scholarly journals First Report of Iris yellow spot virus Infecting Green Onion in Indonesia

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1665-1665 ◽  
Author(s):  
H. R. Pappu ◽  
A. Rauf
Keyword(s):  
Consensus Sequence ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Fta Cards ◽  
Field Samples

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5′-AGCAAAGTGAGAGGACCACC-3′ and IYSV-239f: 5′ TGAGCCCCAATCAAGACG3′ (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 96:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Iris yellow spot virus in Onion in Mauritius

Plant Disease ◽  
2010 ◽  
Vol 94 (11) ◽  
pp. 1373-1373 ◽  
Author(s):  
K. Lobin ◽  
A. Saison ◽  
B. Hostachy ◽  
S. P. Benimadhu ◽  
H. R. Pappu
Keyword(s):  
Disease Incidence ◽  
Consensus Sequence ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Das Elisa

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by thrips (Thrips tabaci Lindeman) is an economically important viral pathogen of bulb and seed onion (Allium cepa) crops in many onion-growing areas of the world (2,3). In Africa, IYSV has been reported in Reunion (4) and South Africa (1). In June 2008, diamond-shaped lesions that are typical of IYSV were observed on onion seed scapes in an onion plot of 0.25 ha at Reduit in the central part of Mauritius. Disease incidence was 80% with a severity of 50 to 75% of the scape surface area. Lodging was observed in 25% of the symptomatic plants. Twenty-two symptomatic plants were tested and found to be positive for IYSV when tested by double antibody sandwich (DAS)-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). The presence of the virus was confirmed by reverse transcription (RT)-PCR tests with primers 917L: 5′-TAAAACTTAACTAACACAAA-3′ and 56U: 5′-TCCTAAGTATTCACCAT-3′ as forward and reverse primers, respectively, for specific sequences flanking the CP gene. Another set of primers specific to the small (S) RNA of IYSV (5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTT AACAAGCAC-3′) produced an amplicon of approximately 1.2 kb that includes the 772-bp nucleocapsid (N) gene. The 1.2-kb amplicon was cloned and four clones were sequenced and consensus sequence was used for comparisons. Sequence analysis showed that the N gene of the IYSV isolate from Mauritius (GenBank Accession No. HM218822) shared the highest nucleotide sequence identity (99%) with several known IYSV N gene sequences (Accession Nos. FJ785835 and AM900393) available in the GenBank, confirming the presence of IYSV in the onion crops in Mauritius. A survey was subsequently carried out from July to November 2008 in major onion-growing localities at La Marie, Henrietta, Reduit, and Plaine Sophie (center); Bassin, La Ferme, and La Chaumiere (west); Grand Sable, Petit Sable, and Plaisance (south, southeast); and Belle Mare, Trou d'Eau Douce, and Palmar (east) to monitor the distribution of the disease on the island. Symptomatic samples with diamond-to-irregularly shaped lesions were observed and 155 symptomatic and 35 nonsymptomatic samples were collected and screened by DAS-ELISA for IYSV and Tomato spotted wilt virus (TSWV), another tospovirus reported to infect onion elsewhere. Sixty-six percent of the symptomatic samples screened (102 of 155) tested positive for IYSV. No IYSV was detected in the symptomless samples. There was no serological indication of TSWV infection in the samples. Samples that tested positive for IYSV were collected from Belle mare, Palmar, and Trou d'eau douce in the east and La Ferme in the west. Cultivars infected were Gandiole, Local Red, and Veronique. No IYSV was detected in the bulbs. The vector, T. tabaci, was observed in infected onion parcels surveyed and is known to occur in all onion-producing areas of the island. To our knowledge, this is the first report of IYSV in onion in Mauritius. Further surveys and monitoring of IYSV incidence, along with its impact on the yield, need to be established. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

scholarly journals Identification and Incidence of Iris yellow spot virus, a New Pathogen in Onion and Leek in Greece

