First Report of Leaf Spot Caused by Corynespora cassiicola on Viburnum odoratissimum Ker-Gawl. var. awabuki (K. Koch) Zabel ex Rumpl. (sweet viburnum) in China

Sweet viburnum [Viburnum odoratissimum Ker-Gawl. var. awabuki (K. Koch) Zabel ex Rumpl.] belonging to the family Adoxaceae, is a medical and landscape plant, native to Korea (Jeju Island), Taiwan, and Japan (Edita 1988). In June and September 2019, leaf spots were observed on approximately 65% to 80% of sweet viburnum plants in a hedgerow located in Fenghe Xincheng District (28°41'52.9"N 115°52'14.3"E) in Nanchang, China. Initial symptoms of disease appeared as dark brown spots surrounded by red halos (Figure 1 A), which expanded irregularly. Finally, the center of the lesions desiccated and became light-brown, surrounded by a deep-red halos (Figure 1 B). Ten leaf samples with typical symptoms were collected and washed with tap water for about 15 min. The tissue between the healthy and necrotic area (ca. 4 mm × 4 mm) was cut with a sterile scalpel and surface sterilized with 70% alcohol for 45 s, 2% NaClO for 2 min, washed in sterile deionized water three times, dried on sterilized filter paper, then placed in Petri dishes and incubated at 25℃ in the dark. After 3 to 5 days, the hyphal tips from the edges of growing colonies were transferred to fresh PDA dishes. Eventually, 54 fungal isolates were obtained and, of these, 39 isolates were identical in their morphological characteristics. Morphological analysis was performed according with Ellis (1971). The isolate S18, chosen as representative, formed a gray to grayish brown colony with concentric circleson PDA, and a diameter of 8.5 to 9 cm after 7 days incubation at 25℃ (Figure 1 G). Conidia were hyaline, straight or slightly curved, needle shaped, truncate at the base, and acuminate at the tip, with 2 to 6 pseudosepta, 18.90 to 38.38 µm (avg. = 27.51 µm) × 1.64 to 4.50 µm (avg. = 2.60 µm) (n = 36) (Figure 1 H). The genes of fungal isolates (i.e., ITS, tub2 and ACT) were amplified with ITS4/ITS5 for ITS (White, Bruns et al. 1990), Bt2a/Bt2b for tub2 (Glass and Donaldson 1995) and ACT783R/ACT512F for ACT (Carbone and Kohn 1999) and sequenced. The sequences were deposited in GenBank (MW165772 for ITS, MW175900 for ACT and MW168659 for tub2), which showing greater than 99.1% similarity to multiple C. cassiicola accessions, respectively. Pathogenicity tests were performed on healthy leaves in field by inoculating surface-sterilized mature leaves with puncture wound (Figure C) and non-wounded young leaves with 20 µL of a conidial suspension (105 conidia ml-1) (Figure F and G) at 26℃. After 4 to 7 days, all inoculated leaves reproduced similar symptoms as observed initially in the field (Figure 1 C, E and F). To fulfill Koch’s postulates, the fungus was isolated on PDA from the margins of leaf spots on inoculated leaves and confirmed as C. cassiicola by morphological characters and ITS gene sequencing. Previously, C. cassiicola was reported as an endophyte on Viburnum spp. and Viburnum odoratissimum (Alfieri et al. 1994). More recently, C. cassiicola has been reported as a pathogen of many plant species in China, such as kiwifruit (Cui, Gong et al. 2015), American sweetgum (Mao, Zheng et al. 2021), castor bean (Tang, Liu et al. 2020), and holly mangrove (Xie, He et al. 2020). To our knowledge, this is the first report of leaf spot disease on sweet viburnum caused by C. cassiicola in China and the precise identification of the causal agent will be useful for its management.

Download Full-text

First Report of a Leaf Spot Disease of Bells-of-Ireland (Moluccella laevis) Caused by Cercospora apii in California

Plant Disease ◽

10.1094/pdis.2003.87.2.203a ◽

2003 ◽

Vol 87 (2) ◽

pp. 203-203

Author(s):

S. T. Koike ◽

S. A. Tjosvold ◽

J. Z. Groenewald ◽

P. W. Crous

Keyword(s):

Leaf Spot ◽

Sequence Data ◽

Disease Incidence ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Spot Disease ◽

