First Report of Target Spot of Tobacco Caused by Rhizoctonia solani (AG-3) in Massachusetts

In June 2010, shade-grown cigar wrapper tobacco (Nicotiana tabacum L.) plants in Hampshire County, Massachusetts were observed with leaf lesion symptoms that ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Lesions had a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A.B. Frank) was isolated from lesions and identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm and hyphal branches occurring at approximately right angles, and constricted at the base (3). Eight-week-old, potted tobacco plants were each inoculated either by spraying with a mycelial suspension (1 × 105 CFU) (five plants) or by placing colonized half-strength potato dextrose agar (PDA) plugs (0.2 cm) of an isolate of R. solani recovered from tobacco onto leaves (five plants) or with water or half-strength PDA plugs alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants were placed in trays filled with water to a depth of 1 cm in the growth chamber. After 8 days, the pathogen was reisolated from inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were not diseased. DNA was extracted from the R. solani isolate and the nuclear ribosomal internal transcribed spacer (ITS) region was amplified and sequenced (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease had been previously reported on tobacco from South America, South Africa, the southern United States (1), and Canada (2). To our knowledge, this is the first report of this disease in cigar wrapper tobacco in New England. The humid environmental conditions under which shade tobacco is grown make this new disease a significant threat for the Massachusetts and Connecticut growing area. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993 (2) R. D. Reeleder et al. Plant Dis. 80:712, 1996. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Target Spot of Broadleaf Tobacco Caused by Rhizoctonia solani (AG-3) in Connecticut

Plant Disease ◽

10.1094/pdis-04-12-0335-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1378-1378 ◽

Cited By ~ 1

Author(s):

J. A. LaMondia ◽

C. R. Vossbrinck

Keyword(s):

Rhizoctonia Solani ◽

Sequence Data ◽

Its Region ◽

Anastomosis Group ◽

Growth Chamber ◽

First Report ◽

Potted Plants ◽

Plastic Bags ◽

Target Spot ◽

Half Strength

In June 2011, 15 transplant beds of broadleaf cigar wrapper tobacco (Nicotiana tabacum L., cv. C9) plants in Hartford County, Connecticut, were observed with almost every plant diseased. Leaf lesion symptoms ranged from small (2 to 3 mm) water-soaked spots to larger (2 to 3 cm) lesions. Disease was subsequently observed, also at nearly 100% incidence in a 10-hectare field on that farm and at additional broadleaf tobacco farms from two other towns in Hartford County and one town in Tolland County. Lesions exhibited a pattern of concentric rings, necrotic centers and tears in the centers, and margins that often resulted in a shot-hole appearance. Some lesions had chlorotic halos. Rhizoctonia solani Kuhn (Thanatephorus cucumeris A. B. Frank) was isolated from the margins of lesions that had been surface sterilized in 0.5% NaOCl for 30 s and then rinsed in sterile distilled water and placed on the surface of half-strength potato dextrose agar (PDA). Multiple isolations were made and the pathogen was identified on the basis of mycelial characteristics including multinucleate cells, septate hyphae wider than 7 μm, and hyphal branches occurring at approximately right angles, constricted at the base (4). Eight-week-old potted tobacco plants were each inoculated by spraying with a mycelial suspension (1 × 105 CFU) of an isolate of R. solani recovered from tobacco onto leaves, or with water alone (five plants each). The plants were placed in plastic bags in a 24°C growth chamber and misted. After 2 days, the bags were removed and the potted plants placed in trays filled to a depth of 1 cm with water in the growth chamber. After 8 days, the pathogen was reisolated from all inoculated plants exhibiting water-soaked spots as disease symptoms. Leaves inoculated with water or half-strength PDA plugs alone were asymptomatic. DNA was liberated from hyphae of the R. solani isolate by bead beating in STE buffer using 0.15 mm zirconium beads. Two microliters of the eluate was used to amplify the ITS region. Amplified DNA was purified in a Qiagen QIAquick PCR purification kit and submitted to the Yale science hill genomic facility for standard Sanger dideoxy sequencing. The sequence was exactly the same as an isolate from Massachusetts that we sequenced in 2010 (GenBank Accession No. HQ241274). The ITS sequence confirmed our identification of this new isolate as R. solani anastomosis group (AG) 3. This disease has been previously reported on tobacco from South America, South Africa, and the southern United States (1), Canada (3), and Massachusetts (2). Conditions were very conducive for disease because 2011 was a very wet year in Connecticut. To our knowledge, this is the first report of this disease in broadleaf cigar wrapper tobacco in Connecticut. The sequence data suggested that it may have been introduced to Connecticut from Massachusetts. We have found the target spot pathogen distributed across the tobacco producing area of Connecticut. This constitutes a serious threat as there are no systemic fungicides currently registered for control of this disease in broadleaf tobacco. References: (1) J. S. Johnk et al. Phytopathology 83:854, 1993. (2) J. A. LaMondia and C. R. Vossbrinck, Plant Dis. 95:496, 2010. (3) R. D. Reeleder et al., Plant Dis., 80:712. (4) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991.