Plant Disease ◽  
2009 ◽  
Vol 93 (7) ◽  
pp. 761-761 ◽  
Author(s):  
E. K. Chatzivassiliou ◽  
V. Giavachtsia ◽  
A. H. Mehraban ◽  
K. Hoedjes ◽  
D. Peters
Keyword(s):  
Polyclonal Antibodies ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Sequence Comparisons ◽  
Thrips Species ◽  
Field Samples ◽  
Das Elisa

Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an emerging and serious pathogen affecting several Allium spp. worldwide (2). The virus causes straw-colored, chlorotic or necrotic lesions that coalesce, occasionally resulting in an extensive necrosis on onion (A. cepa L.) leaves. From February to June 2008, 530 onion and 439 leek (A. porum L.) leaf samples showing a variety of lesions were collected from different areas of Greece. All plants sampled were infested with Thrips tabaci Lindeman, the sole thrips species identified as the vector of this virus. Samples were analyzed by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against the N protein of IYSV (Laboratory of Virology, Wageningen Agricultural University). A higher percentage of onion samples than leek samples were infected, with IYSV detected in 36, 44, 23.7, 61.7, 10, 55, 15.3, and 9.4% of onion samples from the prefectures of Evros, Heraklion, Kavala, Magnissia, Pella, Rodopi, Thessaloniki, and Viotia, respectively, and in 5, 0, 0, 9.3, and 13% of leek samples from Evros, Heraklion, Magnissia, Pella, and Thessaloniki, respectively. No leek samples were tested from Kavala, Rodopi, and Viotia. Sap extracts from some positive samples were mechanically inoculated onto Nicotiana benthamiana leaves, and infected plants developed typical IYSV symptoms and were positive in DAS-ELISA, confirming transmission from the field samples. Viral RNA was extracted from ELISA-positive onion and leek samples and an ~800-bp amplicon was obtained from both hosts by reverse-transcription (RT)-PCR and N-gene primers derived from IYSV (IY1: 5′-CCCGAGGATCCATGGCTACCGTTAGGG-3′ and IY2: 5′-CCCGAGGATCCAAATTAATTATATCTATCTTTCTTGG-3′) (1). These amplicons were cloned and sequenced (GenBank Accession No. FJ785835) and nucleotide sequence comparisons showed a 98 to 99% identity with a Dutch isolate of IYSV (GenBank Accession No AF001387). The virus was transmitted among onion seedlings in the laboratory using a leek population of T. tabaci. Infected seedlings, as determined by DAS-ELISA, developed symptoms similar to those observed in the field samples. To our knowledge, this is the first report of IYSV in Greece; however, the virus seems already to be very well established. References: (1) I. Cortez et al. Phytopathology 88:1276, 1998. (2) D. Gent et al. Plant. Dis. 90:1468, 2006.

scholarly journals First Report of Onion (Allium cepa) Naturally Infected with Iris yellow spot virus in Peru

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 377-377 ◽  
Author(s):  
S. W. Mullis ◽  
R. D. Gitaitis ◽  
C. Nischwitz ◽  
A. S. Csinos ◽  
Z. C. Rafael Mallaupoma ◽  
...  
Keyword(s):  
The United States ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Enzyme Linked Immunosorbent Assay ◽  
Spot Virus ◽  
First Report ◽  
The Impact ◽  
Das Elisa