Leaf Spots ◽

Initial Symptoms

Bells-of-Ireland (Moluccella laevis) (Lamiaceae) is an annual plant that is field planted in coastal California (Santa Cruz County) for commercial cutflower production. In 2001, a new leaf spot disease was found in these commercially grown cutflowers. The disease was most serious in the winter-grown crops in 2001 and 2002, with a few plantings having as much as 100% disease incidence. All other plantings that were surveyed during this time had at least 50% disease. Initial symptoms consisted of gray-green leaf spots. Spots were generally oval in shape, often delimited by the major leaf veins, and later turned tan. Lesions were apparent on both adaxial and abaxial sides of the leaves. A cercosporoid fungus having fasciculate conidiophores, which formed primarily on the abaxial leaf surface, was consistently associated with the spots. Based on morphology and its host, this fungus was initially considered to be Cercospora molucellae Bremer & Petr., which was previously reported on leaves of M. laevis in Turkey (1). However, sequence data obtained from the internal transcribed spacer region (ITS1, ITS2) and the 5.8S gene (STE-U 5110, 5111; GenBank Accession Nos. AY156918 and AY156919) indicated there were no base pair differences between the bells-of-Ireland isolates from California, our own reference isolates of C. apii, as well as GenBank sequences deposited as C. apii. Based on these data, the fungus was subsequently identified as C. apii sensu lato. Pathogenicity was confirmed by spraying a conidial suspension (1.0 × 105 conidia/ml) on leaves of potted bells-of-Ireland plants, incubating the plants in a dew chamber for 24 h, and maintaining them in a greenhouse (23 to 25°C). After 2 weeks, all inoculated plants developed leaf spots that were identical to those observed in the field. C. apii was again associated with all leaf spots. Control plants, which were treated with water, did not develop any symptoms. The test was repeated and the results were similar. To our knowledge this is the first report of C. apii as a pathogen of bells-of-Ireland in California. Reference: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Cornell University Press, Ithaca, New York, 1954.

Download Full-text

First Report of Leaf Spot on Industrial Hemp (Cannabis sativa L.) Caused by Alternaria alternata in China

Plant Disease ◽

10.1094/pdis-01-21-0130-pdn ◽

2021 ◽

Author(s):

Lili Tang ◽

Xixia Song ◽

Liguo Zhang ◽

Jing Wang ◽

Shuquan Zhang

Keyword(s):

Leaf Spot ◽

Cannabis Sativa ◽

Leaf Spot Disease ◽

Molecular Characteristics ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Sterile Water ◽

First Report ◽

Leaf Spots ◽

Industrial Hemp

Industrial hemp is an economically important plant with traditional uses for textiles, paper, building materials, food and medicine (Li 1974; Russo et al. 2008; Zlas et al. 1993). In August 2020, an estimated 80% of the industrial hemp plants with leaf spots were observed in greenhouse in Minzhu town, Harbin City, Heilongjiang Province, China (45.8554°N, 126.8167°E), resulting in yield losses of 20%. Leaf symptoms began as small spots on the upper surface of leaves and gradually developed into brown spots with light yellow halos. These irregular spots expanded gradually and eventually covered the entire leaf; the center of the spots was easily perforated. To identify the pathogen, 20 diseased leaves were collected, and small sections of (3 to 5 mm) were taken from the margins of lesions of infected leaves. The pieces were sterilized with 75% alcohol for 30 s, a 0.1% mercuric chloride solution for 1 min, and then rinsed three times with sterile water. Samples were then cultured on potato dextrose agar at 28℃ in darkness for 4 days. A single-spore culture was obtained by monosporic isolation. Conidiophores were simple or branched, straight or flexuous, brown, and measured 22 to 61 μm long × 4 to 5 μm wide (n = 50). Conidia were solitary or in chains, brown or dark brown, obclavate, obpyriform or ellipsoid. Conidia ranged from 23 to 55 μm long × 10 to 15 μm wide (n = 50) with one to eight transverse and several longitudinal septa. For molecular identification (Jayawardena et al. 2019), genomic DNA of pathogenic isolate (MZ1287) was extracted by a cetyltrimethylammonium bromide protocol. Four gene regions including the rDNA internal transcribed spacer (ITS), glyceraldehyde-3-phosplate dehydrogenase (GAPDH), translation elongation factor 1-alpha (TEF1) and RNA polymerase II beta subunit (RPB2) were amplified with primers ITS1/ITS4, GDF1/GDR1, EF1-728F/EF1-986R and RPB2-5F/RPB2-7cR, respectively (White et al. 1990). Resulting sequences were deposited in GenBank with accession numbers of MW272539.1, MW303956.1, MW415414.1 and MW415413.1, respectively. A BLASTn analysis showed 100% homology with A. alternata (GenBank accession nos. MN615420.1, MH926018.1, MN615423.1 and KP124770.1), respectively. A neighbor-joining phylogenetic tree was constructed by combining all sequenced loci in MEGA7. The isolate MZ1287 clustered in the A. alternata clade with 100% bootstrap support. Thus, based on morphological (Simmons 2007) and molecular characteristics, the pathogen was identified as A. alternata. To test pathogenicity, leaves of ten healthy, 2-month-old potted industrial hemp plants were sprayed using a conidial suspension (1×106 spores/ml). Control plants were sprayed with sterile water. All plants were incubated in a greenhouse at 25℃ for a 16 h light and 8 h dark period at 90% relative humidity. The experiment was repeated three times. After two weeks, leaf spots of industrial hemp developed on the inoculated leaves while the control plants remained asymptomatic. The A. alternata pathogen was re-isolated from the diseased leaves on inoculated plants, fulfilling Koch's postulates. Based on morphology, sequencing, and pathogenicity test, the pathogen was identified as A. alternata. To our knowledge, this is the first report of A. alternata causing leaf spot disease of industrial hemp (Cannabis sativa L.) in China and is worthy of our attention for the harm it may cause to industrial hemp production.

