First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Web Blight on Winter Savory (Satureja Montana “Repandens”) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-12-11-1075-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 585-585 ◽

Cited By ~ 1

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

M. T. Amatulli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Late Summer ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Pathogenicity Test ◽

First Report ◽

Hyphal Diameter ◽

Wheat Kernels ◽

Satureja Montana

Satureja montana L. (winter savory “Repandens”) is an evergreen shrub. In late summer 2010, blight was observed on a farm near Albenga (northern Italy) on 3% of 500 potted 2-month-old plants. Semicircular, water-soaked lesions appeared first on stems then on leaves. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage within 5 to 6 days. Stem fragments taken from the margin of the diseased tissues of 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 100 μg/liter streptomycin sulfate. A fungus with morphological characters of Rhizoctonia solani was consistently isolated. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tested strain. Hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from winter savory were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were repeated once. Mycelium of 10-day-old isolates from winter savory appeared light brown, compact, and radiate. Numerous, dark brown sclerotia, 1 to 4 mm in diameter (average 1.7), developed within 20 days after transfer of mycelia to PDA in 90-mm-diameter petri dishes and incubated (11-h daylight, 13-h dark) at 21 to 24°C. Descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (3). The internal transcribed spacer (ITS) region of rDNA was amplified with primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 696 bp showed a 99% homology with the sequence of R. solani. The nucleotide sequence has been assigned GenBank No. JQ313811. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks (30 min at 121°C and 1 atm) for 15 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Five 90-day-old plants of S. montana were inoculated. Each plant grown in 2-liter pots in a steam disinfested peat/pumice/pine bark/clay mix (50:20:20:20:10) was inoculated with 10 g of infested wheat kernels placed at the base of the stem. Five plants inoculated with noninfested wheat kernels served as the control. Plants covered with plastic bags were arranged randomly in a growth chamber at 20 ± 1°C with 12-h light/dark for 5 days. Symptoms, similar to those observed in the farm, developed 4 days after inoculation. Ten colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice. Symptoms caused by R. solani have been recently observed on S. hortensis in Poland (4). This is, to our knowledge, the first report of blight of S. montana caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (3) R. T. Sherwood. Phytopathology 59:1924, 1969. (4) B. Zimowska. Herba Polonica 56:29, 2010.

Download Full-text

First Report of Web Blight on Rosemary (Rosmarinus officinalis) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-11-12-1012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Ground Cover ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Rosmarinus Officinalis ◽

Economic Losses ◽

Pathogenicity Test ◽

First Report ◽

Wheat Kernels

Rosmarinus officinalis L., family Labiatae, is an evergreen shrub used in gardens as an aromatic or ground cover plant. In the summer of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 20% of 150,000 70-day-old plants, grown in trays. Water soaked lesions appeared on leaves and stems. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. A light mycelium spread on the substrate. Disease progressed from infected plants to healthy ones and, eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered. Three isolates of R. solani obtained from affected plants were successfully paired with R. solani tester strains AG 1, 2, 3, 4, 6, 7, or 11 and examined microscopically. Three pairings were made for each recovered isolate. The isolates of R. solani from rosemary anastomosed only with tester strain AG 1 (ATCC 58946). Results were consistent with other reports on anastomosis reactions (2). Tests were repeated once. Mycelium of 10-day-old isolates from rosemary appeared light brown, compact, and radiate. Numerous dark brown sclerotia, 0.7 to 2.0 mm diameter (average 1.3), developed within 10 days at 20 to 26°C. The descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced (GenBank Accession No. KC005724). BLASTn analysis (1) of the 657-bp showed a 99% similarity with the sequence of R. solani GU596491. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks for 8 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Fifteen 90-day-old rosemary plants were grown in 15-liter pots in a steam disinfested peat:pomice:pine bark:clay mix (50:20:20:10) infested with 3 g/liter of infested wheat kernels, placed at the base of the stem. Fifteen plants inoculated with non-infested wheat kernels served as control treatments. Plants were covered with plastic bags and arranged in a growth chamber at 20 to 24°C with 12 h light/dark for 15 days. The first symptoms, similar to those observed in the farm, developed 10 days after inoculation. About 10 colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on R. officinalis in United States (3), India, and Brazil. This is, to our knowledge, the first report of blight of R. officinalis caused by R. solani in Italy. This disease could cause serious economic losses, because rosemary is one of the most cultivated aromatic plants in the Mediterranean region. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, 1996. (3) G. E. Holcomb. Plant Dis. 76:859, 1992. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Web Blight on Rose Campion (Lychnis coronaria) Caused by Rhizoctonia solani AG 1-IB in Italy

