First Report of the Occurrence of Wheat dwarf virus in Wheat in China

In May of 2004 and 2005, several diseased wheat (Triticum aestivum L.) plants showing extreme dwarfing, various types of yellowing, and reduced or no heading were found in the breeding fields of the Institute of Crop Science, Shanxi Academy of Agricultural Sciences, Taiyuan, Shanxi Province, China. On the basis of these symptoms, infection with Wheat dwarf virus (WDV) was suspected. Total DNA was extracted from diseased plants with the DNeasy Plant Mini kit (Qiagen, Hilden, Germany). Primers were designed based on the WDV-Enkoping1 genome sequence (NC_003326) (1), including: 245f, 5′-CGACTACGCCTGGCGAACATTTG-3′ (residues 245–267); 806r, 5′-TCTGGCATTGCCTGTTTCGG-3′ (complementary to residues 787–806); 1381f, 5′-CAGTGACATCTTCGCCGGAG-3′ (residues 1381–1400); and, 1886r, 5′-ACTCCGTAAGCCTCGAATCC-3′ (complementary to residues 1867–1886). With primer pairs 245f/806r, 1381f/1886r, 245f/1886r, and 1381f/806r, PCR products of 560, 506, 1642, and 2,275 bp were expected, respectively. After amplification, fragments of the expected sizes were seen on 1% (w/v) agarose gels. The fragments were purified by using a DNA gel extraction kit (TaKaRa, Dalian, China) and cloned into the pGEM-T vector (Promega, Madison, WI). The plasmids were transformed into E. coli strain DH5α and plasmid DNA was isolated from overnight cultures by alkaline lysis. Insert sequences were determined using the dideoxynucleotide chain termination method with an automated sequencer (ABI BigDye 3.1, Applied Biosystems, Foster City, CA). At least three independently isolated clones were analyzed for each PCR product. The compiled 2,750 nt sequence (GenBank Accession No. DQ868525) was 98.1, 98.5, 97.8, and 97.9% identical to WDV-Enkoping1 (NC_003326), WDV-SE (X02869), WDV-B (AM040732), and WDV-F (AM040733), respectively. Therefore, the virus isolate (WDV-TY) was identified as WDV (genus Mastrevirus, family Geminividae). Wheat samples collected from different provinces from 2004-2006 were also infected with WDV as indicated by PCR using the same primer pairs. For Shijiazhuang (Hebei Province), Yangling (Shanaxi Province), Kunming (Yunnan Province), Yuncheng (Shanxi Province), Tianshui (Gansu Province), Gangu (Gansu Province), and Zhenzhou (Henan Province), 13 of 14, 6 of 6, 5 of 5, 4 of 4, 2 of 3, 1 of 2, and 1 of 1 samples were positive, respectively, indicating a broad distribution of WDV in China. To our knowledge, this is the first report of WDV in wheat in China. Reference: (1) A. Kvarnheden et al. Arch Virol. 147:205, 2002.

Download Full-text

First Report of the Occurrence of Wheat dwarf virus Infecting Wheat in Slovenia

Plant Disease ◽

10.1094/pdis-11-16-1642-pdn ◽

2017 ◽

Vol 101 (7) ◽

pp. 1336 ◽

Cited By ~ 2

Author(s):

M. Viršček Marn ◽

I. Mavrič Pleško

Keyword(s):

Dwarf Virus ◽

Wheat Dwarf Virus ◽

First Report

Download Full-text

First Report of Wheat dwarf virus in Winter Wheat in Finland

Plant Disease ◽

10.1094/pd-89-0912b ◽

2005 ◽

Vol 89 (8) ◽

pp. 912-912 ◽

Cited By ~ 11

Author(s):

A. Lemmetty ◽

E. Huusela-Veistola

Keyword(s):

