scholarly journals First Report of Bacterial Leaf Spot of Coriander Caused by Pseudomonas syringae pv. coriandricola in India

Plant Disease ◽  
2013 ◽  
Vol 97 (3) ◽  
pp. 418-418 ◽  
Author(s):  
M. Gupta ◽  
N. Bharat ◽  
A. Chauhan ◽  
A. Vikram

A new disease was observed during the early spring of 2011 and 2012 on coriander (Coriandrum sativum L.) in the Himachal Pradesh state of India. Disease incidence was estimated as 10% in approximately 5 ha. Symptoms were observed as brown leaf spots (1 to 2 × 3 to 5 mm) surrounded by a water soaked area. The leaf spots were often angular, being limited by veins. Leaf spots merged to cause a more extensive blight. Symptomatic leaf tissues were surface sterilized in 0.1% HgCl2 for 30 sec followed by three successive rinses in sterilized water. Small sections of tissue were excised aseptically from leaf spot margins and transferred to several drops of sterile distilled water in a petri dish for 30 min. The diffusate was streaked onto King's B medium and incubated at 25°C for 24 to 48 h. Six representative strains of bacteria were isolated from five infected leaves. The bacteria were characterized as Gram negative, rod shaped, with few polar flagella and nonfluorescent on KB, and positive for levan production and tobacco hypersensitivity reaction but negative for oxidase reaction, rot of potato slices, and arginine dihydrolase. Preliminary identification of bacterial isolates was made on the basis of morphological and biochemical characters (3) and confirmed for one isolate by partial 16S rRNA gene sequencing. Using primers PF:5′AACTGAAGAGTTTGATCCTGGCTC3′ and PR:5′TACGGTTACCTTGTTACGACTT3′, a 1,265-bp DNA fragment of the 16S rDNA region was amplified. A BLAST search of this sequence (JX 156334) in the NCBI database placed the isolate in the genus Pseudomonas, with 99% similarity to accession P. syringae GRFHYTP52 (GQ160904). The sequence also showed 97% similarity to P. syringae pv. apii and P. syringae pv. coriandricola isolates from California (1). Identification of the bacterium to pathovar was based on host symptoms, fulfillment of Koch's postulates, cultural characteristics, physiological and determinative tests, and specificity of host range (2). Host range studies were conducted on celery, carrot, fennel, parsley, and parsnip, and no symptoms developed on any of these hosts. Pathogenicity was confirmed by artificial inoculation of five 1-month-old coriander plants with all isolates. A bacterial suspension (108 CFU ml–1) was injected into four leaves for each isolate with a hypodermic syringe and inoculated plants were placed in growth chamber at 25°C and 80% relative humidity. Initial symptoms were observed on leaves within 5 days of inoculation. No symptoms were observed on control plants inoculated with sterile water. Reisolation was performed on dark brown lesions surrounded by yellow haloes on the inoculated leaves and the identity of isolated bacteria was confirmed using the biochemical, pathogenicity, and molecular techniques stated above. All tests were performed three times. To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in India. References: (1) Bull et al., Phytopathology 101:847, 2011. (2) Cerkauskas, Can. J. Plant Pathol. 31:16, 2009. (3) R. A. Lelliott and D. E. Stead, Methods for the Diagnosis of Bacterial Diseases of Plants, Blackwell Scientific, Sussex, UK, 1988.

Plant Disease ◽  
2003 ◽  
Vol 87 (2) ◽  
pp. 203-203
Author(s):  
S. T. Koike ◽  
S. A. Tjosvold ◽  
J. Z. Groenewald ◽  
P. W. Crous