Plant Disease ◽

10.1094/pdis-09-14-0970-pdn ◽

2015 ◽

Vol 99 (1) ◽

pp. 162-162

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

G. Ortu ◽

M. L. Gullino

Keyword(s):

Relative Humidity ◽

Rhizoctonia Solani ◽

Its Region ◽

Common Species ◽

Morphological Characters ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter ◽

Web Blight ◽

The Impact

Lychnis coronaria (syn. Silene coronaria), rose campion, is a perennial in the Caryophyllaceae used in gardens. In the summer of 2014, a web blight was observed in a private garden located near Biella (northern Italy), approximately 45°39′N 8°00′E, on 40% of 100 5-month-old plants grown in sandy soil. In the days preceding the outbreak of the disease, daytime temperatures ranged from 18 to 24°C and relative humidity from 45 to 83%. Affected plants showed pale brown discoloration of stems, starting from the base, and eventually collapsed. Under conditions of high relative humidity, a scant amount of whitish mycelium developed on leaves of about 50% of diseased plants. Eventually, infected plants died about 10 days after symptoms appeared. Symptomatic tissues of stems and leaves were disinfected for 10 s in 1% NaOCl, rinsed in sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani (3) was consistently recovered. Three representative isolates were paired with tester strains of R. solani (AG 1, AG 2-2-IIIB, AG 4, AG 7, and AG 11) (2) and examined microscopically. The Lychnis isolates anastomosed only with the AG 1 tester strain, with low fusion frequency. The anastomosis point was obvious: the hyphal diameter at the point of anastomosis was reduced and death of adjacent cells was observed, indicating an anastomosis reaction (1). Mycelium maintained on PDA at 23 ± 1°C was coarse and reddish brown. After 5 days of growth, mycelium started differentiating numerous sclerotia, often aggregated. Mature sclerotia were dark, spheroidal, with diameters ranging from 0.2 to 1.6 (average 0.6) mm. The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis of the 609-bp amplicon (GenBank Accession No. KM596899) showed a 98% homology with the sequence of the R. solani isolate FJ746937 obtained from Zoysiagrass. On the basis of molecular and cultural characteristics and anastomosis tests, the isolates from L. coronaria were identified as R. solani AG 1-IB (4). For pathogenicity tests performed in August, mycelial disks (8 mm diam.) from 10-day-old PDA cultures of an isolate of the fungus were placed on four healthy 6-month-old L. coronaria plants (four stem and six leaf disks per plant). Four plants inoculated with disks of PDA served as controls. Plants were covered with plastic bags for 4 days and maintained in a garden located in the same area in which the disease appeared, at field temperatures ranging from 15 to 28°C. The first symptoms developed 4 days after inoculation, and 15 days after the artificial inoculation, all inoculated plants were dead. R. solani was re-isolated from the stem of symptomatic plants, whereas no colonies developed from controls, which all remained healthy. This is the first report of blight of L. coronaria caused by R. solani in Italy or anywhere else in the world. The impact of this disease may become a significant problem for L. coronaria, a very common species in Italian gardens. References: (1) D. E. Carling. Page 37 in: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (2) A. Ogoshi. Ann. Rev. Phytopathol. 25:125, 1987. (3) B. Sneh et al. Identification of Rhizoctonia species. APS Press, St. Paul, MN, 1991. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Target Spot of Broadleaf Tobacco Caused by Rhizoctonia solani (AG-3) in Connecticut