Winter Wheat ◽

Triticum Aestivum L ◽

Dwarf Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Wheat Dwarf Virus ◽

Mean Values ◽

Extraction Buffer ◽

Yellow Traps ◽

Positive Threshold ◽

Das Elisa

During June and July of 2004, several diseased plants in winter wheat (Triticum aestivum L.) were reported by agricultural advisers in the southern and southwestern coastal area of Finland. The plants showed extreme dwarfing, various yellowing symptoms, and reduced or no heading. The damage varied considerably. Yield loss estimates in direct-drilled winter wheat fields were approximately 20 to 40% and in worst cases as much as 100%. A few leafhoppers (Psammotettix alienus Dahlb.) were collected from the field with sweep nets and yellow traps. Roots and symptomatic leaves of winter wheat and the leafhoppers were first tested using a commercial polyclonal antibody (DSMZ, Braunschweig, Germany) specific for Wheat dwarf virus (WDV). For the leaf and root samples, routine double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) procedures were used. Five leafhoppers per sample were homogenized with the extraction buffer provided. The homogenate was centrifuged and the extract was evaluated using DAS-ELISA (2). The highest absorbance values were obtained from leafhoppers suspected to be viruliferous. The mean values varied from 1.002 to 1.990 after incubation in the substrate for 2 h. The absorbance values of several leaf samples exceeded the virus-positive threshold but were lower than those of the viruliferous leafhoppers. The virus was not detected in roots. Low absorbance values of virus-positive plants were confirmed using polymerase chain reaction (PCR) with primers specific for WDV (1). Total DNA extracts (DNeasy Plant Mini Kit; Qiagen, Hilden, Germany) from symptomatic leaves were tested using puRe Taq Ready-To-Go PCR beads (Amersham Biosciences, Buckinghamshire, UK). The PCR amplicon was the expected size (1,201 bp). The high absorbance value of the leafhoppers showed that the leafhoppers were carriers of the virus. These results confirmed that the causal agent of dwarfing and yellowing symptoms in winter wheat was WDV (genus Mastrevirus, family Geminiviridae). References: (1) A. Kvarnheden et al. Arch Virol 147:205, 2002. (2) J. Vacke and R. Cibulka. Plant Prot. Sci. 35:41, 2000.

Download Full-text

First Report of Wheat dwarf virus and Its Vector (Psammotettix provincialis) Affecting Wheat and Barley Crops in Syria

Plant Disease ◽

10.1094/pdis-09-10-0628 ◽

2011 ◽

Vol 95 (1) ◽

pp. 76-76 ◽

Cited By ~ 11

Author(s):

A. M. Ekzayez ◽

S. G. Kumari ◽

I. Ismail

Keyword(s):