Bells-of-Ireland (Moluccella laevis) (Lamiaceae) is an annual plant that is field planted in coastal California (Santa Cruz County) for commercial cutflower production. In 2001, a new leaf spot disease was found in these commercially grown cutflowers. The disease was most serious in the winter-grown crops in 2001 and 2002, with a few plantings having as much as 100% disease incidence. All other plantings that were surveyed during this time had at least 50% disease. Initial symptoms consisted of gray-green leaf spots. Spots were generally oval in shape, often delimited by the major leaf veins, and later turned tan. Lesions were apparent on both adaxial and abaxial sides of the leaves. A cercosporoid fungus having fasciculate conidiophores, which formed primarily on the abaxial leaf surface, was consistently associated with the spots. Based on morphology and its host, this fungus was initially considered to be Cercospora molucellae Bremer & Petr., which was previously reported on leaves of M. laevis in Turkey (1). However, sequence data obtained from the internal transcribed spacer region (ITS1, ITS2) and the 5.8S gene (STE-U 5110, 5111; GenBank Accession Nos. AY156918 and AY156919) indicated there were no base pair differences between the bells-of-Ireland isolates from California, our own reference isolates of C. apii, as well as GenBank sequences deposited as C. apii. Based on these data, the fungus was subsequently identified as C. apii sensu lato. Pathogenicity was confirmed by spraying a conidial suspension (1.0 × 105 conidia/ml) on leaves of potted bells-of-Ireland plants, incubating the plants in a dew chamber for 24 h, and maintaining them in a greenhouse (23 to 25°C). After 2 weeks, all inoculated plants developed leaf spots that were identical to those observed in the field. C. apii was again associated with all leaf spots. Control plants, which were treated with water, did not develop any symptoms. The test was repeated and the results were similar. To our knowledge this is the first report of C. apii as a pathogen of bells-of-Ireland in California. Reference: (1) C. Chupp. A Monograph of the Fungus Genus Cercospora. Cornell University Press, Ithaca, New York, 1954.


Plant Disease ◽  
2002 ◽  
Vol 86 (8) ◽  
pp. 921-921 ◽  
Author(s):  
S. T. Koike ◽  
H. R. Azad ◽  
D. C. Cooksey

In 2000 and 2001, a new disease was observed on commercial spinach (Spinacia oleracea) in the Salinas Valley, Monterey County, CA. Initial symptoms were water-soaked, irregularly shaped leaf spots (2 to 3 mm diameter). As the disease developed, spots enlarged to as much as 1 to 2 cm, were vein-delimited, and turned dark brown. Faint chlorotic halos sometimes surrounded the spots. Death of large areas of the leaf occurred if spots coalesced. Spots were visible from the adaxial and abaxial sides of leaves, and no fungal structures were observed. The disease occurred on newly expanded and mature foliage. No fungi were isolated from the spots. However, cream-colored bacterial colonies were consistently isolated on sucrose peptone agar, and these strains were nonfluorescent on King's medium B. Strains were positive for levan and negative for oxidase, arginine dihydrolase, and nitrate reductase. Strains did not grow at 36°C, did not rot potato slices, but induced a hypersensitive reaction in tobacco (Nicotiana tabacum cv. Turk). These results suggested the bacterium was similar to Pseudomonas syringae. Fatty acid methyl ester (FAME) analysis (MIS-TSBA 4.10, MIDI Inc., Newark, DE) indicated the strains were highly similar (80.1 to 89.3%) to P. syringae pv. maculicola. However, in contrast to P. syringae pv. maculicola, the spinach strains did not utilize the carbon sources erythritol, L+tartrate, L lactate, and DL-homoserine. Pathogenicity of 10 strains was tested by growing inoculum in nutrient broth shake cultures for 48 h, diluting to 106 CFU/ml, and spraying 4-week-old plants of spinach cv. Bossanova. Control plants were sprayed with sterile nutrient broth. After 5 to 8 days in a greenhouse (24 to 26°C), leaf spots identical to those observed in the field developed on cotyledons and true leaves of inoculated plants. Strains were reisolated from the spots and identified as P. syringae. Control plants remained symptomless. The 10 strains were also inoculated on beet (Beta vulgaris), Swiss chard (Beta vulgaris subsp. cicla), cilantro (Coriandrum sativum), and spinach. Spinach showed leaf spots after 8 days; however, none of the other plants developed symptoms. Two strains were inoculated onto spinach cvs. Califlay, Lion, Nordic IV, Polka, Resistoflay, Rushmore, RZ 11, Spinnaker, Springfield, Viroflay, and Whitney. Leaf spot developed on all cultivars, and the pathogen was reisolated. Because the FAME data indicated a similarity between the spinach pathogen and P. syringae pv. maculicola, we inoculated sets of spinach cv. Bolero, cabbage (Brassica oleracea subsp. capitata cv. Grenedere), and cauliflower (Brassica oleracea subsp. botrytis cv. White Rock) with three P. syringae pv. maculicola and three spinach strains. Cabbage and cauliflower developed leaf spots only when inoculated with P. syringae pv. maculicola; spinach had leaf spots only when inoculated with the spinach strains. All inoculation experiments were done twice, and the results of the two tests were the same. To our knowledge, this is the first report of bacterial leaf spot of spinach in California caused by a nonfluorescent P. syringae, and the first record of this disease in the United States. Biochemical characteristics and limited host range of the pathogen indicate the California strains are likely the same as the P. syringae pv. spinaciae pathogen that was reported in Italy (1) and Japan (2). References: (1) C. Bazzi et al. Phytopathol. Mediterr. 27:103, 1988. (2) K. Ozaki et al. Ann. Phytopathol. Soc. Jpn. 64:264, 1998.