Download Full-text

First Report of Target Spot of Tobacco Caused by Rhizoctonia solani AG-2.1

Plant Disease ◽

10.1094/pdis-08-11-0696 ◽

2012 ◽

Vol 96 (3) ◽

pp. 456-456 ◽

Cited By ~ 2

Author(s):

G. Mercado Cárdenas ◽

M. Galván ◽

V. Barrera ◽

M. Carmona

Keyword(s):

Rhizoctonia Solani ◽

Morphological Characteristics ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Staining Procedure ◽

Nuclear Staining ◽

Tobacco Plants ◽

First Report ◽

Target Spot

In August 2010, lesions similar to those reported for target spot were observed on Nicotiana tabacum L. plants produced in float systems in Cerrillos, Salta, Argentina. Tobacco leaves with characteristic lesions were collected from different locations in Cerrillos, Salta. Symptoms ranged from small (2 to 3 mm), water-soaked spots to larger (2 to 3 cm), necrotic lesions that had a pattern of concentric rings, tears in the centers, and margins that often resulted in a shot-hole appearance. Isolation of the causal agent was made on potato dextrose agar (PDA) acidified to pH 5 with 10% lactic acid and incubated at 25 ± 2°C in darkness for 2 to 3 days. Hyphal tips were transferred to a new medium and the cultures were examined for morphological characters microscopically (3). Eight isolates were obtained. The rapid nuclear-staining procedure using acridine orange (3) was used to determine the number of nuclei in hyphal cells. Multinucleate hyphae were observed, with 4 to 9 nuclei per cell. Molecular characterization was conducted by examining the internal transcribed spacer (ITS) region from all of the isolates of the pathogen identified as Rhizoctonia solani based on morphological characteristics (1). Fragments amplified using primers ITS1 (5′TCCGTAGGTGAACCTGCGG3′) and ITS4 (5′TCCTCCGCTTATTGATATGC3′) (4) were sequenced and compared with R. solani anastomosis group (AG) sequences available in the NCBI GenBank database. Sequence comparison identified this new isolate as R. solani anastomosis group AG 2-1. Previous isolates of target spot were identified as AG 3 (2). The isolates that were studied were deposited in the “Laboratorio de Sanidad Vegetal” INTA-EEA-Salta Microbial Collection as Rs59c, Rs59b, Rs59, Rs66, Rs67, Rs68, Rs69, and Rs70. The ITS nucleotide sequence of isolate Rs59 has been assigned the GenBank Accession No. JF792354. Pathogenicity tests for each isolate were performed using tobacco plants grown for 8 weeks at 25 ± 2°C with a 12-h photoperiod. Ten plants were inoculated by depositing PDA plugs (0.2 cm) colonized with R. solani onto leaves; plants inoculated with the pure PDA plug without pathogen served as controls. The plants were placed in a 25 ± 2°C growth chamber and misted and covered with polyethylene bags that were removed after 2 days when plants were moved to a glasshouse. After 48 h, symptoms began as small (1 to 2 mm), circular, water-soaked spots, lesions enlarged rapidly, and often developed a pattern of concentric rings of 1 to 2 cm. After 8 days, all inoculated plants showed typical disease symptoms. Morphological characteristics of the pathogen reisolated from symptomatic plants were consistent with R. solani. Control plants remained healthy. These results correspond to the first reports of the disease in the country. Compared to other areas in the world, target spot symptoms were only observed in tobacco plants produced in float systems and were not observed in the field. The prevalence of the disease in Salta, Argentina was 7%. To our knowledge, this is the first report of R. solani AG2.1 causing target spot of tobacco. References: (1) M. Sharon et al. Mycoscience 49:93, 2008. (2) H. Shew and T. Melton. Plant Dis. 79:6, 1995. (3) B. Sneh et al. Identification of Rhizoctonia species. The American Phytopathological Society, St. Paul, MN, 1991. (4) T. J. White et al. Page 282 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, 1990.

