Ty-2 and Ty-3a Conferred Resistance are Insufficient Against Tomato Yellow Leaf Curl Kanchanaburi Virus from Southeast Asia in Single or Mixed Infections of Tomato

Plant Disease ◽  
2020 ◽  
Vol 104 (12) ◽  
pp. 3221-3229 ◽  
Author(s):  
Sota Koeda ◽  
Ikuya Fujiwara ◽  
Yuki Oka ◽  
Elly Kesumawati ◽  
Sabaruddin Zakaria ◽  
...  
Keyword(s):  
Southeast Asia ◽  
Resistance Genes ◽  
Eastern Mediterranean ◽  
Tomato Yellow Leaf ◽  
Bipartite Begomoviruses ◽  
Mixed Infections ◽  
Yellow Leaf ◽  
Heterozygous State ◽  
Viral Dnas ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a monopartite begomovirus that originated in the eastern Mediterranean, has spread worldwide, becoming a serious threat to tomato (Solanum lycopersicum L.) production. Southeast Asia is considered one of the hotspots for begomovirus diversity, and a wide variety of local begomovirus species distinct from TYLCV have been identified. In this study, the protection effect of introgressions of single TYLCV Ty resistance genes, Ty-2 and Ty-3a, in tomato was examined against inoculations of the bipartite begomoviruses Tomato yellow leaf curl Kanchanaburi virus (TYLCKaV) and Pepper yellow leaf curl Indonesia virus (PepYLCIV) isolated from Indonesia. Our findings suggest that Ty-2 in the heterozygous state was found to be ineffective against PepYLCIV and TYLCKaV, whereas Ty-3a in the heterozygous state was effective against PepYLCIV and partially effective against TYLCKaV. Quantification of viral DNAs showed correlation between symptom expression and viral DNA accumulation. Moreover, mixed infections of TYLCKaV and PepYLCIV caused notably severe symptoms in tomato plants harboring Ty-3a. In cases of mixed infection, quantifying viral DNAs showed a relatively high accumulation of PepYLCIV, indicating that Ty-3a loses its effectiveness against PepYLCIV when TYLCKaV is also present. This study demonstrates the lack of effectiveness of Ty resistance genes against single and mixed infections of distinct local begomoviruses from Southeast Asia.

Study of a collection of tomato hybrids with genetic resistance to the yellow leaf curl virus in Southern Russia

2020 ◽  
pp. 30-34
Author(s):  
С.Ф. Гавриш ◽  
Т.А. Редичкина ◽  
А.В. Буц ◽  
Г.М. Артемьева
Keyword(s):  
Resistance Genes ◽  
Molecular Genetic Analysis ◽  
Tomato Yellow Leaf ◽  
Tomato Mosaic Virus ◽  
Average Weight ◽  
Yellow Leaf ◽  
The South ◽  
Economically Valuable Traits ◽  
Leaf Curl Virus ◽  
Leaf Curl

