LChV-1 detected in five sweet cherry trees and LChV-2 singly infecting one sweet cherry tree cv Elton (isolate C4/14). The nucleotide sequence of the 438-bp methyltransferase gene fragment of isolate C4/14 showed 86, 85, and 84% identity to GenBank Accession Nos. AF333237, AF531505, and AJ430056, respectively, all previously reported LChV-2 sequences from cherry trees. Sequence analysis of the 1,088-bp coat protein gene showed 89 to 91% and 92 to 93% nucleotide and amino acid identity, respectively, with the aforementioned three LChV-2 isolates. The tree infected with LChV-2 was indexed by graft transmission to the woody indicator, Prunus avium cv. Canindex, which showed reddening of the leaves characteristic of LChD 3 months after inoculation. Since cherry production in Poland is 230,000 t per year, the disease may have a significant economic impact because the affected fruits are unsuitable either for consumption or sale. To our knowledge, this is the first report of LChV-2 in Poland. References: (1) M. E. Rott and W. Jelkmann. Phytopathology 91:261, 2001. (2) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005. (3) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

Download Full-text

First Report of Cherry green ring mottle virus in Plum (Prunus domestica) in North America

Plant Disease ◽

10.1094/pdis-93-10-1073a ◽

2009 ◽

Vol 93 (10) ◽

pp. 1073-1073 ◽

Cited By ~ 2

Author(s):

L. P. Wang ◽

N. Hong ◽

G. P. Wang ◽

R. Michelutti ◽

B. L. Zhang

Keyword(s):

North America ◽

Sweet Cherry ◽

Sour Cherry ◽

Mottle Virus ◽

Rt Pcr ◽

Prunus Species ◽

Indicator Plants ◽

First Report ◽

Green Ring ◽

Field Samples

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, is reported to infect several Prunus species including sour cherry (Prunus cerasus L.), sweet cherry (P. avium L.), flowering cherry (P. serrulata L.), peach (P. persica B.), and apricot (P. armeniaca L.). The virus has been detected in most regions of North America, Europe, New Zealand, Africa, and Japan where Prunus species are grown for production (3). In sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Other Prunus species are usually symptomless hosts of CGRMV. There is no report on the infection of CGRMV in plum so far. A survey was conducted to evaluate the sanitary status of stone fruit tree collections in the Canadian Clonal Genebank (CCG) at the Greenhouse and Processing Crops Research Center (GPCRC) in Harrow, Ontario (Canada). In October 2006, samples from 110 cultivar clones including 28 sweet cherry, 36 sour cherry, 12 hybrids, and 34 plum accessions, were bud grafted onto indicator seedlings of P. serrulata ‘Kwanzan’ for virus indexing in a greenhouse with a controlled environment. In April 2007, symptoms of epinasty and/or rusty necrotic fragments of midrib, which is indicative of Kwanzan infection by CGRMV (4), were observed on indicator plants inoculated with samples from eight clones (one sweet cherry, one cherry plum (P. besseyi × P. hortulana) and six plum). Indicator plants inoculated with samples from 19 other clones (three sweet cherry, nine sour cherry, one cherry plum and six plum) showed symptoms including small leaves and leaves that were twisted, deformed, bubbled, and/or had shot holes. Total RNA was extracted from leaves of all these symptomatic indicator plants by the cetyltrimethylammoniumbromide (CTAB) method (2). One-step reverse transcription (RT)-PCR was carried out using the primer set CGRMV1 (CCTCATTCACATAGCTTAGGTTT, 7,297 to 7,313 bp) and CGRMV2 (ACTTTAGCTTCGCCCCGTG, 8,245 to 8,227 bp) (1) for the detection of CGRMV. Amplicons of the expected size of 948 bp were consistently produced from eight samples showing symptoms of CGRMV infection, no amplicons were produced from the other 19 samples. Those results were further confirmed by RT-PCR detection for the original field samples. The fragment from plum cv. Vanier was cloned into pGEM-T Easy and sequenced in both directions of three clones. The resulting nucleotide sequence (GenBank Accession No. FJ402843) had the highest identity (97%) with that of a CGRMV isolate Star from sweet cherry (GenBank Accession No. AY841279) and had lower identity (81%) with that of a CGRMV isolate from apricot (GenBank Accession No. AY172334.1). To our knowledge, this is the first report of CGRMV infecting plum in North America. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. Plant Dis. 88:12, 2004. (3) K. G. Parker et al. USDA Agric. Handb. No. 437:193, 1976. (4) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Download Full-text