Download Full-text

First report of Bipolaris yamadae leaf spot disease on Guinea grass (Panicum maximum) in Florida.

Plant Disease ◽

10.1094/pdis-07-20-1486-pdn ◽

2020 ◽

Author(s):

Ashish Adhikari ◽

Xuechun Wang ◽

Brett Lane ◽

Philip F Harmon ◽

Erica Goss

Keyword(s):

Leaf Spot ◽

Phylogenetic Trees ◽

Leaf Spot Disease ◽

Panicum Maximum ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

First Report ◽

Leaf Spots ◽

Guinea Grass ◽

Symptomatic Leaf

Guinea grass is an invasive perennial C4 grass and is a common weed around agricultural crops in Louisiana, Texas, and Hawaii, USA (Overholt and Franck 2019). In November 2018, leaf spots were observed on Guinea grass occurring in an organic garden located in Gainesville, Florida, USA. Lesions were oblong to irregular, dark grey to brownish center with pale-yellow to brownish black margin. Lesions had coalesced, forming necrotic margins that spread from the leaf tip, resulting in leaf blight and collapse of the canopy. Pieces of symptomatic leaf blades (5 sq cm) were surface sterilized (1 min), washed with sterile distilled water and plated onto water agar media plates. Plates were incubated at 27°C under 12-h light/dark for 3 to 5 days. Grey to black cottony mycelium was consistent on all plates and produced conidia characteristic of Bipolaris spp. Conidia were transferred to potato dextrose agar (PDA) plates with a 0.5 mm diameter sterile needle. Three isolates GG1, GG2 and GG3 were successfully grown on PDA. Conidia were black to brown colored, distoseptate with 3 to 8 septa and measured from (60.6- )70-105(-139.8) × (16.0-)17-23(-25.9) μm (avg: 93.3 μm, n=35, SD = 20.6; avg = 21.3 μm, n = 35, SD = 2.89). Conidiophores were in groups or single, brown, smooth and straight, septate and swollen at upper tip. Sigma Extract-N-Amp was used for genomic DNA extraction. Primers ITS1/ITS4 and GPD1/GPD2 (Berbee et al. 1999) were used to amplify and sequence the internal transcribed spacer region (ITS) and partial glyceraldehyde-3-phosphate dehydrogenase (GPDH) gene, respectively. Sequences were aligned using MUSCLE and alignment was trimmed for length. Maximum likelihood phylogenetic trees were constructed with 1,000 bootstrap samples based on the K2+G substitution model, selected by BIC for these two loci using Mega X (Kumar et al. 2018). The ITS and GPDH sequences of GG1, GG2 and GG3 (Genbank accessions MT514518-20, MT576654-56), grouped with B. yamadae isolates CPC_28807 and CBS_202.29 in phylogenetic trees (Marin-Felix et al. 2017). All three isolates from Guinea grass were inoculated on Sach’s agar (Luttrell 1958) at 27°C under 12-h light/dark for a week, but no sexual morph was observed, and consistent for two repeated inoculations. To fulfill Koch’s postulates, one isolate, GG1, was used. Conidia were harvested from a one-week-old colony grown on PDA incubated at 27°C and 12-h light/dark cycle. The concentration of the conidial suspension was adjusted to 105 conidia/ml using a hemocytometer. Using a Passche H-202S airbrush sprayer, five-week-old seedlings of Guinea grass were sprayed until runoff with the conidia suspension or 0.5% tween water only. Each treatment included four replicates and the experiment was repeated. Leaf spot symptoms were observed on the seedlings inoculated with conidia, whereas seedlings sprayed with water were asymptomatic. Cultures with the expected morphology were isolated from symptomatic leaf blades and absent from control plants. To our knowledge, this is the first report of leaf spot on Guinea grass caused by B. yamadae in Florida, USA. B. yamadae was previously reported from Guinea grass in India, and from other Panicum species in the northern USA (Farr and Rossman 2019). B. yamadae was also isolated from sugarcane in Cuba and China, and corn in Japan (Manamgoda et al. 2014, Raza et al. 2019), which suggests that it has the potential to impact agronomic crops in Florida, such as sugarcane and corn.