Dwarf Virus ◽

Economic Losses ◽

Grass Species ◽

Chinese Isolate ◽

Eastern Region ◽

Wheat Dwarf Virus ◽

Serological Tests ◽

First Report ◽

Sequence Identity ◽

Wide Range

A field survey covering the major cereal-production areas of Syria was conducted during May 2009. A total of 938 wheat and 971 barley samples with typical symptoms of viral infection were collected from 45 wheat and 58 barley fields. All collected samples were tested by the tissue-blot immunoassay (1) at the Virology Laboratory of ICARDA, Syria using six specific cereal virus antisera, including polyclonal antibody AS-0216 for Wheat dwarf virus (WDV) provided by the German Collection of Microorganisms and Cell Cultures (DSMZ). Serological tests showed that WDV was detected in 16 wheat (cv. Cham 8) and five barley (cv. Arabic abiad) samples collected from Al-Hasskah governorate (eastern region of Syria) and showing dwarfing, yellowing, and reduced heading. Samples that reacted with WDV antiserum were transmitted from infected plants to healthy plants of oat (Avena sativa L.), barley (Hordeum vulgare L.), wheat (Triticum aestivum L.), and some grass species using four different leafhopper species, collected from Syrian wheat and barley fields, in a persistent manner. Leafhopper transmission tests indicated that only Psammotettix provincialis Ribaut was able to transmit Syrian barley WDV isolates (SB 1248-09 and SB 1249-09) from infected barley plants to healthy barley (48 plants became infected of 50 plants inoculated) and oats (45 of 50) under greenhouse conditions. The identity of P. provincialis was confirmed by the British Museum. Total DNA was extracted from six WDV-positive samples (three wheat and three barley) and tested by PCR using WDV primer set (WDV-F: 5′-TTGAGCCAATCTTCGTC-3′; WDV-R: 5′-GGAAAGACTTCCTGGGC-3′) described by Oluwafemi (2). All six Syrian WDV-positive samples generated amplicons around the expected size (~253 bp). The amplicons from one isolate from wheat (SW 2131-09, GenBank Accession No. HQ113095) and one isolate from barley (SB 1248-09, GenBank Accession No. HQ113096) showed they had 86% sequence identity with each other, suggesting that both isolates can be considered to belong to the same species (3). Barley isolate SB 1248-09 had 99% sequence identity to an Iranian isolate of Barley dwarf virus (FJ620684.1) and 92% identity to most European barley-WDV isolates (e.g., Germany [AM942044.1] and Hungary [FM999832.1]), whereas, the wheat isolate (SW 2131-09) had 98 to 100% identity with most European wheat-WDV isolates (e.g., Czech Rep [FJ546191.1] and Germany [AM296023.1]) and a Chinese isolate (EF536868.1). WDV has been reported to infect cereals in few countries in West Asia and North Africa (Turkey, Tunisia, and Morocco) and causes economic losses on wheat in many countries in Europe (e.g., Sweden). WDV has been reported to be transmitted in a persistent manner only by leafhoppers (P. alienus Dahlbom) (4) to a wide range of cereal and wild grasses. Two strains of WDV are known, one that primarily infects wheat and another that infects barley. To our knowledge, this is the first record of WDV (both strains) infecting wheat and barley crops in Syria and the first report of P. provincialis as a WDV vector worldwide. References: (1) K. M. Makkouk and A. Comeau. Eur. J. Plant Pathol. 100:71, 1994. (2) S. Oluwafemi. Afr. J. Biotechnol. 5:590, 2006. (3) J. Stanley et al. Page 301 in: The International Committee on the Taxonomy of Viruses. 8th Report. Elsevier/Academic Press, London, 2005. (4) J. Vacke. Biol. Plant. 3:228, 1961.

Download Full-text

First Report of Raspberry bushy dwarf virus in Andean Blackberry (Rubus glaucus) in Central Ecuador

Plant Disease ◽

10.1094/pdis-12-12-1198-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1003-1003 ◽

Cited By ~ 1

Author(s):

D. F. Quito-Avila ◽

M. A. Ibarra ◽

R. A. Alvarez ◽

L. Espinoza ◽

M. F. Ratti ◽

...

Keyword(s):