Plant Disease ◽

10.1094/pdis-04-12-0335-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

Rhizoctonia Solani ◽

Sequence Data ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2011, 15 transplant beds of broadleaf cigar wrapper tobacco (Nicotiana tabacum L., cv. C9) plants in Hartford County, Connecticut, were observed with almost every plant diseased. Leaf lesion symptoms ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Disease was subsequently observed, also at nearly 100% incidence in a 10-hectare field on that farm and at additional broadleaf tobacco farms from two other towns in Hartford County and one town in Tolland County. Lesions exhibited a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A. B. Frank) was isolated from the margins of lesions that had been surface sterilized in 0.5% NaOCl for 30 s and then rinsed in sterile distilled water and placed on the surface of half-strength potato dextrose agar (PDA). Multiple isolations were made and the pathogen was identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm, and hyphal branches occurring at approximately right angles, constricted at the base (4). Eight-week-old potted tobacco plants were each inoculated by spraying with a mycelial suspension (1 × 105 CFU) of an isolate of R. solani recovered from tobacco onto leaves, or with water alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants placed in trays filled to a depth of 1 cm with water in the growth chamber. After 8 days, the pathogen was reisolated from all inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were asymptomatic. DNA was liberated from hyphae of the R. solani isolate by bead beating in STE buffer using 0.15 mm zirconium beads. Two microliters of the eluate was used to amplify the ITS region. Amplified DNA was purified in a Qiagen QIAquick PCR purification kit and submitted to the Yale science hill genomic facility for standard Sanger dideoxy sequencing. The sequence was exactly the same as an isolate from Massachusetts that we sequenced in 2010 (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease has been previously reported on tobacco from South America, South Africa, and the southern United States (1), Canada (3), and Massachusetts (2). Conditions were very conducive for disease because 2011 was a very wet year in Connecticut. To our knowledge, this is the first report of this disease in broadleaf cigar wrapper tobacco in Connecticut. The sequence data suggested that it may have been introduced to Connecticut from Massachusetts. We have found the target spot pathogen distributed across the tobacco producing area of Connecticut. This constitutes a serious threat as there are no systemic fungicides currently registered for control of this disease in broadleaf tobacco. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993. (2) J. A. LaMondia and C. R. Vossbrinck, Plant Dis. 95:496, 2010. (3) R. D. Reeleder et al., Plant Dis., 80:712. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Leaf Blight on Coral Bells (Heuchera sanguinea) Caused by Rhizoctonia solani AG 1A in Italy