Download Full-text

First Report of Gray Leaf Spot of Mango (Mangifera indica) Caused by Pestalotiopsis mangiferae in Taiwan

Plant Disease ◽

10.1094/pdis-91-12-1684b ◽

2007 ◽

Vol 91 (12) ◽

pp. 1684-1684 ◽

Cited By ~ 6

Author(s):

Y. Ko ◽

K. S. Yao ◽

C. Y. Chen ◽

C. H. Lin

Keyword(s):

Leaf Spot ◽

Mangifera Indica ◽

Gray Leaf Spot ◽

Leaf Spot Disease ◽

Continuous Exposure ◽

Conidial Suspension ◽

Tropical Fruit ◽

First Report ◽

Spot Disease ◽

Initial Symptoms

Mango (Mangifera indica L.; family Anacardiaceae) is one of the world's most important fruit crops and is widely grown in tropical and subtropical regions. Since 2001, a leaf spot disease was found in mango orchards of Taiwan. Now, the disease was observed throughout (approximately 21,000 ha) Taiwan in moderate to severe form, thus affecting the general health of mango trees and orchards. Initial symptoms were small, yellow-to-brown spots on leaves. Later, the irregularly shaped spots, ranging from a few millimeters to a few centimeters in diameter, turned white to gray and coalesced to form larger gray patches. Lesions had slightly raised dark margins. On mature lesions, numerous black acervuli, measuring 290 to 328 μm in diameter, developed on the gray necrotic areas. Single conidial isolates of the fungus were identified morphologically as Pestalotiopsis mangiferae (Henn.) Steyaert (2,3) and were consistently isolated from the diseased mango leaves on acidified (0.06% lactic acid) potato dextrose agar (PDA) medium incubated at 25 ± 1°C. Initially, the fungus grew (3 mm per day) on PDA as a white, chalky colony that subsequently turned gray after 2 weeks. Acervuli developed in culture after continuous exposure to light for 9 to 12 days at 20 to 30°C. Abundant conidia oozed from the acervulus as a creamy mass. The conidia (17.6 to 25.4 μm long and 4.8 to 7.1 μm wide) were fusiform and usually straight to slightly curved with four septa. Three median cells were olivaceous and larger than the hyaline apical and basal cells. The apical cells bore three (rarely four) cylindrical appendages. Pathogenicity tests were conducted with either 3-day-old mycelial discs or conidial suspension (105 conidia per ml) obtained from 8- to 10-day-old cultures. Four leaves on each of 10 trees were inoculated. Before inoculation, the leaves were washed with a mild detergent, rinsed with tap water, and then surface sterilized with 70% ethanol. Leaves were wounded with a needle and exposed to either a 5-mm mycelial disc or 0.2 ml of the spore suspension. The inoculated areas were wrapped with cotton pads saturated with sterile water and the leaves were covered with polyethylene bags for 3 days to maintain high relative humidity. Wounded leaves inoculated with PDA discs alone served as controls. The symptoms described above were observed on all inoculated leaves, whereas uninoculated leaves remained completely free from symptoms. Reisolation from the inoculated leaves consistently yielded P. mangiferae, thus fulfilling Koch's postulates. Gray leaf spot is a common disease of mangos in the tropics and is widely distributed in Africa and Asia (1–3); however, to our knowledge, this is the first report of gray leaf spot disease affecting mango in Taiwan. References: (1) T. K. Lim and K. C. Khoo. Diseases and Disorders of Mango in Malaysia. Tropical Press. Malaysia, 1985. (2) J. E. M. Mordue. No. 676 in: CMI Descriptions of Pathogenic Fungi and Bacteria. Surrey, England, 1980. (3) R. C. Ploetz et al. Compendium of Tropical Fruit Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text

First Report of Leaf Spot Disease of Peony Caused by Seimatosporium botan in China

Plant Disease ◽

10.1094/pdis-10-10-0735 ◽

2011 ◽

Vol 95 (2) ◽

pp. 226-226

Author(s):

Y. B. Duan ◽

Z. Z. Yu ◽

Y. B. Kang

Keyword(s):

Basal Cell ◽

Leaf Spot ◽

Apical Cell ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Humid Atmosphere ◽