United States ◽

Rna Viruses ◽

The United States ◽

Dwarf Virus ◽

First Report ◽

The Andes ◽

Raspberry Bushy Dwarf Virus ◽

Pcr Products ◽

Symptomatic Tissue ◽

Production Areas

During the past two decades, several viruses have been identified from Rubus spp. in wild and commercial plantings around the world (2). In Ecuador, approximately 14 tons of blackberries are produced each year from an estimated area of 5,500 ha. In 2012, a preliminary survey was conducted to determine the presence of RNA viruses in Rubus glaucus, the most prevalent blackberry in Ecuador. Fifteen plants showing leaf mottling and severe mosaic were leaf-sampled from each of five different fields in Azuay Province. A total of 12 pooled samples of 20 g were obtained from the collected symptomatic tissue and used for dsRNA extraction using a cellulose-based protocol for detection of RNA viruses in plants (3). Three dsRNA segments of approximately 5 kbp, 2 kbp, and 900 bp were observed from all 12 dsRNA preparations. The dsRNA was heat-denatured and used as template for the generation of cDNA library using the universal random primer 5′-GCCGGAGCTCTGCAGAATTCNNNNNN-3′, for reverse transcription (RT), and the anchor primer 5′-GCCGGAGCTCTGCAGAATTC-3′for PCR as described (1). The PCR products were cloned using a StrataClone Kit (Agilent, CA) and sequenced (Macrogen, Korea). Sequence analysis revealed the presence of Raspberry bushy dwarf virus (RBDV), a pollen-borne Idaeovirus naturally found in several Rubus spp. worldwide. Approximately 120 RBDV sequences obtained from the Ecuadorean isolate were assembled into two contigs belonging to RNA1 and RNA2. Both sequences were re-confirmed by RT-PCR using specific primers. Partial sequences were assigned GenBank Accessions KC315894, KC315893, and KC315892 for the replicase, MP and CP, respectively. Furthermore, BLAST searches showed that the nucleotide sequence corresponding to the replicase was 95% similar to an isolate from the resistance breaking R15 strain (S51557.1), whereas the MP and CP nucleotide sequences were up to 98% similar to a Slovenian isolate (EU796088.1). Primers designed to amplify a 427-bp portion of the CP were used to detect RBDV from four blackberry plantings in two distant production areas: Ambato in Tungurahua Province and Paute in Azuay Province. Leaf mottling and severe mosaic was observed in 90% of blackberry fields in those two locations. Leaf samples (n = 90) were randomly collected from both symptomatic and asymptomatic plants in each location. In Ambato, RBDV was detected in 50% and 40% of symptomatic and asymptomatic plants, respectively. In Paute, RBDV was present in 70% of symptomatic plants and 29% of asymptomatic plants. The presence of RBDV in asymptomatic plants suggests the virus might not be the sole causal agent of the disorder. Further studies are needed to determine the role of RBDV in the observed symptoms, since virus complexes responsible for increased severity of symptoms have been commonly reported in Rubus spp. (4). R. glaucus is native to the tropical highlands (from Ecuador to Mexico) and differs from blackberries commercially grown in the United States and Europe. Therefore, RBDV-induced symptoms reported in blackberry grown in the United States and Europe may not be extrapolated to the Andes berry. To the best of our knowledge, this is the first report of RBDV from blackberry in Ecuador. References: (1) P. Froussard. Nucleic Acids Res. 20:2900, 1992. (2) R. R. Martin et al. Plant Dis. 97:168, 2013. (3). T. J. Morris and J. A. Dodds. Phytopathology 69:854. 1979. (4) D. F. Quito-Avila et al. J. Virol. Methods 179:38, 2012.

Download Full-text

First Report of Cucumber mosaic virus in Agastache rugosa in China

Plant Disease ◽

10.1094/pdis-04-14-0392-pdn ◽

2014 ◽

Vol 98 (11) ◽

pp. 1589-1589

Author(s):

J. Du ◽

C. M. Zhang ◽

Y. B. Niu

Keyword(s):

Coat Protein ◽

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Consensus Sequence ◽

Tomato Mosaic Virus ◽

Shanxi Province ◽

Agastache Rugosa ◽

First Report ◽

Pcr Products ◽

Das Elisa

Agastache rugosa (family Lamiaceae) is one of the most common herbs of traditional Chinese medicine in China, and the species increasingly gains popularity on the international market. In June 2012, typical mosaic symptoms were observed on many A. rugosa plants in a field in Shanxi Province. The incidence of this disease reached more than 60% in a 2.6-ha field. Seven symptomatic plants were tested by DAS-ELISA using monoclonal antibodies specific for Tobacco mosaic virus (TMV), Cucumber mosaic virus (CMV), and Tomato mosaic virus (ToMV); all antisera used in DAS-ELISA were generated and validated in our laboratory. CMV was found in all seven samples tested, but not TMV and ToMV. Double-stranded RNAs (dsRNA) extracted from infected leaves were used as templates in the subsequent two-step RT-PCR reaction (1). In order to further confirm the presence of CMV, a pair of specific primers (forward: 5′-ACGTCGACCATGGACAAATC-3′, and reverse: 5′-TACCCGGGTCAGACTGGTAGCACC-3′) based on the coat protein gene sequence of CMV were used to amplify PCR products of the expected size (657 bp) from ELISA-positive samples (2). These PCR products were cloned into pUCm-T Vector (Sangon Biotech, Shanghai) and sequenced. Five independent clones have been sequenced to obtain the consensus sequence. This consensus sequence (GenBank Accession No. JQ403529) was compared with other CMV sequences available in GenBank using DNAMAN. The partial CMV coat protein sequence showed the highest 97.9% nucleotide identity with a subgroup IB CMV isolate from China (DQ459481). To our knowledge, this is the first report of the natural occurrence of CMV on A. rugosa. References: (1) M. Krajacić et al. J. Chromatogr. A. 1144:111, 2007. (2) F. Li et al. J. Zhejiang Univ. 26:261, 2000.