Download Full-text

First Report of Web Blight on Oregano (Origanum vulgare L.) Caused by Rhizoctonia solani AG-1-IB in Italy

Plant Disease ◽

10.1094/pdis-02-13-0138-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1119-1119 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Morphological Identification ◽

Pathogenicity Test ◽

Origanum Vulgare ◽

First Report ◽

Plastic Bags ◽

Hyphal Diameter

Origanum vulgare L., common name oregano, family Labiatae, is grown for its aromatic and medicinal properties and as ornamental. In the fall of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 6% of 30,000 50-day-old plants, grown in trays in a peat/perlite mix. Semicircular, water soaked lesions appeared on leaves and stems, starting from the basal ones. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. Eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently recovered. Three isolates of R. solani obtained from affected plants were successfully anastomosed with R. solani isolate AG 1 (ATCC 58946). Three pairings were made for each tester strain. The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). Isolates from oregano were paired with R. solani isolates AG 2, 3, 4, 6, 7, or 11 and examined microscopically. Anastomosis was not observed in any of the pairings. Tests were conducted twice. Mycelium of 10-day-old isolates from oregano appeared reddish brown, coarse, and radiate. Numerous dark brown sclerotia, 0.3 to 1.0 mm diameter (average 0.7) developed within 10 days after transfer of mycelia to PDA in 90 mm diameter petri dishes at 21 to 24°C. The descriptions of mycelium and sclerotia were typical for subgroup IB Type 1 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced. BLASTn analysis (1) of the 538 bp showed a 99% homology with the sequence of R. solani FJ746937, confirming the morphological identification of the species. The nucleotide sequence has been assigned the GenBank Accession KC493638. For pathogenicity tests, one of the isolates assigned to the anastomosis group AG-1-IB was tested by placing 9 mm diameter mycelial disks removed from PDA 10-day-old cultures of the fungus on leaves of 90-day-old oregano plants (n = 35). Thirty-five plants inoculated with non-inoculated PDA disks served as controls. Plants were covered with plastic bags and maintained in a growth chamber at 25 ± 1°C with 12 h light/dark. The first symptoms, similar to those observed in the farm, developed 3 days after inoculation. Nine days after the artificial inoculation, 50% of plants were dead. About 10 colonies of R. solani were reisolated from infected leaves of inoculated plants. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on O. vulgare in Greece (3). This is, to our knowledge, the first report of blight of O. vulgare caused by R. solani in Italy. References: (1) S. F. Altschul et al. Nucleic Acids Res., 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, pp. 37-47, 1996. (3) C. D. Holevas et al. Benaki Phytopathol. Inst., Kiphissia, Athens, 19:1-96, 2000. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Web Blight on Rosemary (Rosmarinus officinalis) Caused by Rhizoctonia solani AG-1-IA in Italy

Plant Disease ◽

10.1094/pdis-11-12-1012-pdn ◽

2013 ◽

Vol 97 (6) ◽

pp. 844-844 ◽

Cited By ~ 4

Author(s):