First Report ◽

Spot Disease ◽

Initial Symptoms

Tree peony (Paeonia suffruticosa Andrews), a perennial ligneous deciduous shrub in the Paeoniaceae family, is known for its beautiful and charming flowers. It is regarded as the flower symbol of China and is cultivated throughout the country. In August 2008, a previously unknown leaf spot was observed on peony cultivated in the Mountain Peony Garden located in the Luoyang area of Henan Province, China. In 2009, the leaf spot disease was observed in some gardens in the city of Luoyang, China. Initial symptoms appeared as small, round or irregular, brown, necrotic lesions in the middle of leaves. These lesions gradually enlarged up to 1 cm in diameter and were circular or irregular, brown to dark brown, and brown on the margins. In a humid atmosphere, black, sessile, discoid acervuli developed on the lesions, and the lesions sometimes became waxy-like, eventually coalesced, and nearly covered the entire leaf. Conidia produced in acervuli had two morphologically different types. One type had a single basal appendage, ellipsoid to fusiform, transversely three septate, 16 to 20 × 5 to 7 μm, smooth, basal cell obconic with a truncate base, subhyaline, 3 to 5 μm long; two central cells subcylindrical to dolioform, brown to dark brown, 8 to 10 μm long, apical cell conical with rounded apex, concolorous with the central cells, 4 to 5 μm long, basal appendage filiform, unbranched, excentric, 4 to 8 μm long. The other type had a single appendage at both ends, fusiform to subcylindrical, transversely three septate, 16 to 20 × 4 to 5 μm, smooth; basal cell obconic with a truncate base, subhyaline, 4 to 5 μm long; two central cells subcylindrical to dolioform, pale brown, 8 to 11 μm long; apical cell conical with an acute apex, hyaline to subhyaline, 4 to 5 μm long; basal appendage filiform, unbranched, excentric, 4 to 8 μm long; apical appendage filiform, unbranched, 4 to 8 μm long. Single conidial isolates of both types of conidia yielded identical colonies, which produced both types of conidia on potato dextrose agar (PDA), thus showing that both types of conidia belonged to the same fungus. Colonies on PDA were slimy in appearance, yellow to villous with an irregular taupe margin; reverse brown to grayish brown. Cultural and conidial characteristics of the isolates were similar to those of Seimatosporium botan (1). The DNA sequence for the fungus showed internal transcribed spacer region (ITS1-5.8S-ITS2) sequences (GenBank Accession No. HM067840) with 93% sequence identity to S. discosioides (Accession Nos. EF600970.1 and EF600969.1). This is the first submission of a S. botan sequence to GenBank. To determine pathogenicity, 20 healthy leaves of P. suffruticosa were inoculated by spraying a conidial suspension of S. botan onto the foliage. Ten leaves were sprayed with sterile water and served as controls. Plants were covered with plastic for 24 h to maintain high relative humidity. After 15 days, the symptoms described above were observed on leaves in all inoculated plants, whereas symptoms did not develop on the control plants. The pathogen was reisolated from inoculated leaves, fulfilling Koch's postulates. On the basis of morphology and ITS region sequences, we conclude that S. botan is the causal agent of leaf spots of P. suffruticosa. There is a report of S. botan on P. suffruticosa stems in Japan (1), but to our knowledge, this is the first report of leaf spot disease of peony caused by S. botan in China. References: (1) S. Hatakeyama et al. Mycoscience 45:106, 2004.

Download Full-text

First Report of Leaf Spot of Phoenix theophrasti Caused by Paraconiothyrium variabile in Greece

Plant Disease ◽

10.1094/pdis-01-13-0114-pdn ◽

2013 ◽

Vol 97 (9) ◽

pp. 1250-1250

Author(s):

E. K. Ligoxigakis ◽

I. A. Papaioannou ◽

E. A. Markakis ◽

M. A. Typas

Keyword(s):