Download Full-text

First Report of Wheat dwarf virus in Winter Wheat in Estonia

Plant Disease ◽

10.1094/pdis-11-18-2059-pdn ◽

2019 ◽

Vol 103 (7) ◽

pp. 1797-1797

Author(s):

M. Sõmera ◽

E. Truve ◽

P. Sooväli

Keyword(s):

Winter Wheat ◽

Dwarf Virus ◽

Wheat Dwarf Virus ◽

First Report

Download Full-text

First Report of Fusarium pseudograminearum Causing Crown Rot of Wheat in Henan, China

Plant Disease ◽

10.1094/pdis-01-12-0007-pdn ◽

2012 ◽

Vol 96 (7) ◽

pp. 1065-1065 ◽

Cited By ~ 25

Author(s):

H. L. Li ◽

H. X. Yuan ◽

B. Fu ◽

X. P. Xing ◽

B. J. Sun ◽

...

Keyword(s):

Elongation Factor ◽

Pcr Primers ◽

Triticum Aestivum L ◽

Crown Rot ◽

Control Treatment ◽

Single Spore ◽

Climate Conditions ◽

First Report ◽

Fusarium Pseudograminearum ◽

Pcr Products

Fusarium pseudograminearum (O'Donnell & Aoki), a residue-borne pathogen, is responsible for crown rot of wheat (Triticum aestivum L.). Since its first detection in Queensland, Australia in 1951, it has been reported in many other countries, but not China (2). In May 2011, a crown rot disease was observed in wheat cv. Aikang 58 in a wheat-maize rotation, irrigable and loam field in Henan Province, China. Diseased wheat plants showed honey brown discoloration in the stem bases and whitehead in some plants, which are symptoms of crown rot with about 70% incidence in a surveyed field (2). The pathogen was isolated from diseased stem base on potato dextrose agar (PDA) after being surface-disinfested with 5% NaClO solution for 2 min. Pure cultures were established on carnation leaf agar (CLA) through a single spore technique and identified by morphological and molecular methods according to protocols described previously (1,3,4). Macroconidia of F. pseudograminearum were formed in abundant sporodochia on CLA cultures grown under the BLB light. Macroconidia were usually five septate (about three to seven) and 27 to 91 × 2.7 to 5.5 μm. Colonies grown on PDA from a single conidium in the dark at 25°C had average radial growth rates of ~4.7 to 9.9 mm per day. Colony pigment on PDA grown under light varied from rose to burgundy, while mycelium ranged from rose to yellow white. Two isolates (WZ-8A and WZ-2B) were selected for molecular identification. The translation elongation factor 1-α gene and rDNA ITS gene were amplified by PCR using the specific primers described previously (4). PCR products were sequenced (GenBank Accession Nos. JN862232 to JN862235). Phylogenic analysis of the sequence indicated that the isolates were identified as F. pseudograminearum. The identification was further confirmed by the F. pseudograminearum species-specific PCR primers (Fp1-1: CGGGGTAGTTTCACATTTCCG and Fp1-2: GAGAATGTGATGACGACAATA) (1). The expected PCR products of 520 bp were produced only in F. pseudograminearum. Isolates WZ-2B and WZ-8A were deposited in the Agriculture Culture Collection of China as ACCC38067 and ACCC 38068, respectively. Pathogenicity tests were conducted by inoculating winter wheat cultivar Wenmai 19 with isolates WZ-8A and WZ-2B through soil inoculation. Inoculum was prepared by growing cultures on sterilized wheat bran and chopped wheat-straw (4:1, v/v) after incubation at 25°C for 2 weeks. This inoculum was added to sterilized soil at 1% by volume and no inoculum was added in control treatment. Five seeds were planted in a 15 cm wide pot in a 20 to 25°C greenhouse, with six replications. Seedling death and crown browning occurred in the inoculated wheat plants after 4 weeks with over 90% incidence, while no symptoms developed in the control plants. The fungus was reisolated from inoculated plants, fulfilling Koch's postulates. To our knowledge, this is the first report of F. pseudograminearum causing crown rot of wheat in China. Considering Henan is the largest wheat production province in China with over 5 million hectares planting area, and the soil and climate conditions are suitable for this disease, it will be a important pathogen of wheat in Henan in the future. References: (1) T. Aoki et al. Mycologia 91:597, 1999. (2) L. W. Burgess. Page 271 in: Crown Rot of Wheat: Fusarium. B. A. Summerell et al., eds. APS Press, St. Paul, MN, 2001. (3) R. G. Francis et al. Trans. Brit. Mycol. Soc. 68:421, 1977. (4) J. B. Scott et al. Mycol. Res. 110:1413, 2006.