Plant Disease ◽  
2021 ◽  
Author(s):  
Dayu Lan ◽  
Fangling Shu ◽  
Yanhui Lu ◽  
Anfa Shou ◽  
Wei Lin ◽  
...  

Tobacco (Nicotiana tabacum L.), one of the chief commercial crops, is wildly cultivated worldwide. In June 2020 and 2021, an unknown bacterial leaf spot on tobacco was found in Hezhou and Hechi City, Guangxi, China. 30% of the tobacco were affected and the rate of diseased leaves reached about 10% in the field under high temperature and rainstorm. The disease mainly damaged the middle and top leaves of tobacco plants at vigorous growing stage. The initial symptoms were water-soaked spots on the frontal half of a leaf, and then expanded into circular to irregular spots with a yellow halo at the edge. The spots mostly appeared dark brown at high air humidity, while yellow brown at low humidity and exhibited a concentric pattern. In severe cases, the lesions coalesced and the whole leaf was densely covered with lesions, resulting in the loss of baking value. A bacterium was consistently isolated from diseased leaf tissues on nutrient agar (NA). Growth on NA was predominantly grayish white circular bacterial colonies with smooth margins, and the bacterium is rod-shaped, gram-negative and fluorescent on King’s B medium. Seven isolates (ND04A-ND04C and ZSXF02-ZSXF05) were selected for molecular identification and pathogenicity tests. Genomic DNA of the bacterium was extracted and the housekeeping gene of cts (encoding citrate synthase) was amplified with the primers cts-Fs/cts-Rs (forward primer cts-Fs: 5’-CCCGTCGAGCTGCCAATWCTGA-3’; reverse primer cts-Rs: 5’-ATCTCGCACGGSGTRTTGAACATC-3’) (Berge et al. 2014; Sarkar et al. 2004). 409-bp cts gene sequences were deposited in the GenBank database for seven isolates (accession no. OK105110-OK105116). Sequence of seven isolates shared 100% identity with several Pseudomonas cichorii strains within the GenBank database (accession no. KY940268 and KY940271), and the phylogenetic tree of cts genes of the seven isolates clustered with the phylogroup 11 of Pseudomonas syringae (accession no. KJ877799 and KJ878111), which was classified as P.cichorii. To satisfy Koch’s postulates, a pathogenicity test was tested by using a needle to dip a suspension of the bacterium (108 CFU/ml) and pricking three holes in the tobacco leaf. The control plants leaves were needled with sterile water. Each tobacco plant was inoculated with three leaves, and the test was repeated three times. All plants were placed in transparent plastic boxes and incubated in a greenhouse at 25 ± 3°C. The water-soaked spots appeared 24h after inoculation and quickly expanded through leaf veins. Three days after inoculation, all the inoculated leaves showed symptoms similar to those observed in the field. Control plants remained healthy. Only P. cichorii was successfully re-isolated from the lesions, confirming Koch’s postulates. Pseudomonas cichorii can infect eggplant, lettuce, tomatoand other crops, and has a wide range of hosts (Timilsina et al. 2017; Ullah et al. 2015). To our knowledge, this is the first report of P. cichorii causing leaf spot on tobacco in China.


Plant Disease ◽  
2021 ◽  
Author(s):  
Lei Li ◽  
Yishuo Huang ◽  
Yanxia Shi ◽  
A LI CHAI ◽  
Xuewen Xie ◽  
...  