First Report of Cherry green ring mottle virus on Sweet Cherry in Poland

Plant Disease ◽

10.1094/pd-89-1363a ◽

2005 ◽

Vol 89 (12) ◽

pp. 1363-1363 ◽

Cited By ~ 3

Author(s):

B. Komorowska ◽

M. Cieślińska

Keyword(s):

Nucleotide Sequence ◽

Sweet Cherry ◽

Pcr Amplification ◽

Sour Cherry ◽

Mottle Virus ◽

Rt Pcr ◽

Green Ring ◽

Bacterial Vector ◽

Primer Sets ◽

Cherry Trees

Cherry green ring mottle virus (CGRMV), a member of the genus Foveavirus, infects several Prunus species including sweet cherry, sour cherry, ornamental cherry, peach, and apricot throughout North America and Europe. On sour cherry, the virus causes leaf yellowing and dark mottle around secondary veins. Sweet cherry trees are symptomless hosts of CGRMV. During the 2004 growing season, 27 sour and sweet cherry trees were tested for the presence of CGRMV. RNA was isolated from leaves using an RNeasy kit (Qiagen GmbH, Hilden, Germany) and then evaluated by reverse transcription-polymerase chain reaction (RT-PCR) amplification. Two primer sets, GRMV7956/GRMV8316 (1) and NCP5/NCP3 (2), were used for amplification of the CGRMV coat protein gene (807 bp) or its fragment (366 bp), respectively. The cDNA fragments were cloned into bacterial vector pCR 2.1-TOPO, sequenced and analyzed using the Lasergene (DNASTAR, Madison, WI) computer program. Nucleotide sequence of the C328 isolate (GenBank Accession No. AY841279) was compared with corresponding regions of published sequences of CGRMV isolates. The nucleotide sequence of this isolate was 98% identical to the Leb isolate (GenBank Accession No. AF533157) from sour cherry. The lowest similarity (80%) was between the CP sequences of isolate C328 and an isolate from apricot (GenBank Accession No. AY172334.1). Results of biological indexing on Prunus serrulata ‘Shirofugen’ and ‘Kwanzan’ confirmed the infection of ‘Star’ sweet cherry with CGRMV. The indicators showed leaf epinasty and necrosis of fragments of midrib or veins characteristic for CGRMV (2). The CGRMV infection of the indicators was confirmed using RT-PCR. References: (1) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411, 2001. (2) Y. Zhang et al. J. Gen. Virol. 79:2275, 1998.

Download Full-text

First Report of Cherry necrotic rusty mottle virus on Stone Fruit Trees in China

Plant Disease ◽

10.1094/pdis-09-12-0836-pdn ◽

2013 ◽

Vol 97 (2) ◽

pp. 290-290 ◽

Cited By ~ 6

Author(s):

J. F. Zhou ◽

G. P. Wang ◽

L. N. Qu ◽

C. L. Deng ◽

Y. Wang ◽

...