Leaf Spot ◽

Rrna Genes ◽

Leaf Spot Disease ◽

28S Rrna ◽

Conidial Suspension ◽

First Report ◽

Spot Disease ◽

Initial Symptoms ◽

Palm Species ◽

Paraconiothyrium Variabile

In the spring of 2011, a severe leaf spot disease of Phoenix theophrasti was observed in the vicinity of Heraklion (Crete), Greece. Initial symptoms were small, round-ovoid spots of varying shades of brown on the leaves, later being transformed into oblong streaks (average dimensions 7.3 ± 1.0 × 3.3 ± 0.5 mm), surrounded by dark brown rings. As the disease progressed, the expanding streaks often coalesced to form enlarged necrotic lesions. Similar symptoms were also detected on petioles and leaf bases. Extended spotting and blighting occasionally resulted in leaf death. A filamentous fungus was consistently isolated onto potato dextrose agar plates from the periphery of the characteristic lesions, with cultures invariably producing brick to cinnamon colonies with sparse aerial mycelium, subglobose and dark brown superficial pycnidial conidiomata on pine needles, 1- to 3-celled hyaline conidiophores, and hyaline, subcylindrical to ellipsoidal, 1-celled, smooth- and thin-walled conidia, with average dimensions of 3.5 ± 0.6 × 1.7 ± 0.4 μm (n = 100). Total DNA of two isolates was extracted and used for PCR amplification and sequencing of the ITS1-5.8S-ITS2 region, together with parts of the flanking 18S and 28S rRNA genes (4). Both sequences (GenBank Accession Nos. JX456476 and JX456477) were 100% identical to deposited Paraconiothyrium variabile ITS sequences (EU295640 to 48, JN983440 and 41, and JF934920), and were clustered together as a single group with these sequences with good support by phylogenetic analysis that included representatives of the relative P. brasiliense and P. africanum species. Based on the morphological, molecular, and phylogenetic analyses, the pathogen was identified as P. variabile Riccioni, Damm, Verkley & Crous (2). To prove pathogenicity, 10 P. theophrasti 2-year-old seedlings were sprayed with a conidial suspension of the fungus (107 conidia ml–1, 10 ml per plant), while five additional control plants were treated with sterile distilled water. All plants were maintained in the greenhouse at 15 ± 5°C, with 90% humidity. Characteristic leaf spots were evident 4 weeks post inoculation on the older leaves, and P. variabile was consistently reisolated from all inoculated plants. No symptoms were observed on control plants. Paraconiothyrium variabile has been isolated from various woody host plants such as Prunus persica, P. salicina, and Malus sp. in South Africa (1,2), Actinidia chinensis and A. deliciosa in Italy (2), Laurus nobilis in Turkey (2), and Salix matsudana in China (3). To our knowledge, this is the first report of P. variabile naturally infecting and causing a leaf spot disease on a palm species. Palms are extensively used as ornamentals throughout Greece and the occurrence of P. variabile can potentially result in economic loss to the local ornamental industry. References: (1) M. Cloete et al. Phytopathol. Mediterr. 50:S176, 2011. (2) U. Damm et al. Persoonia 20:9, 2008. (3) H. Gao et al. Afr. J. Biotechnol. 10:4166, 2011. (4) M. P. Pantou et al. Mycol. Res. 109:889, 2005.

Download Full-text

First report of leaf spot disease caused by Corynespora cassiicola on American sweetgum (Liquidambar styraciflua L.) in China

Plant Disease ◽

10.1094/pdis-08-20-1842-pdn ◽

2021 ◽

Author(s):

Yun-fei Mao ◽

Xiang-rong Zheng ◽

Fengmao Chen

Keyword(s):

Leaf Spot ◽

Morphological Characteristics ◽

Liquidambar Styraciflua ◽

Bootstrap Support ◽

Leaf Spot Disease ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Corynespora Cassiicola ◽

First Report ◽

Leaf Spots

American sweetgum (Liquidambar styraciflua L.) is a forest plant native to North America, which has been introduced into other countries due to its ornamental and medicinal values. In June 2019, symptoms of leaf spots on sweetgum were observed in a field (5 ha) located in Xuzhou, Jiangsu Province, China. On this field, approximately 45% of 1,000 trees showed the same symptoms. Symptoms were observed showing irregular or circular dark brown necrotic lesions approximately 5 to 15 mm in diameter with a yellowish margin on the leaves. To isolate the pathogen, diseased leaf sections (4×4mm) were excised from the margin of the lesion, surface-sterilized with 0.1% NaOCl for 90 s, rinsed 4 times in sterile distilled water, air dried and then transferred on potato dextrose agar (PDA) medium at 25°C in the dark. Pure cultures were obtained by monospore isolation after subculture. Ten purified isolates, named FXI to FXR, were transferred to fresh PDA and incubated as above to allow for morphological and molecular identification. After 7 days, the aerial mycelium was abundant, fluffy and exhibited white to greyish-green coloration. The conidia were dark brown or olive, solitary or produced in chains, obclavate, with 1 to 15 pseudosepta, and measured 45 to 200µm  10 to 18µm. Based on morphological features, these 10 isolates were identified as Corynespora cassiicola (Ellis et al. 1971). Genomic DNA of each isolate was extracted from mycelia using the cetyltrimethylammonium bromide (CTAB) method. The EF-1α gene and ITS region were amplified and sequenced with the primer pairs rDNA ITS primers (ITS4/ITS5) (White et al. 1990) and EF1-728F/EF-986R (Carbone et al.1999) respectively. The sequences were deposited in GenBank. BLAST analysis revealed that the ITS sequence had 99.66% similarity to C. cassiicola MH255527 and that the EF-1α sequence had 100% similarity to C. cassiicola KX429668A. maximum likelihood phylogenetic analysis based on EF-1α and ITS sequences using MEGA 7 revealed that ten isolates were placed in the same clade as C. cassiicola (Isolate: XQ3-1; accession numbers: MH572687 and MH569606, respectively) at 98% bootstrap support. Based on the morphological characteristics and phylogenetic analyses, all isolates were identified as C. cassiicola. For the pathogenicity test, a 10 µl conidial suspension (1×105 spores/ml) of each isolate was dripped onto healthy leaves of 2-year-old sweetgum potted seedlings respectively. Leaves inoculated with sterile water served as controls. Three plants (3 leaves per plant) were conducted for each treatment. The experiment was repeat twice. All seedlings were enclosed in plastic transparent incubators to maintain high relative humidity (90% to 100%) and incubated in a greenhouse at 25°C with a 12-h photoperiod. After 10 days, leaves inoculated with conidial suspension of each isolate showed symptoms of leaf spots, similar to those observed in the field. Control plants were remained healthy. In order to reisolate the pathogen, surface-sterilized and monosporic isolation was conducted as described above. The same fungus was reisolated from the lesions of symptomatic leaves, and its identity was confirmed by molecular and morphological approaches, thus fulfilling Koch’s postulates. Chlorothalonil and Boscalid can be used to effectively control Corynespora leaf spot (Chairin T et al.2017). To our knowledge, this is the first report of leaf spot caused by C. cassiicola on L. styraciflua in China.