Coriander (Coriandrum sativum L.) or Chinese parsley is a culinary herb with multiple medicinal effects that are widely used in cooking and traditional medicine. From September to November 2019, symptoms were observed in 2-month-old coriander plants from coriander fields in Lanzhou and Wenzhou, China. The disease developed rapidly under cold and wet climatic conditions, and the infection rate was almost 80% in open coriander fields. Typical symptoms on leaves included small, water-soaked blotches and irregular brown spots surrounding haloes; as the disease progressed, the spots coalesced into necrotic areas. Symptomatic leaf tissue was surface sterilized, macerated in sterile distilled water, and cultured on nutrient agar plates at 28 °C for 48 h (Koike and Bull, 2006). After incubation, six bacterial colonies, which were individually isolated from collected samples from two different areas, were selected for further study. Colonies on NA plate were small, round, raised, white to cream-colored, and had smooth margins. All bacterial isolates were gram-negative, rod-shaped and nonfluorescent on King's B medium. The bacteria were positive for levan production, Tween 80 hydrolysis, and tobacco hypersensitivity but negative for oxidase, potato slice rot test, arginine dihydrolase, ice nucleation activity, indole production and H2S production. The suspension of representative isolate for inoculating of plants was obtained from single colony on King's B medium for 2-3 days at 28 °C. DNA was extracted from bacterial suspensions of YS2003200102 cultured in 20 ml of King’s B medium broth at 28 °C for 1 day. Extraction was performed with a TIANamp Bacterial DNA Kit (TIANGEN, China) according to the manufacturer’s recommendations. The pathogen was confirmed by amplification and sequencing of the glyceraldehyde-3-phosphate dehydrogenase A (gapA) gene, the citrate synthase (gltA) gene, the DNA gyrase B (gyrB) gene and the RNA polymerase sigma factor 70 (rpoD) gene using gapA-For/gapA-Rev, gltA-For/gltA-Rev, gyrB-For/gryB-Rev, rpoD-For/rpoD-Rev primers, respectively (Popović et al., 2019). The sequences of the PCR products were deposited in GenBank with accession numbers MZ681931 (gapA), MZ681932 (gltA), MZ681933 (gyrB), and MZ681934 (rpoD). Phylogenetic analysis of multiple genes (Xu and Miller, 2013) was conducted with the maximum likelihood method using MEGA7. The sequences of our isolates and ten published sequences of P. syringae pv. coriandricola were clustered into one clade with a 100% confidence level. To confirm the pathogenicity of isolate YS2003200102, 2-month-old healthy coriander plants were inoculated by spraying the leaves with a bacterial suspension (108 CFU ml−1) at 28 °C incubation temperature and 70% relative humidity condition, and sterile distilled water was applied as a negative control treatment (Cazorla et al. 2005). Three replicates were conducted for every isolate, and each replicate included 6 coriander plants. After twelve days, only the inoculated leaves with bacterial suspension showed bacterial leaf spot resembling those observed on naturally infected coriander leaves. Cultures re-isolated from symptomatic leaves showed the same morphological characteristics and molecular traits as those initially isolated from infected leaves in the field. This bacterium was previously reported causing leaf spot of coriander in India and Spain (Gupta et al. 2013; Cazorla et al. 2005). To our knowledge, this is the first report of P. syringae pv. coriandricola causing leaf spot disease on coriander in China. Studies are needed on strategies to manage P. syringae pv. coriandricola in crops, because its prevalence may cause yield loss on coriander in China.


Plant Disease ◽  
2021 ◽  
Author(s):  
Marilen Nampijja ◽  
Mike Derie ◽  
Lindsey J. du Toit