Onions have become an important export crop for Peru during the last few years. The onions produced for export are primarily short-day onions and include Grano- or Granex-type sweet onions. The first of two growing seasons for onion in Peru occurs from February/March until September/October and the second occurs from September/October to December/January. Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), primarily transmitted by onion thrips (Thrips tabaci), has been reported in many countries during recent years, including the United States (1,2). In South America, the virus was reported in Brazil during 1999 (3) and most recently in Chile during 2005 (4). During 2003, an investigation of necrotic lesions and dieback in onions grown near the towns of Supe and Ica, Peru led to the discovery of IYSV in this region. Of 25 samples of symptomatic plants collected from five different fields near Supe, 19 tested strongly positive and an additional three tested weakly positive for IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkhart, IN). None of the samples tested positive for Tomato spotted wilt virus (TSWV). A number of onions with necrosis and dieback symptoms were also observed during 2004 and 2005. During September 2005, 25 plants with symptoms suspected to be caused by IYSV or TSWV in the Supe and Casma valleys were collected and screened for both viruses using DAS-ELISA. All plants screened were positive for IYSV. There was no serological indication of TSWV infection in these samples. The positive samples were blotted onto FTA cards (Whatman Inc., U.K.) to bind the viral RNA for preservation and processed according to the manufacturer's protocols. The presence of IYSV was verified by reverse transcription-polymerase chain reaction (RTPCR) using (5′-TCAGAAATCGAGAAACTT-3′) and (5′-TAATTATATCTATCTTTCTTGG-3′) as forward and reverse primers (1), respectively. The primers amplify the nucleocapsid (N) gene of IYSV, and the RT-PCR products from this reaction were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose to verify the presence of this amplicon in the samples. Subsequent to the September 2005 sampling, 72 additional samples from regions in northern and southern Peru were analyzed in the same manner. The amplicons obtained were cloned, sequenced, and compared with known IYSV isolates for further verification. Onions have become a significant export crop for Peru, and more research is needed to determine the impact of IYSV on the Peruvian onion export crop. To our knowledge, this is the first report of IYSV in onion in Peru. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) L. Pozzer et al. Plant Dis. 83:345, 1999. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

scholarly journals First Report of Iris yellow spot virus Infecting Onion in Pakistan

Plant Disease ◽  
2013 ◽  
Vol 97 (11) ◽  
pp. 1517-1517 ◽  
Author(s):  
R. Iftikhar ◽  
S. Bag ◽  
M. Ashfaq ◽  
H. R. Pappu
Keyword(s):  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Spot Virus ◽  
Viral Pathogen ◽  
Widespread Occurrence ◽  
First Report ◽  
Allium Cepa L ◽  
Seed Crops ◽  
Agricultural Organization

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Iris yellow spot virus on Garlic in India

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1066-1066 ◽  
Author(s):  
S. J. Gawande ◽  
A. Khar ◽  
K. E. Lawande
Keyword(s):  
Natural Infection ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
First Report ◽  
Qiagen Gmbh ◽  
The World ◽  
Seed Crops

Garlic (Allium sativum) is a spice crop of prime importance in India as well as other parts of the world. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important pathogen of onion bulb and seed crops in many parts of the world (3). The virus is also known to infect garlic and other Allium spp. (2–4). IYSV infection of garlic was reported from Reunion Island (4) and the United States (1). In February 2010, straw-colored, spindle-shaped spots with poorly defined ends were observed on the leaves of a garlic crop at the research farm of the Directorate of Onion and Garlic Research in the Pune District of Maharashtra State, India, 105 days after planting. The spots coalesced to form larger patches on the leaves, suggesting possible IYSV infection. Symptoms were visible on older leaves and more prevalent on cv. G-41, G-282, AC50, AC200, AC283, and Godavari than on other cultivars. The incidence of symptomatic plants was estimated at 5% for G-41 and AC-200, 8% for G-282 and AC283, and 10% for AC50. Leaves were sampled from 40 symptomatic plants per cultivar with each sample composited from young, middle, and older (basal) leaves of the plant. Samples were assayed by double-antibody sandwich-ELISA (Loewe Biochemica GmbH, Sauerlach, Germany) and each tested positive for the virus. Total RNA was extracted from the leaves of ELISA-positive plants using the RNAeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany) and tested by reverse transcription-PCR assay using primers IYSV-F (5′-TCAGAAATCGAGAAACTT-3′) and IYSV-R (5′-TAATTATATCTATCTTTCTTGG-3′) (2) designed to amplify 797 bp of the nucleocapsid (N) gene of IYSV. Amplicons of expected size were obtained and cloned into a pDrive vector (Qiagen GmbH). The recombinant clone was sequenced (GenBank Accession No. HM173691). Sequence comparisons showed 98 to 100% nt identity with other IYSV N gene sequences in GenBank (Nos. EU310294 and EU310286). A phylogenetic analysis of the deduced amino acid sequences of the N gene showed that the garlic isolate of IYSV grouped most closely with onion IYSV isolates from India (GenBank Nos. EU310294, EU310286, EU310300, and EU310296). To our knowledge, this is the first report of natural infection of garlic by IYSV in India. Additional surveys and evaluations are needed to obtain a better understanding of the potential impact of IYSV on garlic production in India. References: (1) S. Bag et al. Plant Dis. 93:839, 2009. (2) A. Bulajic et al. Plant Dis. 93:976, 2009. (3) D. Gent et al. Plant Dis. 90:1468, 2006. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Iris yellow spot virus on Onion in New York