A. Garibaldi ◽

D. Bertetti ◽

P. Pensa ◽

A. Poli ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Ground Cover ◽

Its Region ◽

Morphological Characters ◽

Anastomosis Group ◽

Rosmarinus Officinalis ◽

Economic Losses ◽

Pathogenicity Test ◽

First Report ◽

Wheat Kernels

Rosmarinus officinalis L., family Labiatae, is an evergreen shrub used in gardens as an aromatic or ground cover plant. In the summer of 2012, a blight was observed in a farm located near Albenga (northern Italy) on 20% of 150,000 70-day-old plants, grown in trays. Water soaked lesions appeared on leaves and stems. As the disease progressed, blighted leaves turned brown, withered, clung to the shoots, and matted on the surrounding foliage. A light mycelium spread on the substrate. Disease progressed from infected plants to healthy ones and, eventually, infected plants died. Leaf and stem fragments taken from the margin of the diseased tissues belonging to 10 plants were disinfected for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA). A fungus with the morphological characters of Rhizoctonia solani was consistently and readily recovered. Three isolates of R. solani obtained from affected plants were successfully paired with R. solani tester strains AG 1, 2, 3, 4, 6, 7, or 11 and examined microscopically. Three pairings were made for each recovered isolate. The isolates of R. solani from rosemary anastomosed only with tester strain AG 1 (ATCC 58946). Results were consistent with other reports on anastomosis reactions (2). Tests were repeated once. Mycelium of 10-day-old isolates from rosemary appeared light brown, compact, and radiate. Numerous dark brown sclerotia, 0.7 to 2.0 mm diameter (average 1.3), developed within 10 days at 20 to 26°C. The descriptions of mycelium and sclerotia were typical for subgroup IA Type 2 (4). The internal transcribed spacer (ITS) region of rDNA was amplified using the primers ITS1/ITS4 and sequenced (GenBank Accession No. KC005724). BLASTn analysis (1) of the 657-bp showed a 99% similarity with the sequence of R. solani GU596491. For pathogenicity tests, inoculum of R. solani was prepared by growing the pathogen on wheat kernels autoclaved in 1-liter glass flasks for 8 days. One of the isolates assigned to the anastomosis group AG 1 IA was tested. Fifteen 90-day-old rosemary plants were grown in 15-liter pots in a steam disinfested peat:pomice:pine bark:clay mix (50:20:20:10) infested with 3 g/liter of infested wheat kernels, placed at the base of the stem. Fifteen plants inoculated with non-infested wheat kernels served as control treatments. Plants were covered with plastic bags and arranged in a growth chamber at 20 to 24°C with 12 h light/dark for 15 days. The first symptoms, similar to those observed in the farm, developed 10 days after inoculation. About 10 colonies of R. solani were reisolated from infected leaves and stems of each inoculated plant. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. Symptoms caused by R. solani have been recently observed on R. officinalis in United States (3), India, and Brazil. This is, to our knowledge, the first report of blight of R. officinalis caused by R. solani in Italy. This disease could cause serious economic losses, because rosemary is one of the most cultivated aromatic plants in the Mediterranean region. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease control. Kluwer Academic Publishers, The Netherlands, 1996. (3) G. E. Holcomb. Plant Dis. 76:859, 1992. (4) R. T. Sherwood. Phytopathology 59:1924, 1969.

Download Full-text

First Report of Rhizoctonia solani AG-4 on Epipremnum aureum in Buenos Aires, Argentina

Plant Disease ◽

10.1094/pdis.2001.85.1.96c ◽

2001 ◽

Vol 85 (1) ◽

pp. 96-96 ◽

Cited By ~ 1

Author(s):

E. R. Wright ◽

P. E. Grijalba ◽

L. Gasoni

Keyword(s):