Дана информация об изучении коллекции гибридов F1томата (Solanum lycopersicum L.) зарубежной селекции различных фирм-оригинаторов, рекомендованных производителями семян как толерантные к вирусу желтой курчавости листьев томата. Все гибриды обладали комплексом хозяйственно ценных признаков и набором генов устойчивости к основным заболеваниям томата, в том числе к новому для юга России опасному патогену с максимальным потенциальным риском – вирусу желтой курчавости листьев томата (Tomato yellow leaf curl virus — TYLCV). Исследования проведены в 2017-2018 годах в лаборатории пасленовых культур ООО «НИИСОК» и в лаборатории молекулярной диагностики растений ООО «Семеновод». Всего было протестировано 34 гибрида F1 томата. Гибриды оценивали по совокупности хозяйственно ценных признаков, также проводили молекулярно-генетический анализ на наличие и аллельное состояние основных генов устойчивости: к вирусу табачной мозаики (Tm2а), фузариозному увяданию (I2), вертициллезному увяданию (Ve), к кладоспориозу (Cf9), нематодам (Mi1.2), вирусу бронзовости томата (Sw5), вирусу желтой курчавости листьев томата (Ty3a). Установлено, что все проанализированные гибриды томата с заявленной оригинаторами семян устойчивостью к вирусу желтой курчавости листьев были гетерозиготны по гену Ty3a. На основании проведенных исследований и с учетом требований рынка разработаны модели гибридов F1 томата юга России. Перспективный гибрид томата должен обладать индетерминантным типом роста с укороченными междоузлиями (4,5-5 см) а также хорошей облиственностью. Плоды томата должны быть с красной равномерной окраской без зеленого пятна у плодоножки, с плоскоокруглой или округлой формой плода и со средней массой 220-270 г. Для повышения транспортабельности томатов необходимо, чтобы плоды отличались высокой прочностью и характеризовались хорошей лежкостью. Урожайность гибрида томата должна быть более 30 кг/м2, а товарность - не менее 85%. Гибрид томата должен обладать следующим набором генов устойчивости в гетерозиготном состоянии: Ty3a, Mi1.2, Cf-9, а также в гомозиготном состоянии: Tm2a, I2, Ve. The article provides information on the study of the collection of F1 tomato hybrids (Solanum lycopersicumL.) of foreign breeding from various firms-originators recommended for cultivation in regions with a strong spread of tomato yellow leaf curl virus. All hybrids had a complex of economically valuable traits and a set of genes for resistance to the main diseases of tomato, including a new dangerous pathogen for the South of Russia with a maximum potential risk — the tomato yellow leaf curl virus (TYLCV). The studies were carried out in 2017-2018 in the Solanaceae Laboratory of LLC NIISOK and in the Molecular Diagnostics Laboratory of Plants of LLC Semenovod. A total of 34 F1 tomato hybrids were tested. The hybrids were assessed by a set of economically valuable traits. Molecular genetic analysis was also carried out for the presence and allelic state of the main resistance genes: Tomato mosaic virus (Tm2a), Fusarium wilt (I2), Werticillium wilt (Ve), Cladosporium fulvum (Cf9), Nematodes (Mi1.2), Tomato spotted wilt virus (Sw5), Tomato yellow leaf curl virus (Ty3a). It was found that all the analyzed tomato hybrids with the declared by seed originators resistance to yellow leaf curl virus were heterozygous for the Ty3a gene. Based on the conducted research and taking into account the market requirements, models of F1 tomato hybrids for protected ground for the South of Russia have been developed. A promising tomato hybrid should have an indeterminate growth type with shortened internodes (4.5-5 cm) and good foliage. Tomato fruits should have a uniform red color without green shoulders, with a flat-round or round shape of the fruit and with an average weight of 220-270 g. To increase the transportability of tomatoes, it is necessary that the fruits are highly firm and characterized by good shelf life. The yield of tomato hybrid should be more than 30 kg/m2, and marketability should be at least 85%. The tomato hybrid should have the following set of resistance genes in a heterozygous state: Ty3a, Mi1.2, Cf-9, and also in a homozygous state: Tm2a, I2, Ve.

scholarly journals The Tomato Yellow Leaf Curl Virus Resistance Genes Ty-1 and Ty-3 Are Allelic and Code for DFDGD-Class RNA–Dependent RNA Polymerases

PLoS Genetics ◽  
2013 ◽  
Vol 9 (3) ◽  
pp. e1003399 ◽  
Author(s):  
Maarten G. Verlaan ◽  
Samuel F. Hutton ◽  
Ragy M. Ibrahem ◽  
Richard Kormelink ◽  
Richard G. F. Visser ◽  
...  
Keyword(s):  
Resistance Genes ◽  
Virus Resistance ◽  
Tomato Yellow Leaf ◽  
Rna Polymerases ◽  
Yellow Leaf ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Tomatillo (Physalis ixocarpa) as a Natural New Host for Tomato yellow leaf curl virus in Sinaloa, Mexico