Download Full-text

First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽

10.1094/pdis-03-12-0257-pdn ◽

2013 ◽

Vol 97 (3) ◽

pp. 418-418 ◽

Cited By ~ 5

Author(s):

M. Gupta ◽

N. Bharat ◽

A. Chauhan ◽

A. Vikram

Keyword(s):

Host Range ◽

Pseudomonas Syringae ◽

Leaf Spot ◽

Molecular Techniques ◽

Bacterial Suspension ◽

Leaf Spot Disease ◽

Rrna Gene ◽

First Report ◽

Leaf Spots ◽

Initial Symptoms

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Download Full-text

First Report of Anthracnose of Alocasia macrorrhiza Caused by Colletotrichum karstii in Guangdong, China

Plant Disease ◽

10.1094/pdis-10-13-1046-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 696-696 ◽

Cited By ~ 1

Author(s):

Y. He ◽

C. Shu ◽

J. Chen ◽

E. Zhou

Keyword(s):

Morphological Characteristics ◽

Pcr Amplification ◽

Leaf Spot Disease ◽

Molecular Characteristics ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Leaf Spots ◽

Purification Technique ◽

Initial Symptoms

Alocasia macrorrhiza (L.) Schott. (Araceae), native to South America, is a common, herbaceous perennial ornamental plant in tropical and subtropical areas (1). A severe leaf spot disease was observed on this plant in several places on the campus of authors' university in Guangzhou, Guangdong Province, China, in April 2013. Initial symptoms were water-soaked, dark green leaf spots. These small spots gradually expanded to 6- to 11-mm circular lesions. They were grayish-white in color with a yellow halo and many small, black, concentric dots were observed on them. Microscopic examination revealed that these small dots were acervuli, which were 100 to 300 μm in diameter, developing beneath the epidermis and becoming erumpent with age. By using routine tissue-isolation method and single-spore purification technique, four single-conidial isolates were obtained from each of four diseased leaves. These isolates formed a grayish-white colony with numerous pink spore masses on PDA at 28°C. Their mycelial radial growth rate was about 4.5 mm per day. Conidia were single-celled, hyaline, and cylindrical with an obtuse apex and protruding base; they were 12.7 to 14.2 × 4.8 to 5.9 μm in size. Conidial appressoria were irregular in shape, sepia to dark brown, solitary, and 6.9 to 8.5 × 4.6 to 5.9 μm. These morphological characteristics were consistent with the description of Colletotrichum karstii (2). The sequences of beta-tubulin gene (TUB2) and partial actin gene (ACT) of a representative isolate CAM1 were obtained by PCR amplification with primers BT2a/BT2b and ACT512F/ACT783R, respectively. These sequences were deposited in GenBank under the accession numbers of KF444947 and KF460435. BLAST searches showed a 99% homology with the TUB2 and ACT sequences of C. karstii (JX625209, KC843559). Therefore, the fungus isolated from A. macrorrhiza was identified as C. karstii by morphological and molecular characteristics. Pathogenicity tests were performed on 30-day-old plants of A. macrorrhiza grown in plastic pots (0.8 L) by spraying 15 ml conidial suspension (1 × 106 conidia ml–1) of this fungus onto each plant. The control plants were sprayed only with sterile distilled water. These plants then were placed in an intelligent artificial climate incubator with 12-h photoperiod and 100% relative humidity at 24 ± 1°C. Three replicates, each with five plants, were included in a test, and the test was repeated twice. Seven days after inoculation, the inoculated plants showed necrotic lesions on leaves similar to those observed on the campus, but no symptoms were observed on any non-inoculated controls. The same fungus C. karstii was re-isolated from the infected leaves. Although C. karstii is a well-known anthracnose pathogen on some plants belonging to family Orchidaceae (2), this is the first report of the same pathogen causing anthracnose on A. macrorrhiza in Guangdong, China. References: (1) S. Li et al. PLoS ONE 8(6):e66016, 2013. (2) Y. Yang et al. Cryptogr. Mycol. 32:229, 2011.