Rhizoctonia Solani ◽

Buenos Aires ◽

Its Region ◽

Anastomosis Group ◽

Causal Agent ◽

Basal Stem Rot ◽

First Report ◽

Brown Discoloration ◽

Epipremnum Aureum ◽

Petri Plate

Root and basal stem rot, blighting, and wilting have been observed on Epipremnum aureum (Linden ex André) plants in many nurseries in and near Buenos Aires since 1997. Infected stem tissues show an intense dark brown discoloration and water soaking near the stem base that eventually leads to plant death. To determine the causal agent of the disease, small pieces of diseased tissue were surface-sterilized for 2 min in 2% sodium hypochlorite and plated on potato-dextrose agar (PDA). Whitish colonies that eventually turned brown developed in 2 to 3 days at 22 to 24°C. Irregularly shaped sclerotia were observed. Isolates typical of Rhizoctonia solani Kuhn exhibited mycelia with branches inclined in the direction of growth, constricted at the point of union with the main hyphae, with a septum in the branch near the constriction. No telemorph was observed. Nuclei in living hyphal mats were stained directly on a microscope slide coated with water agar according to the method of Tu and Kimbrough (4) and were examined at 400× magnification. The cells were multinucleate. Anastomosis group was determined by using known tester isolates of Rhizoctonia spp. (3). Positive anastomosis was observed with tester strains of AG-4 HG-II. The polymerase chain reaction was performed according to the protocol of Boysen et al (1) in order to confirm the anastomosis group. Primers used for the amplification of the ITS region were ITSI and LROR. Amplification of the ITS region indicated lack of variation with AG-4 tester strain. The pathogenicity of the isolate was determined with the inoculum-layer technique (2), consisting of a 7-day-old petri plate culture of the pathogen in PDA that is removed from the dish and placed intact on the soil, 2 to 4 cm under the roots of 10 healthy plants. Some leaves of the plants were placed in contact with the inoculated substratum. For a control, PDA was placed under the roots of other plants. Plants were maintained at 22 to 24°C, with close-to-saturation humidity. After 6 to 10 days, symptoms were similar to those previously observed. Initially leaves that had been placed in contact with the substratum showed dark areas with a watersoaked area 2 to 3 cm in diameter. These lesions expanded over the entire leaf blade moving into the petioles and stems killing the plant. One hundred percent of inoculated plants were infected. Koch's postulates were satisfied after reisolating the fungus. The characteristics of the causal agent are those of multinucleate isolates of R. solani belonging to the anastomosis group AG-4 HG-II (3). This is the first report of R. solani causing disease on E. aureum in Argentina. References: (1) M. Boysen, M. Borja, C. Del Corral, O. Salazar, and V. Rubio. Curr. Genet. 29:174–181, 1996. (2) A. F. Schmitthenner and J. W. Hilty. Phytopathology 52:177–178, 1962. (3) B. Sneh, L. Burpee, and A. Ogoshi. 1991. Identification of Rhizoctonia Species. The American Phytopathological Society, St. Paul, MN. (4) C. C. Tu and J. W. Kimbrough. Mycologia 65:941–944, 1973.

Download Full-text

First Report of Rhizoctonia solani AG2-1 on roots of wheat in Kazakhstan

Plant Disease ◽

10.1094/pdis-04-21-0786-pdn ◽

2021 ◽

Author(s):

Göksel Özer ◽

İmren Mustafa ◽

Tugba Bozoglu ◽

Abdelfattah A. Dababat

Keyword(s):

Rhizoctonia Solani ◽

Its Region ◽

Triticum Aestivum L ◽

Anastomosis Group ◽

Universal Primers ◽

Sodium Hypochlorite Solution ◽

First Report ◽

Pure Cultures ◽

The Impact ◽

Wheat Kernels

In June 2019, approximately 20 tillers of wheat (Triticum aestivum L.) were sampled at the ripening stage (Feekes scale 11) from four different fields in Almaty, Kazakhstan. Brown lesions (3-5 mm in length) were present on the roots of sampled plants, with 20% incidence. To determine the causal agent, diseased roots were surface disinfected in sodium hypochlorite solution (1%) for 3 min, rinsed triple with sterile distilled water, air-dried in a laminar flow hood, and plated onto one-fifth strength potato dextrose agar (PDA) supplemented with 50 ppm chloramphenicol. After three days, the hyphal fragments that developed from the sections were transferred to fresh PDA and incubated at 23°C with 12-h photoperiod for 7 days to obtain pure cultures. Brown pigmented fungal colonies with a constriction at the base of hyphal branches, septa near the branching point, and right-angled branching resembling Rhizoctonia solani were observed. The identification anastomosis group (AG) of a representative isolate for each field was conducted by sequencing the internal transcribed spacer (ITS) region of rDNA with the universal primers ITS4 and ITS5 (White et al. 1990). The resulting sequences of 693 bp length were deposited in GenBank (accession nos. MW898143:MW898146). These sequences were 100% identical to the isolate 8Rs of R. solani AG2-1 (accession no. AF354063). To confirm the pathogenicity of the four isolates, the colonized wheat kernels method described by Demirci (1998) was used to inoculate a sterile potting mix containing peat, vermiculite, and soil (1:1:1 by v/v/v) into which wheat (cv. Seri) was planted. Control pots were inoculated with sterile wheat kernels using the same procedure. Wheat plants were left to grow for four weeks under controlled environmental conditions with a 23°C temperature regime. During the period that the plants remained in the glasshouse, the typical light regime was 16 h. Brown lesions were observed on the roots of plants in the inoculated pots whereas no symptoms were observed on plants grown in the control pots. R. solani was consistently reisolated from symptomatic plants, thereby confirming Koch’s postulates. To our knowledge, this is the first report of R. solani AG2-1 on roots of wheat in Kazakhstan. R. solani AG2-1 isolates have been previously reported to be a weak pathogen to wheat (Roberts and Sivasithamparam 1986; Sturrock et al. 2015; Jaaffar et al. 2016; Özer et al. 2019). We suggest further studies are required to characterize the impact of R. solani AG2-1 in wheat. Considering crop rotation, the selection of non-host crops to this AG group is important to pathogen management, by reducing the amount of inoculum in the soil.