Plant Disease ◽  
2009 ◽  
Vol 93 (5) ◽  
pp. 545-545 ◽  
Author(s):  
C. Gámez-Jiménez ◽  
J. L. Romero-Romero ◽  
M. E. Santos-Cervantes ◽  
N. E. Leyva-López ◽  
J. Méndez-Lozano
Keyword(s):  
Tomato Yellow Leaf ◽  
Bipartite Begomoviruses ◽  
Yellow Leaf ◽  
New Host ◽  
Pcr Product ◽  
National Production ◽  
Main Production ◽  
Production Areas ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomatillo, also known as husk or green tomato, is cultivated in 29 of 32 states in Mexico, with the main production areas located in the states of Sinaloa, Michoacán, Puebla, Sonora, Guanajuato, Jalisco, and Hidalgo. The national production of tomatillo in 2006 was 805,721 tons with a value of $259 million. Tomato yellow leaf curl virus (TYLCV) is one of the most damaging begomoviruses affecting tomato worldwide. TYLCV was first identified in Mexico in 1999 in Yucatán (1) and most recently identified as infecting tomato in Sinaloa (3). During December of 2006, symptoms including chlorotic margins, yellowing, and interveinal yellowing were observed in tomatillo fields. Symptomatic plants were associated with the presence of whiteflies in many fields, suggesting a begomovirus etiology. Total DNA was extracted from leaves of 77 symptomatic tomatillo plants from Guasave and Ahome counties and amplified by PCR using a degenerate primer pair (2). These primers can differentiate between monopartite and bipartite begomoviruses on the basis of the size of the amplification products, approximately 750 and 650 bp, respectively. A PCR product of 742 bp was obtained from 48 of 97 samples. The PCR product of two representative samples from each county were cloned into pGEM-T Easy Vector (Promega, Madison, WI) and sequenced. The sequences of the four amplicons were identical (GenBank Accession No. EU224314) and were compared with sequences of others begomoviruses in the NCBI/GenBank database using the Clustal V alignment method (MegAlign, DNASTAR software, London). The highest sequence identity of 100% was with a TYLCV isolate from Sinaloa (GenBank Accession No. DQ377367), 99.8% with a TYLCV isolate from Tosa (GenBank Accession No. AB192965), 98.4% with a TYLCV isolate from China (GenBank Accession No. AM282874), 95.8% with a TYLCV isolate from Yucatán (GenBank Accession No. AF168709), and 94.6% with TYLCV-Is (GenBank Accession No. X15656). The genome of tomatillo TYLCV isolate was amplified using PCR and overlapping primer pair (TYLCV NcoI Forward GGCCCATGGCCGCGCAGCGG and Reverse CGGCCATGGAGACCCATAAG). Sequence of a 2,781-bp fragment was obtained (GenBank Accession No. FJ609655) and sequence analysis corroborated that the tomatillo TYLCV has 99.3% identity with two TYLCV isolates from Sinaloa (GenBank Accession Nos. EF5234478 and FJ012358). To our knowledge, this is the first report of tomatillo as a natural host of TYLCV in Mexico. These results suggest that TYLCV has begun to establish itself in others crops since it was first reported to be infecting tomato in Sinaloa, Mexico. References: (1) J. T. Ascencio-Ibañez et al. Plant Dis. 83:1178, 1999. (2) J. T. Ascencio-Ibañez et al. Plant Dis. 86:692, 2002. (3) C. Gámez-Jímenez et al. (Abstr.) Phytopathology 96(suppl.):S38. 2006.

scholarly journals Trans-Replication of, and Competition Between, DNA β Satellites in Plants Inoculated with Tomato yellow leaf curl China virus and Tobacco curly shoot virus