Arizona is an important region of the USA for winter production of baby leaf crops such as spinach (Spinacia oleracea), table beet (Beta vulgaris subsp. vulgaris Condivita Group), and Swiss chard (B. vulgaris subsp. vulgaris Cicla Group). In the winter of 2019, severe leaf spots were observed at 80% incidence and 40% severity per plant in a 1-ha baby leaf Swiss chard crop of an (unknown cultivar) in Arizona. The lesions were circular to irregular, necrotic, water-soaked, and 1 to 5 mm in diameter. Symptomatic leaf sections (1-cm2) were surface-sterilized with 0.6% NaOCl, rinsed, and macerated in sterilized, deionized water. An aliquot of each macerate was streaked onto King’s B (KB) agar medium. Cream-colored, non-fluorescent colonies typical of Pseudomonas were isolated consistently, and all were non-fluorescent. A dozen isolates selected randomly were all negative for potato soft rot, oxidase, and arginine dihydrolase, and positive for levan production and tobacco hypersensitivity, which is typical of fluorescent P. syringae isolates, but can also include non-fluorescent strains (Lelliot et al. 1966). Three isolates were tested for pathogenicity on the table beet cv. Red Ace and Swiss chard cv. Silverado. Strain Pap009 of P. syringae pv. aptata (Psa), demonstrated previously to be pathogenic on Swiss chard and table beet, served as a positive control strain (Derie et al. 2016; Safni et al. 2016). Each isolate was grown inoculated into medium 523 broth and incubated on a shaker at 175 rpm overnight at 25°C. Each bacterial suspension was adjusted to an optical density (OD) of 0.3 at 600 nm (108 CFU/ml), and diluted in 0.0125M phosphate buffer to 107 CFU/ml. Thirty-day-old seedlings grown in Redi-Earth Plug and Seedling Mix in a greenhouse at 22 to 26°C were inoculated by rubbing the abaxial and adaxial leaf surfaces of each plant with a cotton swab dipped in inoculum to which Carborundum had been added (0.06 g/10 ml). The negative control plants were treated similarly with phosphate buffer with Carborundum. The experiment was set up as a randomized complete block design with 4 replications per treatment and 6 seedlings per experimental unit. In both trials, leaf spots resembling those on the original plants developed on all table beet and Swiss chard plants inoculated with the Arizona isolates and Pap009, but not on negative control plants. Disease severity was greater on Swiss chard (average 39% leaf area with spots) than on table beet (14%). Re-isolates obtained from inoculated seedlings using the same method as the original isolations resembled Psa. Multilocus sequence analysis (MLSA) was carried out for the original three Arizona isolates and the re-isolates using DNA amplified from the housekeeping genes gyrB, rpoD, gapA, and gltA (Hwang et al. 2005; Sarkar and Guttman 2004). Sequence identities of these genes of the Arizona isolates (GenBank accession numbers MW291615 to MW291618 for strain Pap089; MW291619 to MW291622 for Pap095; and MW291623 to MW291626 for Pap096 for gltA, gyrB, rpoD, and gapA, respectively) and the re-isolates ranged from 98 to 100% with those of Psa pathotype strain CFBP 1617 in the PAMDB database (Almeida et al. 2010; Altschul et al. 1997). Based on Koch’s postulates, colony characteristics, and MLSA, Psa was the causal agent of leaf spots in the Arizona Swiss chard crop. To our knowledge, this is the first report of bacterial leaf spot on chard in Arizona. The pathogen could have been introduced on infected seed as Psa is readily seedborne and seed transmitted.


Plant Disease ◽  
2021 ◽  
Author(s):  
Tianning Zhang ◽  
Huanhuan Liu ◽  
Qingni Song ◽  
Jun Liu ◽  
Qingpei Yang ◽  
...  