Plant Disease ◽

10.1094/pdis-91-9-1206b ◽

2007 ◽

Vol 91 (9) ◽

pp. 1206-1206

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Aqueous Suspension ◽

Morphological Characters ◽

Leaf Blight ◽

Pathogenicity Test ◽

Uniform Size ◽

First Report ◽

Leaf Petiole ◽

Pathogenicity Tests ◽

Hyphal Diameter

Heuchera sanguinea (Saxifragaceae), coral bells or alum root, is an herbaceous perennial used in parks and gardens and sometimes grown in pots for its heart-shaped leaves and upright panicles of bright red, tiny flowers produced in late spring. At the end of fall 2006, a leaf blight was observed on 50% of a crop of potted 45-day-old plants grown in a sphagnum peat/clay/perlite (70:20:10) substrate at temperatures ranging between 20 and 25°C in a nursery. Semicircular, water-soaked lesions developed on leaves just above the soil line at the leaf-petiole junction and later along the leaf margins. For several days, lesions expanded along the midvein until the entire leaf was destroyed. Blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Mycelia were often seen on and suspended between leaves. Blight progressed up the plant from the leaves to the shoot tip. Affected plants often died leaving wide empty areas. Diseased tissue was disinfected for 1 min in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 100 μg/liter of streptomycin sulfate. A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered, then transferred and maintained in pure culture (3). The isolates of R. solani obtained from affected plants were successfully anastomosed with tester isolate AG 1 (ATCC 58946). The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and cell death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (1). Pairings were also made with tester isolates of AG 2, 3, 4, 5, 6, 7, and 11 with no anastomoses observed between the recovered and tester isolates. Sclerotia were of uniform size with a diameter from 0.4 to 4 mm and sometimes joined laterally. The description of sclerotia was typical for subgroup 1A Type 2 (2). For pathogenicity tests, the inoculum of R. solani was prepared by growing three isolates of the pathogen on PDA for 7 days. Plants of 30-day-old H. sanguinea were grown in 10-liter containers (6 plants per container) on a steam disinfested peat/clay/perlite substrate (70:20:10)). Inoculum consisted of an aqueous suspension of PDA and mycelium disks (1 cm2 of mycelium per plant) and was placed at the base of the plant stems and on leaves. Plants inoculated with water and PDA fragments alone served as control treatments. Three replicates were used. Plants were maintained in a growth chamber at 24°C with 12 h of light/dark. The first symptoms, similar to those observed in the nursery, developed 12 days after the artificial inoculation. R. solani was consistently reisolated from infected leaves and stems. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. This is, to our knowledge, the first report of leaf blight of H. sanguinea caused by R. solani in Italy and probably in the world. References: (1) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, the Netherlands, 1996. (2) R. T. Sherwood. Phytopathology, 59:1924, 1969. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St Paul, MN, 1991.

Download Full-text

First Report of Leaf Blight on Woodland Sage Caused by Rhizoctonia solani AG 1 in Italy

Plant Disease ◽

10.1094/pdis-94-8-1071c ◽

2010 ◽

Vol 94 (8) ◽

pp. 1071-1071 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Aqueous Suspension ◽

Its Region ◽

Morphological Characters ◽

Leaf Blight ◽

Pathogenicity Test ◽

First Report ◽

Leaf Petiole ◽

Perennial Plant ◽

Potted Plants

Woodland sage (Salvia nemorosa L.; Lamiaceae) is a hardy herbaceous perennial plant that is easy to grow and propagate and is used in parks and grown as potted plants. During the summer of 2009 in a nursery near Torino in northern Italy, a leaf blight was observed on 30-day-old plants of cv. Blau Koenigin grown in pots under shade. Semicircular, water-soaked lesions developed on leaves just above the soil line at the leaf-petiole junction and later along leaf margins. Lesions expanded along the midvein until the entire leaf was destroyed. Blighted leaves turned brown, withered, and clung to the shoots. No symptoms were observed on the roots. Severely infected plants died. Diseased tissue was disinfested for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 25 mg/liter of streptomycin sulfate. A fungus with morphological characters of Rhizoctonia solani (3) was consistently recovered. Ten-day-old mycelium grown on PDA at 22 ± 1°C appeared light brown, rather compact, and with radial growth. Sclerotia were irregular and measured between 0.5 and 2 mm. Pairings were made with tester isolates of AG 1, 2, 3, 4, 5, 6, 7, 11, and AG B1. The only successful anastomosis was with tester isolate AG 1 (ATCC 58946). The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and cell death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). The description of sclerotia of the isolate AG1 was typical for subgroup 1A Type 2 (3). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 688 bp showed a 100% homology with the sequence of R. solani AG-1A and the nucleotide sequence has been assigned (GenBank Accession No. HM044764). For pathogenicity tests, the inoculum of one isolate of R. solani from the nursery was prepared by growing the pathogen on PDA for 7 days. The foliage of 30-day-old potted plants of S. nemorosa cv. Blau Koenigin was artificially inoculated with an aqueous suspension of PDA and mycelium fragments (1 g per mycelium per plant) prepared from cultures with a blender. Plants were covered with plastic bags for 3 days. Plants inoculated with water and PDA fragments alone served as control treatments. Plants were maintained in a glasshouse at 20 to 25°C. The first symptoms, similar to those observed in the nursery, developed 7 days after foliar inoculation. R. solani was consistently reisolated from infected leaves. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. To our knowledge, this is the first report of leaf blight of S. nemorosa caused by R. solani in Italy as well as worldwide. The importance of the disease is still unknown. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Page 35 in: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, the Netherlands, 1996. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St Paul, MN, 1991.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani (AG-3) in Massachusetts