2009 ◽  
Vol 99 (6) ◽  
pp. 716-720 ◽  
Author(s):  
Ling Qing ◽  
Xueping Zhou
Keyword(s):  
Nicotiana Benthamiana ◽  
Yunnan Province ◽  
Relative Concentration ◽  
Distinct Species ◽  
Tomato Yellow Leaf ◽  
Mixed Infections ◽  
Yellow Leaf ◽  
Tobacco Curly Shoot Virus ◽  
Selective Maintenance ◽  
Leaf Curl

Tomato yellow leaf curl China virus (TYLCCNV) Y10 isolate (Y10) and Tobacco curly shoot virus (TbCSV) Y35 isolate (Y35), both obtained from Yunnan Province, were each found to be associated with a distinct species of satellite DNA (DNA β). Here, we demonstrate that both Y10 DNA β (Y10β) and Y35 DNA β (Y35β) were stably trans-replicated by the noncognate Begomovirus, although the noncognate DNA β accumulated in plants at a lower level than did the cognate DNA β. In Nicotiana benthamiana and N. glutinosa plants agroinoculated with Y10+Y10β+Y35β or with Y35+Y35β+Y10β, all components accumulated in the early stages of infection but, at later stages, the noncognate DNA β decreased in relative concentration and was undetectable at 80 to 120 days after inoculation. The helper viruses and cognate DNA β species persisted at higher levels throughout the experiments. When the initiation codon of the βC1 gene of the cognate DNA β was mutated, the dominance of the cognate over the noncognate DNA β in mixed infections was unimpaired. These results imply that the cognate DNA β competes with the noncognate DNA β and that the ability for selective maintenance of DNA β is not controlled by the βC1 protein.

scholarly journals First Report of Tomato Yellow Leaf Curl Geminivirus in Yucatán, México

Plant Disease ◽  
1999 ◽  
Vol 83 (12) ◽  
pp. 1178-1178 ◽  
Author(s):  
J. T. Ascencio-Ibáñez ◽  
R. Diaz-Plaza ◽  
J. Méndez-Lozano ◽  
Z. I. Monsalve-Fonnegra ◽  
G. R. Argüello-Astorga ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Full Length ◽  
Bipartite Begomoviruses ◽  
Amino Terminus ◽  
Yellow Leaf ◽  
Amplification Product ◽  
Viral Pathogen ◽  
Actual Distribution ◽  
Pcr Product ◽  
Leaf Curl

Geminiviruses are probably the most important viral pathogen affecting tomatoes and other crops in the Caribbean region. In addition to losses previously caused by native virus populations, the introduction of tomato yellow leaf curl virus (TYLCV) into the area has become a major concern for tomato growers (1). Since the detection of TYLCV in Cuba, and later in Florida (2,3), we have been monitoring the tomato- and pepper-growing areas of the Yucatán Peninsula, México, for TYLCV. We also have reanalyzed samples previously collected. Other geminiviruses (pepper huasteco virus [PHV], Texas pepper virus [TPV], and tomato mottle virus [ToMoV]) in the area can cause symptoms similar to those induced by TYLCV, which led us to refine our analysis of samples, using a polymerase chain reaction (PCR) procedure that can differentiate between monopartite and bipartite begomoviruses based on the size of the amplification product, 750 and 600 bp, respectively. One advantage of using this set of primers is that the PCR product, which includes the amino terminus of the Rep protein, intergenic region, precoat protein, and amino terminus of the coat protein, can be sequenced completely with only one sequencing reaction from each end. Using the primer set, we analyzed samples collected from tomato and pepper fields (as well as from weeds surrounding the fields) from December 1996 until March 1999. In most cases, samples were taken from plants that showed yellowing, curling, and stunting symptoms. Most of the samples that were positive for geminiviruses came from plants infected with PHV or TPV. However, three tomato samples collected during two seasons in Dzidzantun and Yobain counties (northeast of Mérida, Yucatan) produced the larger PCR amplification product (750 bp) expected for monopartite begomoviruses. PCR products were cloned and sequenced to confirm their identity. The sequence was deposited in the GenBank Database (Accession no. AF168709) and compared with all geminivirus sequences deposited in the database. Analysis showed that the amplified fragment from the TYLCV strain present in the Yucatán is 99% identical to the isolate reported in the Dominican Republic and later found in Cuba (2). As previously noted, the isolate is almost identical to TYLCV-Isr (2). In addition to the PCR product, a full-length TYLCV clone was obtained directly from DNA extracts of an infected tomato plant. Further characterization of the full-length clone is underway. The fact that TYLCV was detected in two counties and in samples collected during two seasons confirms the presence of TYLCV in the Yucatán. Interestingly, although the first positive sample for TYLCV was collected during the winter of 1996 and 1997, current incidence is rather low—only two other positive samples have been detected in more recently collected samples. Perhaps the characteristics of the agriculture system in the Yucatán (small, disperse plots) or the presence of other geminiviruses have contributed to a slow spread of the virus. More comprehensive surveys are required to confirm the actual distribution of the pathogen in the area. References: (1) J. E. Polston et al. Plant Dis. 81:1358, 1997. (2) J. E. Polston et al. Plant Dis. 83:984, 1999. (3) P. L. Ramos et al. Plant Dis. 80:1208, 1996.