Download Full-text

Expression of engineered wheat dwarf virus in seed-derived embryos

Physiologia Plantarum ◽

10.1034/j.1399-3054.1990.790122.x ◽

1990 ◽

Vol 79 (1) ◽

pp. 158-162

Author(s):

R. Topfer ◽

B. Gronenborn ◽

S. Schaefer ◽

J. Schell ◽

H.-H. Steinbiss

Keyword(s):

Dwarf Virus ◽

Wheat Dwarf Virus

Download Full-text

First report of Eimeria and Entamoeba infection in alpacas (Vicugna pacos) in Shanxi Province, northern China

Parasitology Research ◽

10.1007/s00436-021-07157-0 ◽

2021 ◽

Author(s):

Wen-Wei Gao ◽

Ye-Ting Ma ◽

Yuan-Yuan Ma ◽

Run-Li Li ◽

Jin Li ◽

...

Keyword(s):

Northern China ◽

Shanxi Province ◽

First Report ◽

Vicugna Pacos

Download Full-text

First Report of a Group 16SrII Phytoplasma Infecting Chickpea in Oman

Plant Disease ◽

10.1094/pd-90-0973c ◽

2006 ◽

Vol 90 (7) ◽

pp. 973-973 ◽

Cited By ~ 8

Author(s):

N. A. Al-Saady ◽

A. M. Al-Subhi ◽

A. Al-Nabhani ◽

A. J. Khan

Keyword(s):

Nested Pcr ◽

Animal Feed ◽

Restriction Enzymes ◽

Universal Primers ◽

Polymorphism Analysis ◽

Disease Symptoms ◽

First Report ◽

Pcr Products ◽

Polymerase Chain ◽

Group 2

Chickpea (Cicer arietinum), locally known as “Dungo”, is grown for legume and animal feed mainly in the interior region of Oman. During February 2006, survey samples of chickpea leaves from plants showing yellows disease symptoms that included phyllody and little leaf were collected from the Nizwa Region (175 km south of Muscat). Total nucleic acid was extracted from asymptomatic and symptomatic chickpea leaves using a cetyltrimethylammoniumbromide method with modifications (3). All leaf samples from eight symptomatic plants consistently tested positive using a polymerase chain reaction assay (PCR) with phytoplasma universal primers (P1/P7) that amplify a 1.8-kb phytoplasma rDNA product and followed by nested PCR with R16F2n/R16R2 primers yielding a product of 1.2 kb (2). No PCR products were evident when DNA extracted from healthy plants was used as template. Restriction fragment length polymorphism analysis of nested PCR products by separate digestion with Tru9I, HaeIII, HpaII, AluI, TaqI, HhaI, and RsaI restriction enzymes revealed that a phytoplasma belonging to group 16SrII peanut witches'-broom group (2) was associated with chickpea phyllody and little leaf disease in Oman. Restriction profiles of chickpea phytoplasma were identical with those of alfalfa witches'-broom phytoplasma, a known subgroup 16SrII-B strain (3). To our knowledge, this is the first report of phytoplasma infecting chickpea crops in Oman. References: (1) A. J. Khan et al. Phytopathology, 92:1038, 2002. (2). I.-M. Lee et al. Int. J. Syst. Bacteriol. 48:1153, 1998 (3) M. A. Saghai-Maroof et al. Proc. Natl. Acad. Sci. USA. 81:8014, 1984.

Download Full-text