Plant Disease ◽

10.1094/pdis-10-10-0751 ◽

2011 ◽

Vol 95 (4) ◽

pp. 496-496 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

New England ◽

Rhizoctonia Solani ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2010, shade-grown cigar wrapper tobacco (Nicotiana tabacum L.) plants in Hampshire County, Massachusetts were observed with leaf lesion symptoms that ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Lesions had a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A.B. Frank) was isolated from lesions and identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm and hyphal branches occurring at approximately right angles, and constricted at the base (3). Eight-week-old, potted tobacco plants were each inoculated either by spraying with a mycelial suspension (1 × 105 CFU) (five plants) or by placing colonized half-strength potato dextrose agar (PDA) plugs (0.2 cm) of an isolate of R. solani recovered from tobacco onto leaves (five plants) or with water or half-strength PDA plugs alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants were placed in trays filled with water to a depth of 1 cm in the growth chamber. After 8 days, the pathogen was reisolated from inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were not diseased. DNA was extracted from the R. solani isolate and the nuclear ribosomal internal transcribed spacer (ITS) region was amplified and sequenced (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease had been previously reported on tobacco from South America, South Africa, the southern United States (1), and Canada (2). To our knowledge, this is the first report of this disease in cigar wrapper tobacco in New England. The humid environmental conditions under which shade tobacco is grown make this new disease a significant threat for the Massachusetts and Connecticut growing area. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993 (2) R. D. Reeleder et al. Plant Dis. 80:712, 1996. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Leaf Blight on Foxglove (Digitalis purpurea) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-93-3-0318c ◽

2009 ◽

Vol 93 (3) ◽

pp. 318-318

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Leaf Blight ◽

Pathogenicity Test ◽

Uniform Size ◽

First Report ◽

Digitalis Purpurea ◽

Blastn Analysis ◽

Hyphal Diameter

Digitalis purpurea (Scrophulariaceae), foxglove, is used in flower gardens. In the spring of 2008, leaf blight was observed in a nursery near Biella (northern Italy) on 30% of potted 30-day-old plants grown in a peat substrate at temperatures from 20 to 25°C and relative humidity at 75 to 80%. Semicircular, water-soaked lesions developed on leaves just above the soil line at the blade-petiole junction and later along the leaf margins. Lesions expanded for several days along the midvein until the entire leaf was affected. Blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Diseased tissue was disinfested for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 100 mg/liter of streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently and readily recovered, then transferred and maintained in pure culture (4). The isolates of R. solani obtained from affected plants successfully anastomosed with tester isolate AG 1 (ATCC 58946). The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and cell death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Pairings were also made with tester isolates AG 2, 3, 4, 6, 7, 11, and AG BI and anastomosis was not observed. Ten-day-old colonies grown on PDA appeared light brown, rather compact, and radial. Numerous sclerotia of uniform size (0.5 to 3 mm in diameter) and sometimes joined laterally were formed. Descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 724-bp fragment showed a 99% homology with the sequence of R. solani (GenBank Accession No. EU591800). The nucleotide sequence has been assigned GenBank Accession No. FJ467490. For pathogenicity tests, the inoculum of R. solani was prepared by growing the pathogen on PDA for 10 days. Plants of 30-day-old D. purpurea were grown in 10-liter containers (6 plants per container) in a steam disinfested peat/clay/perlite (70:20:10) substrate. Disks of PDA cultures were placed on leaves (1 cm2 of mycelium per plant). Plants inoculated with PDA alone served as control treatments. Three replicates were used. Plants were maintained in a growth chamber at 24 ± 1°C with 12 h light/dark. First symptoms developed 12 days after the artificial inoculation. R. solani was consistently reisolated from infected leaves and stems. Control plants remained healthy. The pathogenicity test was repeated twice. R. solani was isolated from a small percentage of infected seeds of D. purpurea in India (3). This is, to our knowledge, the first report of leaf blight of D. purpurea caused by R. solani in Italy as well as in Europe. The spread of R. solani in nurseries might cause a decrease in trade. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions in: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, the Netherlands, 1996. (3) K. K. Janardhanan and D. Ganguly. Indian Phytopathol. 16:379, 1963. (4) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St Paul, MN, 1991.