Download Full-text

First Report of Gray Mold of Rhizoma paridis Caused by Botrytis cinerea in China

Plant Disease ◽

10.1094/pdis-03-14-0336-pdn ◽

2014 ◽

Vol 98 (10) ◽

pp. 1434-1434 ◽

Cited By ~ 2

Author(s):

J. M. You ◽

Q. H. Wang ◽

X. M. Lin ◽

J. Guo ◽

L. Q. Ai ◽

...

Keyword(s):

Botrytis Cinerea ◽

Leading Edge ◽

Its Region ◽

Gray Mold ◽

Pathogenicity Test ◽

Heat Shock Protein 60 ◽

Chinese Medicinal Herb ◽

First Report ◽

Potted Plants ◽

Plastic Bags

Rhizoma paridis is a perennial, traditional Chinese medicinal herb. In May 2013, a disease was observed in an approximately 10 ha cultivated field in Enshi, Hubei Province, China. Approximately 80% of plants in the field were affected. Symptoms were visible on the basal leaves of affected plants. Chlorosis followed by necrosis started at the leaf tips and margins and gradually spread inward until the entire leaf was necrotic. Thick, gray mycelium and conidia were visible on both sides surface of leaves under wet, humid conditions. The leading edge of the chlorotic leaves was excised from 20 plant samples surface disinfested with 1% NaOCl solution for 1 min, rinsed in sterile water, air dried, and placed on potato dextrose agar (PDA). Plates were incubated at 22°C in the dark. Mycelia were initially hyaline and white, and became dark gray after 72 h. Mycelia were septate with dark branched conidiophores. Conidia were smooth, hyaline, ovoid, aseptate, and ranged from 8 to 14.5 × 7 to 8.5 μm. Numerous hard, small, irregular, and black sclerotia that were 1 to 3 × 2 to 5 mm were visible on PDA plates after 12 days. The fungus was identified as Botrytis cinerea on the basis of these characters (1). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1 and ITS4 primer and sequenced (GenBank Accession No. KF265499). BLAST analysis of the PCR product showed 99% identity to Botryotinia fuckeliana (perfect stage of B. cinerea) (EF207415.1, EF207414.1). The pathogen was further identified to the species level as B. cinerea using gene sequences from glyceraldehyde-3-phosphate dehydrogenase (G3PDH), heat-shock protein 60 (HSP60), and DNA-dependent RNA polymerase subunit II (RPB2) (2) (KJ638600, KJ638602, and KJ638601). Pathogenicity was tested by spraying the foliage of 40 two-year-old plants with a suspension of 106 conidia per ml of sterile distilled water. Each plant received 30 ml of the inoculum. Ten healthy potted plants were inoculated with sterilized water as control. All plants were covered with plastic bags for 5 days after inoculation to maintain high relative humidity and were placed in a growth chamber at 22°C. The first foliar lesions developed on leaves 7 days after inoculation and were similar to those observed in the field. No symptoms developed on the control plants. B. cinerea was consistently re-isolated from all artificially inoculated plants. The pathogenicity test was completed twice. To our knowledge, this is the first report of gray mold of R. paridis caused by B. cinerea in China. The root of R. paridis is the most commonly used Chinese herbal medicine to treat viper bites. In recent years, cultivation of this herb has increased in China because of its high value. Consequently, the economic importance of this disease is likely to increase with the greater prevalence of this host species. References: (1) H. L. Barnett and B. B. Hunter. Illustrated Genera of Imperfect Fungi. Burgess Publishing Company, Minneapolis, MN, 1972. (2) M. Staats et al. Mol. Biol. Evol. 22:333, 2005.