Keyword(s):

Sweet Cherry ◽

Prunus Persica ◽

Sour Cherry ◽

Fruit Trees ◽

Stone Fruit ◽

Mottle Virus ◽

Rt Pcr ◽

Cherry Tree ◽

First Report ◽

Pcr Products

During the growing seasons of 2010 through 2012, leaf tissues from 206 stone fruit trees, including one flowering cherry, three sour cherry, six nectarine (Prunus persica L. var. nucipersica Schneider), 14 apricot, 24 plum (P. domestica L.), 41 sweet cherry, and 117 peach [P. persica (L.) Batsch] trees, grown in six provinces of China, were randomly collected and tested for the CNRMV infection by RT-PCR. Out of those sampled trees, 37 showed shot holes and vein yellowing symptoms. Total RNA was extracted from leaves using the CTAB protocol reported by Li et al. (2). The primer pair CGRMV1/CGRMV2 (1) was used to amplify a fragment of 949 bp from CNRMV genome, which includes the CP gene (804 bp). PCR products with the expected size were detected in one sweet cherry, one apricot, one peach, one plum, and two sour cherry plants. However, no correlation between PCR data and symptom expression could be found. PCR products were cloned into the vector pMD18-T (TaKaRa, Dalian, China). Three independent clones from each isolate were sequenced by Genscript Corp., Nanjing, China, and sequences were deposited in the GenBank under accession nos. JX491635, JX491636, JX491637, JX648205, and JX648206. Results of sequence analysis showed that sequences of the five CNRMV isolates shared the highest nt (99.0 to 99.6%) and aa (98.9 to 100%) similarities with a cherry isolate from Germany (GenBank Accession No. AF237816). The sequence of one isolate from a peach tree (JX648205) was divergent and shared only 84.7 to 86.1% nt and 94.4 to 95.1% aa similarities with those cp sequences. Clones intra each isolate shared more than 99% nt similarities. To confirm CNRMV infection, seedlings of peach GF 305 were graft-inoculated with bud-woods from a peach and a sweet cherry tree, which was positive to CNRMV and also two other viruses: Cherry green ring mottle virus (CGRMV) and Plum bark necrosis stem pitting-associated virus (PBNSPaV), as tested by RT-PCR. Grafted seedlings were kept in an insectproof greenhouse and observed for symptom development. In May of the following year, some newly developed leaves of inoculated seedlings showed vein yellowing, ringspot, and shot hole symptoms. Results of Protein A sandwich (PAS)-ELISA using an antiserum raised against the recombinant CP of a CNRMV isolate (unpublished) and RT-PCR confirmed CNRMV infection in inoculated trees. In addition to CNRMV, tested seedlings were also found to be infected with CGRMV and PBNSPaV by RT-PCR. To our knowledge, this is the first report on the occurrence of CNRMV on stone fruit trees in China, and also the first record of the CNRMV infection in peach and plum plants. Given the economic importance of its hosts and the visible symptoms of the viral disease, it is important to prevent the virus spread by using virus-tested propagation materials. References: (1) R. Li and R. Mock. J. Virol. Methods 129:162, 2005. (2) R. Li et al. J. Virol. Methods 154:48, 2008.

Download Full-text

First Report of Carnation vein mottle virus Infecting Dianthus amurensis in China

Plant Disease ◽

10.1094/pdis-05-14-0453-pdn ◽

2014 ◽

Vol 98 (12) ◽

pp. 1747-1747 ◽

Cited By ~ 1

Author(s):

M. R. Li ◽

J. Zhu ◽

J. Gao ◽

R. H. Li ◽

F. Li

Keyword(s):