Download Full-text

First Report of Alternaria alternata Causing Leaf Spot of Tartary Buckwheat (Fagopyrum tataricum) in China

Plant Disease ◽

10.1094/pdis-01-21-0191-pdn ◽

2021 ◽

Author(s):

Shaoqing Li ◽

quan shen ◽

Haihua Wang ◽

Feng He ◽

Zuyin Xiao ◽

...

Keyword(s):

Alternaria Alternata ◽

Leaf Spot ◽

Tartary Buckwheat ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Sterile Water ◽

Fagopyrum Tataricum ◽

First Report ◽

Fungal Isolates ◽

Initial Symptoms

Buckwheat (Fagopyrum tataricum) is recognized as a healthy food with abundant nutrients and high levels of rutin. In April and May of 2020, an unknown tartary buckwheat leaf spot distinct from Nigrospora leaf spot (Shen et al. 2020) was observed in Xiangxiang, Hunan, China (27°49′54″N, 112°span style="font-family:'Times New Roman'; color:#0000ff">18′48″E.). Disease incidence was 60-70% within three fields (totally 7, 000 m2). The disease occurred after plants emerged. Initial symptoms began as circular, or ellipsoid, chlorotic, water-soaked spots, mostly on leaf apexes or leaf margins. The small spots gradually enlarged and often coalesced to form large circular or irregular, pale to light brown lesions, and the infected leaves eventually withered and fell off. Thirty 2 × 2 mm infected tissue pieces collected from five locations were sterilized in 70% ethanol for 10 S, in 2% NaClO for 30 S, rinsed in sterile water for three times, dried, and placed on PDA with lactic acid (3 ml/L). After 3-5 days at 28°C in the dark, 17 fungal isolates were purified using single-spore isolation method. Almost all fungal isolates had similar morphology. Colonies were initially olive green with white margin and later turned dark olive or black with profuse sporulation. Conidia were borne in long chains, tawny to brownish green, with 1-3 longitudinal and 1-7 transverse septa, pyriform, and measured 9.5-39.6 µm long, and 5.1-12.6 µm wide (n=50). Based on morphological characteristics, the fungus was identified as Alternaria alternata (Simmons 2007). Partial internal transcribed spacer (ITS), glyceraldehyde-3-phosphate dehydrogenase (GAPDH), translation elongation factor 1-α(TEF) and Alternaria major allergen (Alt a1) genes of isolate BLS-1 were amplified using ITS1/ITS4 (Mills et al. 1992), EF1-728F/EF1-986R (Carbone and Kohn 1999), Gpd1/Gpd2 and Alt-4for/Alt-4rev (Lawrence et al. 2013), respectively. Sequences were deposited into GenBank with acc. nos MW453091 (ITS), MW480219 (GAPDH), MW480218 (TEF), and MW480220 (Alt a1). BLASTn analysis showed 99.8% (ITS, MH854758.1), 100% (GAPDH, KP124155.1), 99.8% (TEF, KP125073.1) and 100% (Alt a1, KP123847.1) identity with reference strain CBS 106.24 of A. alternata, confirming isolate BSL-1 to be A. alternata. A neighbor-joining phylogenetic tree constructed by MEGA7.0 based on concatenated sequences of the four genes indicated that BSL-1 formed a distinct clade with A. alternata CBS 106.24 with 100% bootstrap values. Pathogenicity test was triplicately performed on healthy leaves. Twenty leaves of five 20-day-old plants (cv. Pinku1) were sprayed with conidial suspension (1×106 conidia/ml) collected from PDA cultures with 0.05% Tween 20. An equal number of control leaves were sprayed with sterile water to serve as the controls. Treated plants were kept in a greenhouse at 28±3 °C with relative humidity of 80±5% for 24 h and transferred to natural conditions (22-30°C, RH 50-60%). After 4 to 6 days, all inoculated leaves developed symptoms similar to those observed in the fields, while the control leaves remained healthy. A. alternata was re-isolated from all infected leaves. Occasionally-isolated Diaporthe isolates were not pathogenic. A. alternata causes leaf spot of oat (Zhao et al. 2020) and leaf blight of F. esculentum (Lu et al. 2019). To our knowledge, this is the first report of A. alternata causing leaf spot on F. tataricum in China and the world. Effective strategies should be developed to manage the disease.

Download Full-text