Download Full-text

First Report of Leaf Blight on Woodland Sage Caused by Rhizoctonia solani AG 1 in Italy

Plant Disease ◽

10.1094/pdis-94-8-1071c ◽

2010 ◽

Vol 94 (8) ◽

pp. 1071-1071 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

Rhizoctonia Solani ◽

Aqueous Suspension ◽

Its Region ◽

Morphological Characters ◽

Leaf Blight ◽

Pathogenicity Test ◽

First Report ◽

Leaf Petiole ◽

Perennial Plant ◽

Potted Plants

Woodland sage (Salvia nemorosa L.; Lamiaceae) is a hardy herbaceous perennial plant that is easy to grow and propagate and is used in parks and grown as potted plants. During the summer of 2009 in a nursery near Torino in northern Italy, a leaf blight was observed on 30-day-old plants of cv. Blau Koenigin grown in pots under shade. Semicircular, water-soaked lesions developed on leaves just above the soil line at the leaf-petiole junction and later along leaf margins. Lesions expanded along the midvein until the entire leaf was destroyed. Blighted leaves turned brown, withered, and clung to the shoots. No symptoms were observed on the roots. Severely infected plants died. Diseased tissue was disinfested for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 25 mg/liter of streptomycin sulfate. A fungus with morphological characters of Rhizoctonia solani (3) was consistently recovered. Ten-day-old mycelium grown on PDA at 22 ± 1°C appeared light brown, rather compact, and with radial growth. Sclerotia were irregular and measured between 0.5 and 2 mm. Pairings were made with tester isolates of AG 1, 2, 3, 4, 5, 6, 7, 11, and AG B1. The only successful anastomosis was with tester isolate AG 1 (ATCC 58946). The hyphal diameter at the point of anastomosis was reduced, the anastomosis point was obvious, and cell death of adjacent cells was observed. Results were consistent with other reports on anastomosis reactions (2). The description of sclerotia of the isolate AG1 was typical for subgroup 1A Type 2 (3). The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 688 bp showed a 100% homology with the sequence of R. solani AG-1A and the nucleotide sequence has been assigned (GenBank Accession No. HM044764). For pathogenicity tests, the inoculum of one isolate of R. solani from the nursery was prepared by growing the pathogen on PDA for 7 days. The foliage of 30-day-old potted plants of S. nemorosa cv. Blau Koenigin was artificially inoculated with an aqueous suspension of PDA and mycelium fragments (1 g per mycelium per plant) prepared from cultures with a blender. Plants were covered with plastic bags for 3 days. Plants inoculated with water and PDA fragments alone served as control treatments. Plants were maintained in a glasshouse at 20 to 25°C. The first symptoms, similar to those observed in the nursery, developed 7 days after foliar inoculation. R. solani was consistently reisolated from infected leaves. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. To our knowledge, this is the first report of leaf blight of S. nemorosa caused by R. solani in Italy as well as worldwide. The importance of the disease is still unknown. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Page 35 in: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, the Netherlands, 1996. (3) B. Sneh et al. Identification of Rhizoctonia Species. The American Phytopathological Society, St Paul, MN, 1991.

Download Full-text

First report of Rhizoctonia solani Kühn AG 2-2 LP in Zoyzia japonica Steud in Brazil

Summa Phytopathologica ◽

10.1590/0100-5405/221916 ◽

2020 ◽

Vol 46 (4) ◽

pp. 289-298

Author(s):

Maria Aurea Saboya Chiaradia Picarelli ◽

Flavia Rodrigues Alves Patricio ◽

Ricardo Harakava ◽

Eliana Borges Rivas ◽

Addolorata Colariccio

Keyword(s):