Chinese Herb ◽

Leaf Size ◽

Mottle Virus ◽

Universal Primers ◽

Rt Pcr ◽

Chinese Medicinal Herb ◽

First Report ◽

Potyvirus Species ◽

The Family ◽

Leaf Distortion

Dianthus amurensis, commonly known as Amur Pink, is a species of the genus Dianthus in the family Caryophyllaceae. This perennial Dianthus is also a Chinese medicinal herb. In August 2012, mosaic, leaf cupping, leaf distortion, reduction in leaf size, and flower-breaking symptoms were observed on some D. amurensis plants in a Chinese herb nursery in Changchun, Jilin Province, China. Disease incidences ranged from 40 to 50% in different plots. Symptoms on diseased D. amurensis were similar to those on the diseased D. caryophyllus, D. barbatus, and D. japonicus. The symptoms resembled to those caused by Carnation vein mottle virus (CVMoV), a member of genus Potyvirus in the family Potyviridae (3). CVMoV infects carnations (D. caryophyllus) worldwide and causes a serious disease. To investigate the presence of CVMoV, leaf samples were collected from three symptomatic plants and tested by dot-ELISA using universal potyvirus group monoclonal antibody (Agdia, Inc., Elkhart, IN). The antibody reacted with the diseased samples, supporting the presence of a potyvirus. To identify the potyvirus species, total nucleic acids were extracted from the diseased samples by a CTAB method (2) and used as template in RT-PCR with potyvirus universal primers Sprimer and M4T (1). An amplicon of the expected size (~1.7 kb) was obtained from all three diseased samples. The amplicons were cloned into pMD18-T vector (TaKaRa, Dalian, China) and sequenced. Sequences obtained from all three samples were identical and deposited in GenBank (Accession No. KJ605654). BLAST search showed that the nucleotide sequence shared 97 and 98% identity with a Japanese CVMoV isolate infecting D. japonicus (AB017630) (3) and a Korean CVMoV isolate (AY512554), respectively. The results confirmed the association of CVMoV with the disease on D. amurensis. To determine the pathogenicity of CVMoV to D. amurensis plants, purified CVMoV from the diseased plants were used to inoculate to healthy Dianthus spp. plants. Inoculated Dianthus spp. plants also showed the symptoms of mottle, leaf cupping, and leaf distortion, and CVMoV could be detected by RT-PCR from these plants. The result confirms that CVMoV is the causal agent of the disease. To our knowledge, this is the first report of CVMoV infection in D. amurensis. Since D. amurensis is economically important in China, proper virus management strategies for the cultivation of this crop should be adopted. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) R. Li et al. J. Virol. Methods 154:48, 2008. (3) T. Sasaya et al. J. Gen. Plant Pathol. 66:251, 2000.

Download Full-text

Duplex-RT-PCR assay for the simultaneous detection and discrimination of Brome mosaic virus and Cocksfoot mottle virus in cereal plants

Molecular Biology Reports ◽

10.1007/s11033-021-06485-9 ◽

2021 ◽

Author(s):

Katarzyna Trzmiel

Keyword(s):

Mosaic Virus ◽

Simultaneous Detection ◽

Brome Mosaic Virus ◽

Mottle Virus ◽

Grass Species ◽

Replicase Gene ◽

Rt Pcr ◽

Pcr Products ◽

Cereal Plants ◽

Cocksfoot Mottle Virus

AbstractBrome mosaic virus (BMV) and cocksfoot mottle virus (CfMV) are pathogens of grass species including all economically important cereals. Both viruses have been identified in Poland therefore they create a potential risk to cereal crops. In this study, a duplex—reverse transcription—polymerase chain reaction (duplex-RT-PCR) was developed and optimized for simultaneous detection and differentiation of BMV and CfMV as well as for confirmation of their co-infection. Selected primers CfMVdiag-F/CfMVdiag-R and BMV2-F/BMV2-R amplified 390 bp and 798 bp RT-PCR products within coat protein (CP) region of CfMV and replicase gene of BMV, respectively. Duplex-RT-PCR was successfully applied for the detection of CfMV-P1 and different Polish BMV isolates. Moreover, one sample was found to be co-infected with BMV-ML1 and CfMV-ML1 isolates. The specificity of generated RT-PCR products was verified by sequencing. Duplex-RT-PCR, like conventional RT-PCR, was able to detect two viruses occurring in plant tissues in very low concentration (as low as 4.5 pg/µL of total RNA). In contrast to existing methods, newly developed technique offers a significant time and cost-saving advantage. In conclusion, duplex-RT-PCR is a useful tool which can be implemented by phytosanitary services to rapid detection and differentiation of BMV and CfMV.

Download Full-text