Download Full-text

First Report of Leaf Blight on Hosta fortunei Caused by Rhizoctonia solani AG 4 in Italy

Plant Disease ◽

10.1094/pdis-93-4-0432c ◽

2009 ◽

Vol 93 (4) ◽

pp. 432-432 ◽

Cited By ~ 3

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

United States ◽

Rhizoctonia Solani ◽

Aqueous Suspension ◽

Its Region ◽

The United States ◽

Morphological Characters ◽

Leaf Blight ◽

Pathogenicity Test ◽

First Report ◽

Leaf Petiole

Hosta fortunei (Liliaceae) is used in semishaded areas of gardens for its lavender-colored flowers produced in midsummer. In April of 2008, in a greenhouse at the University of Torino, located in Grugliasco (northern Italy), a leaf blight was observed on 15% of potted 60-day-old plants growing at temperatures ranging between 20 and 25°C and relative humidity of 60 to 90%. Semicircular, water-soaked lesions developed on leaves just above the soil line at the leaf-petiole junction and later along leaf margins. Lesions expanded for several days along the midvein until the entire leaf was destroyed. Blighted leaves turned brown, withered, and clung to the shoots. Severely infected plants died. Diseased tissue was disinfested for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 25 mg/liter streptomycin sulfate. A fungus with the morphological characters of Rhizoctonia solani (4) was consistently recovered, then transferred and maintained in pure culture. Ten-day-old mycelium grown on PDA at 22 ± 1°C appeared light brown, rather compact, and had radial growth. Sclerotia were not present. Isolates of R. solani obtained from affected plants were successfully anastomosed with tester isolate AG 4 (AG 4 RT 31 obtained from tobacco plants). Results were consistent with other reports on anastomosis reactions (2). Pairings were also made with tester isolates of AG 1, 2.1, 2.2, 3, 6, 7, 11, and BI, but no anastomosis was observed. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 646-bp fragment showed a 100% homology with the sequence of R. solani AG-4 AB000018. The nucleotide sequence has been assigned GenBank Accession No. FJ 534556. For pathogenicity tests, the inoculum of R. solani was prepared by growing the pathogen on PDA for 10 days. Six-month-old plants of H. fortunei were grown in 1-liter pots. Inoculum, which consisted of an aqueous suspension of PDA and mycelium disks (10 g of mycelium per pot), was placed at the collar of plants. Plants inoculated with water and PDA fragments alone served as control treatments. Five plants per treatment were used. Plants were maintained in a growth chamber at 20 ± 1°C. The first symptoms, similar to those observed in the nursery, developed 15 days after inoculation. R. solani was consistently reisolated from infected leaves and stems. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. R. solani was reported on plants belonging to the genus Hosta in the United States (3). This is, to our knowledge, the first report of leaf blight of H. fortunei caused by R. solani in Italy as well as in Europe. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (3) D. F. Farr et al. Fungi on Plants and Products in the United States. The American Phytopathology Society, St Paul, MN, 1989. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St Paul, MN, 1991.

Download Full-text