Rhizoctonia Solani ◽

Mycelial Growth ◽

Its Region ◽

Anastomosis Group ◽

Large Patch ◽

First Report ◽

Rdna Its ◽

Rdna Its Region ◽

Important Disease

ABSTRACT The use of cultivated grasses in Brazil has grown by 40% between 2010 and 2015, and the species Zoysia japonica Steud, especially the cultivar ‘Esmeralda’, corresponds to 81% of the grass market in the country. The most important disease affecting zoysia grass, known as large patch, is caused by Rhizoctonia solani and occurs in the Brazilian lawns particularly during winter months. The aim of this study was to contribute to the identification and characterization of the anastomosis group of R. solani isolates from lesions typical of large patch collected from ‘Esmeralda’ grass at gardens and golf courses in the states of São Paulo and Bahia, Brazil. All 12 obtained isolates presented dark-brown colonies with aerial mycelial growth, multinucleated hyphae and absence of concentric zonation or sclerotia, and showed their greatest mycelial growth rate at 25°C. In pathogenicity experiments, except three out of R. solani isolates, reduced the growth of zoysia grass. Based on the analysis of sequences of the rDNA-ITS region, the isolates clustered with reference isolates of the anastomosis group AG 2-2 LP. Phylogenetic inference showed that the Brazilian isolates are grouped into two clades that shared the same common ancestral with 96% bootstrap. One of the clades includes only Brazilian isolates while the other one also includes American and Japanese R. solani isolates AG 2-2 LP. This is the first report and characterization of R. solani AG 2-2 LP in zoysiagrass in Brazil.

Download Full-text

First Report of Rhizoctonia solani AG-1-IB Causing Leaf Blight of Sorrel (Rumex acetosa) in Brazil

Plant Disease ◽

10.1094/pdis-04-13-0443-pdn ◽

2014 ◽

Vol 98 (2) ◽

pp. 278-278

Author(s):

B. E. C. Miranda ◽

A. M. S. Cardoso ◽

R. W. Barreto

Keyword(s):

New York ◽

Rhizoctonia Solani ◽

Its Region ◽

The United States ◽

Anastomosis Group ◽

Culture Collection ◽

Representative Specimen ◽

Broad Host Range ◽

Rumex Acetosa ◽

First Report

Rumex acetosa L., common name sorrel (in Brazil, azedinha), is an herb from Europe and Asia commonly used either as a vegetable or a medicinal plant (1). No pathogen has been recorded on this plant species in Brazil, where it has been promoted as an alternative vegetable crop. During a routine inspection of a vegetable garden in the campus of the Universidade Federal de Viçosa (Viçosa, state of Minas Gerais, Brazil) in July 2011, a group of sorrel plants were found bearing blight symptoms. Infected leaves had laminae with soaked irregular necrotic areas and infected petioles had reddish lesions. Healthy leaves touched by neighboring blighted leaves became diseased. A mycelial web was always associated with necrotic tissues. A representative specimen was collected, dried in a plant press, and deposited in the local herbarium (VIC 39063). Pure cultures were obtained through direct transfer of mycelium to PDA plates and deposited in the culture collection at the Universidade Federal de Viçosa – Coleção Oswaldo Almeida Drummond (COAD 1265). Slides containing fungal structures were mounted in lactophenol and observed under a microscope (Olympus BX 51). The fungus had the following morphology: mycelium superficial, either filiform or monilioid and constricted at septae, 6 to 10 μm diameter, often branching at right angles or nearly so, typically bearing a septum at branches near the branching point. Additionally, large, poorly differentiated, dirty white sclerotia were formed in older cultures. When mounted in DAPI, 7-day-old mycelium was seen to bear 5 to 13 nuclei per cell. These characteristics suggested that the fungus was Rhizoctonia solani Kuhn (RS). Anastomosis group (AG) was determined by sequencing the rDNA internal transcribed spacer (ITS) region using primers ITS5 and ITS4 (4). A BLAST search revealed that the sequence (GenBank Accession No. KC887353) had 96% sequence identity with RS AG-1-IB GenBank accessions JN426850.1, GU596491.1, JQ692292.1, and JQ692291.1. Pathogenicity of the isolate obtained from sorrel was tested by inoculating four healthy individuals with culture plugs taken from the margin of actively growing cultures on V8 juice agar. Inoculated plants were placed in a dew chamber for 48 h and later transferred to the bench of a greenhouse. Necrosis appeared on all inoculated plants 2 days after inoculation, developing into severe blight after 7 days. RS was isolated from infected tissues. RS AG-1-IB is known as a broad host-range plant pathogen (3). This is its first report as a pathogen of sorrel in Brazil. The sole other published record of this disease on sorrel is from the United States (2). References: (1) N. R. Madeira et al. Hortic. Brasil. 26:428, 2008. (2) G. L. Peltier. Parasitic rhizoctonias in America. University of Illinois Agricultural Experiment Station, 1915. (3) B. Sneh, L. Burpee, and A. Ogoshi. Identification of Rhizoctonia species. APS Press, St Paul, MN, 1991. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. M. A. Innis et al., eds. Academic Press, Inc., New York, 1990.

Download Full-text