Sweet viburnum [Viburnum odoratissimum Ker-Gawl. var. awabuki (K. Koch) Zabel ex Rumpl.] belonging to the family Adoxaceae, is a medical and landscape plant, native to Korea (Jeju Island), Taiwan, and Japan (Edita 1988). In June and September 2019, leaf spots were observed on approximately 65% to 80% of sweet viburnum plants in a hedgerow located in Fenghe Xincheng District (28°41'52.9"N 115°52'14.3"E) in Nanchang, China. Initial symptoms of disease appeared as dark brown spots surrounded by red halos (Figure 1 A), which expanded irregularly. Finally, the center of the lesions desiccated and became light-brown, surrounded by a deep-red halos (Figure 1 B). Ten leaf samples with typical symptoms were collected and washed with tap water for about 15 min. The tissue between the healthy and necrotic area (ca. 4 mm × 4 mm) was cut with a sterile scalpel and surface sterilized with 70% alcohol for 45 s, 2% NaClO for 2 min, washed in sterile deionized water three times, dried on sterilized filter paper, then placed in Petri dishes and incubated at 25℃ in the dark. After 3 to 5 days, the hyphal tips from the edges of growing colonies were transferred to fresh PDA dishes. Eventually, 54 fungal isolates were obtained and, of these, 39 isolates were identical in their morphological characteristics. Morphological analysis was performed according with Ellis (1971). The isolate S18, chosen as representative, formed a gray to grayish brown colony with concentric circleson PDA, and a diameter of 8.5 to 9 cm after 7 days incubation at 25℃ (Figure 1 G). Conidia were hyaline, straight or slightly curved, needle shaped, truncate at the base, and acuminate at the tip, with 2 to 6 pseudosepta, 18.90 to 38.38 µm (avg. = 27.51 µm) × 1.64 to 4.50 µm (avg. = 2.60 µm) (n = 36) (Figure 1 H). The genes of fungal isolates (i.e., ITS, tub2 and ACT) were amplified with ITS4/ITS5 for ITS (White, Bruns et al. 1990), Bt2a/Bt2b for tub2 (Glass and Donaldson 1995) and ACT783R/ACT512F for ACT (Carbone and Kohn 1999) and sequenced. The sequences were deposited in GenBank (MW165772 for ITS, MW175900 for ACT and MW168659 for tub2), which showing greater than 99.1% similarity to multiple C. cassiicola accessions, respectively. Pathogenicity tests were performed on healthy leaves in field by inoculating surface-sterilized mature leaves with puncture wound (Figure C) and non-wounded young leaves with 20 µL of a conidial suspension (105 conidia ml-1) (Figure F and G) at 26℃. After 4 to 7 days, all inoculated leaves reproduced similar symptoms as observed initially in the field (Figure 1 C, E and F). To fulfill Koch’s postulates, the fungus was isolated on PDA from the margins of leaf spots on inoculated leaves and confirmed as C. cassiicola by morphological characters and ITS gene sequencing. Previously, C. cassiicola was reported as an endophyte on Viburnum spp. and Viburnum odoratissimum (Alfieri et al. 1994). More recently, C. cassiicola has been reported as a pathogen of many plant species in China, such as kiwifruit (Cui, Gong et al. 2015), American sweetgum (Mao, Zheng et al. 2021), castor bean (Tang, Liu et al. 2020), and holly mangrove (Xie, He et al. 2020). To our knowledge, this is the first report of leaf spot disease on sweet viburnum caused by C. cassiicola in China and the precise identification of the causal agent will be useful for its management.


Plant Disease ◽  
2005 ◽  
Vol 89 (9) ◽  
pp. 1010-1010 ◽  
Author(s):  
G. Polizzi ◽  
I. Castello ◽  
G. Parlavecchio ◽  
G. Cirvilleri

White bird of paradise tree (Strelitzia augusta Thunb.), originally from South Africa, is a tender perennial cultivated as an ornamental plant and is used in gardens in Italy. During February of 2004, a new blight disease was noticed on potted S. augusta at different ages (6 months to 4 years) in several commercial nurseries of eastern Sicily. Field inspections revealed disease incidences as high as 40%. Initial symptoms were small, water-soaked leaf spots that expanded throughout the veins in dark brown streaks. Stem cross sections revealed browning of the vascular tissues, which might involve the entire stem. In some cases, the necrosis extended to the apical bud, causing death of the plant. Thirty explants from infected tissues were washed in sterile water and plated on plate count agar (PCA) from which two types of bacterial colonies were consistently isolated. Pathogenicity tests were performed on S. augusta plants. Twenty-four plants were inoculated (12 per bacterial isolate) using two different procedures: spray with a bacterial suspension (106 CFU/ml) and wounding with an infected needle on the midribs. The same number of noninoculated plants was used as controls. All plants were maintained at 24 to 26°C with 95 to 100% relative humidity until symptoms occurred 4 days later. Just one of the two tested bacterial types was pathogenic. The symptoms were similar to those previously observed in the field. No symptoms were observed in the plants spray inoculated with the bacterial suspension, proving that the bacteria were unable to infect in the absence of a wound. The controls showed no symptoms. Koch's postulates were fulfilled by the reisolation of the infective strain which was sent to the CBS (Centraalbu-reau voor Schimmelcultures) and identified as Pseudomonas syringae pv. Lachrymans/pisi using the Biolog MicroLog3 4.01C program (Biolog Inc., Hayward, CA). Further pathogenicity tests have been carried out on zucchini and pea pods to characterize the pathovar using 48SR1 of P. syringae pv. syringae and B4 of P. syringae pv. pisi as reference strains. Necrotic, sunken, water-soaked spots surrounded by a chlorotic halo, reported in the literature as typical symptoms of P. syringae pv. lachry-mans (Smith & Bryan) Young, Dye & Wilkie (1), were observed on zucchini when inoculated with our strain. Our P. syringae strain did not cause the typical symptoms of P. syringae pv. pisi on inoculated pea pods. The results of the pathogenicity tests and the inability of the P. syringae strain isolated from S. augusta to utilize homoserine, used to discriminate pv. pisi from other pathovars of P. syringae, allowed us to identify the strain as P. syringae pv. lachrymans. Low temperature damage and late transplant may have promoted the spread of the disease in the nurseries. Under these conditions, the economic importance of this disease for the crop can be considered high. To our knowledge, this is first report of P. syringae pv. lachrymans on S. augusta. Reference: (1) K. Pohronezny et al. Plant Dis. Rep. 62:306, 1978.