scholarly journals The Global Dimension of Tomato Yellow Leaf Curl Disease: Current Status and Breeding Perspectives

2021 ◽  
Vol 9 (4) ◽  
pp. 740
Author(s):  
Zhe Yan ◽  
Anne-Marie A. Wolters ◽  
Jesús Navas-Castillo ◽  
Yuling Bai
Keyword(s):  
Resistance Genes ◽  
Driving Forces ◽  
Current Knowledge ◽  
Rapid Evolution ◽  
Tomato Yellow Leaf ◽  
Current Status ◽  
Yellow Leaf ◽  
Primary Resistance ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato yellow leaf curl disease (TYLCD) caused by tomato yellow leaf curl virus (TYLCV) and a group of related begomoviruses is an important disease which in recent years has caused serious economic problems in tomato (Solanum lycopersicum) production worldwide. Spreading of the vectors, whiteflies of the Bemisia tabaci complex, has been responsible for many TYLCD outbreaks. In this review, we summarize the current knowledge of TYLCV and TYLV-like begomoviruses and the driving forces of the increasing global significance through rapid evolution of begomovirus variants, mixed infection in the field, association with betasatellites and host range expansion. Breeding for host plant resistance is considered as one of the most promising and sustainable methods in controlling TYLCD. Resistance to TYLCD was found in several wild relatives of tomato from which six TYLCV resistance genes (Ty-1 to Ty-6) have been identified. Currently, Ty-1 and Ty-3 are the primary resistance genes widely used in tomato breeding programs. Ty-2 is also exploited commercially either alone or in combination with other Ty-genes (i.e., Ty-1, Ty-3 or ty-5). Additionally, screening of a large collection of wild tomato species has resulted in the identification of novel TYLCD resistance sources. In this review, we focus on genetic resources used to date in breeding for TYLCVD resistance. For future breeding strategies, we discuss several leads in order to make full use of the naturally occurring and engineered resistance to mount a broad-spectrum and sustainable begomovirus resistance.

scholarly journals First Report of Tomato chlorosis virus Infecting Tomato in Single and Mixed Infections with Tomato yellow leaf curl virus in Cuba

Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 836-836 ◽  
Author(s):  
Y. Martínez-Zubiaur ◽  
E. Fiallo-Olivé ◽  
J. Carrillo-Tripp ◽  
R. Rivera-Bustamante
Keyword(s):  
Tomato Yellow Leaf ◽  
Pcr Analysis ◽  
Mixed Infections ◽  
Yellow Leaf ◽  
Rt Pcr ◽  
Specific Primers ◽  
First Report ◽  
Tomato Chlorosis Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.

Sign in / Sign up

Export Citation Format

Share Document