Plant Disease ◽  
2009 ◽  
Vol 93 (2) ◽  
pp. 204-204 ◽  
Author(s):  
S. F. Zhao ◽  
Y. N. Luo ◽  
H. Y. Zhao ◽  
J. Du ◽  
X. Y. Fang

Snow lotus (Saussurea involucrata (Kar. & Kir.) Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. During the summer and autumn of 2005, 2006, and 2007, a necrosis of unknown etiology was observed on leaves in commercial production areas in Xinjiang Province of China. Disease incidence was approximately 40 to 50% of the plants during the 2005 and 2007 growing seasons. Initial symptoms consisted of pronounced water-soaked, dark brown-to-black spots that were 1 to 2 mm in diameter on young, expanding leaves. Later, some leaf spots on older leaves enlarged and coalesced, causing leaf desiccation. Leaf samples were collected in 2005, 2006, and 2007 from the affected hosts. Bacterial streaming was evident from these samples, and 28 strains were isolated on nutrient agar or King's medium B (KMB). All strains were gram negative and fluoresced bluegreen under UV light after 48 h of growth at 28°C on KMB. On the basis of LOPAT tests, the strains were identified as Pseudomonas syringae (1). The identity of two strains was confirmed by sequencing the 16S rDNA gene, which revealed 98% similarity to P. syringae strains in NCBI (Accession Nos. FJ001817 and FJ001818 for XJSNL 111 and 107, respectively). Infiltration of tobacco leaves with bacterial suspensions resulted in typical hypersensitivity reactions within 24 h. Pathogenicity of the strains was confirmed by spray inoculating five snow lotus leaves of a six-leaf stage plant with 108 CFU ml–1 bacterial suspensions in sterile water and five plants sprayed with sterile distilled water served as controls. Inoculated and sterile water-sprayed controls were maintained in the growth chamber with 90% relative humidity for 15 days at 15 ± 2°C. Symptoms similar to the original symptoms were observed on inoculated plants after 2 weeks. No symptoms developed on controls. Bacteria reisolated from inoculated plants were identified as strains of P. syringae. Isolates were deposited at the Key Laboratory for Oasis Crop Disease Prevention and Cure, Shihezi University. Rust caused by Puccinia carthami and leaf spot disease caused by Alternaria carthami of snow lotus have been reported (2,3). To our knowledge, this is the first report of P. syringae as the cause of bacterial leaf spot on snow lotus in China. References: (1) A. Braun-Kiewnick and D. C. Sands. Pseudomonas. Page 84 in: Laboratory Guide for the Identification of Plant Pathogenic Bacteria. 3rd ed. N. W. Schaad et al., eds. The American Phytopathological Society, St. Paul, MN, 2001. (2) S. Zhao et al. Plant Dis. 91:772, 2007. (3) S. Zhao et al. Plant Dis. 92:318, 2008.


Plant Disease ◽  
2019 ◽  
Vol 103 (12) ◽  
pp. 3199-3208 ◽  
Author(s):  
Maryam Ansari ◽  
S. Mohsen Taghavi ◽  
Sadegh Zarei ◽  
Soraya Mehrb-Moghadam ◽  
Hamzeh Mafakheri ◽  
...  

In this study, we provide a polyphasic characterization of 18 Pseudomonas spp. strains associated with alfalfa leaf spot symptoms in Iran. All of the strains were pathogenic on alfalfa, although the aggressiveness and symptomology varied among the strains. All strains but one were pathogenic on broad bean, cucumber, honeydew, and zucchini, whereas only a fraction of the strains were pathogenic on sugar beet, tomato, and wheat. Syringomycin biosynthesis genes (syrB1 and syrP) were detected using the corresponding PCR primers in all of the strains isolated from alfalfa. Phylogenetic analyses using the sequences of four housekeeping genes (gapA, gltA, gyrB, and rpoD) revealed that all of the strains except one (Als34) belong to phylogroup 2b of P. syringae sensu lato, whereas strain Als34 placed within phylogroup 1 close to the type strain of P. syringae pv. apii. Among the phylogroup 2b strains, nine strains were phylogenetically close to the P. syringae pv. aptata clade, whereas the remainder were scattered among P. syringae pv. atrofaciens and P. syringae pv. syringae strains. Pathogenicity and host range assays of the bacterial strains evaluated in this study on a set of taxonomically diverse plant species did not allow us to assign a “pathovar” status to the alfalfa strains. However, these results provide novel insight into the host range and phylogenetic position of the alfalfa-pathogenic members of P. syringae sensu lato, and they reveal that phenotypically and genotypically heterogeneous strains of the pathogen cause bacterial leaf spot of alfalfa.


Plant Disease ◽  
2008 ◽  
Vol 92 (2) ◽  
pp. 318-318
Author(s):  
S. Zhao ◽  
G. Xie ◽  
H. Zhao ◽  
H. Li ◽  
C. Li

Snow lotus (Saussurea involucrata Karel. & Kir. ex Sch. Bip.) is an economically important medicinal herb increasingly grown in China in recent years. In June of 2005, a leaf spot disease on commercially grown plants was found in the QiTai Region, south of the Tianshan Mountain area of Xinjiang, China at 2,100 m above sea level. Disease incidence was approximately 60 to 70% of the plants during the 2006 and 2007 growing seasons. Initial symptoms appeared on older leaves as irregularly shaped, minute, dark brown-to-black spots, with yellow borders on the edge of the leaflet blade by July. As the disease progressed, the lesions expanded, causing the leaflets to turn brown, shrivel, and die. A fungus was consistently isolated from the margins of these lesions on potato dextrose agar. Fifty-eight isolates were obtained that produced abundant conidia in the dark. Conidia were usually solitary, rarely in chains of two, ellipsoid to obclavate, with 6 to 11 transverse and one longitudinal or oblique septum. Conidia measured 60 to 80 × 20 to 30 μm, including a filamentous beak (13 to 47 × 3.5 to 6 μm). According to the morphology, and when compared with the standard reference strains, the causal organism of leaf spot of snow lotus was identified as Alternaria carthami (1,4). Pathogenicity of the strains was tested on snow lotus seedlings at the six-leaf stage. The lower leaves of 20 plants were sprayed until runoff with conidial suspensions of 1 × 104 spores mL–1, and five plants sprayed with sterile distilled water served as controls. All plants were covered with a polyethylene bag, incubated at 25°C for 2 days, and subsequently transferred to a growth chamber at 25°C with a 16-h photoperiod. Light brown lesions developed within 10 days on leaflet margins in all inoculated plants. The pathogen was reisolated from inoculated leaves, and isolates were deposited at the Key Oasis Eco-agriculture Laboratory of Xinjiang Production and Construction Group, Xinjiang and the Institute of Biotechnology, Zhejiang University. No reports of a spot disease caused by A. carthami on snow lotus leaves have been found, although this pathogen has been reported on safflower in western Canada (3), Australia (2), India (1), and China (4). To our knowledge, this is the first report of a leaf spot caused by A. carthami on snow lotus in China. References: (1) S. Chowdhury. J. Indian Bot. Soc. 23:59, 1944. (2) J. A. G. Irwin. Aust. J. Exp. Agric. Anim. Husb. 16:921, 1976. (3) G. A. Petrie. Can. Plant Dis. Surv. 54:155, 1974. (4) T. Y. Zhang. J. Yunnan Agric. Univ.17:320, 2002.


Sign in / Sign up

Export Citation Format

Share Document