Plant Disease ◽  
2007 ◽  
Vol 91 (3) ◽  
pp. 327-327 ◽  
Author(s):  
C. A. Hoepting ◽  
H. F. Schwartz ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
New York ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Onion Thrips ◽  
Spot Virus ◽  
First Report

Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), a potentially devastating disease of onion vectored by onion thrips (Thrips tabaci Lindeman), has been reported from most states in the western United States where significant onion production occurs, with the most recent report from Texas (1). In June 2006, volunteer onion (Allium cepa) plants in Orleans County, New York (Elba muckland) were found to have symptoms indicative of IYSV infection. The scapes (seed stalks) of the volunteer onions found at the edge of a cull pile from a 2005 onion crop exhibited diamond-shaped lesions, each with a distinct green center and a double yellow border. Approximately 25 of 100 plants of red and yellow onion cultivars exhibited characteristic IYSV lesions. The cull pile was composed primarily of locally grown onions, although a few of the bulbs were grown from imported bare-root transplants imported from Arizona. Symptomatic plants tested positive for IYSV using IYSV-specific antiserum from Agdia Inc. (Elkhart, IN) in a double-antibody sandwich-ELISA. The presence of IYSV was verified by reverse transcription (RT)-PCR using primers derived from the small RNA of IYSV (S-RNA). The primers flanked the IYSV nucleocapsid (N) gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′ (3). RT-PCR assays produced a PCR amplicon of expected size (approximately 1.2 kb) and the product was cloned and sequenced. Nucleotide sequence analysis confirmed the identity of the amplicon as that of the IYSV S-RNA. Sequence comparisons showed 95 to 98% identity with known IYSV N gene sequences available in GenBank. The virus is poorly transmitted to onion by mechanical inoculation and we did not have access to a noninfested colony of the onion thrips vector to transfer the virus from these samples to noninfected onions. No asymptomatic plants were tested. Among the onion-growing states in the eastern United States, IYSV has previously only been reported from Georgia (2). To our knowledge, this is the first report of IYSV in New York and the greater northeastern United States. The finding of this disease in New York confirms further spread of the virus within North America and the need for research to develop more effective management options to reduce the impact of IYSV on onion crops. References: (1) M. Miller et al. Plant Dis. 90:1359, 2006. (2) S. W. Mullis et al. Plant Dis. 90:377, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006.

scholarly journals First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 113-113 ◽  
Author(s):  
H. F. Schwartz ◽  
K. Otto ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Allium Porrum ◽  
Rt Pcr ◽  
Spot Virus ◽  
Disease Symptoms ◽  
First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

scholarly journals Green Foxtail (Setaria viridis), A Naturally Infected Grass Host of Iris yellow spot virus in Utah

Plant Disease ◽  
2009 ◽  
Vol 93 (6) ◽  
pp. 670-670 ◽  
Author(s):  
C. K. Evans ◽  
S. Bag ◽  
E. Frank ◽  
J. Reeve ◽  
C. Ransom ◽  
...  
Keyword(s):  
Nucleotide Sequence ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Grass Species ◽  
Setaria Viridis ◽  
Onion Thrips ◽  
Spot Virus ◽  
First Report ◽  
Green Foxtail

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is a serious virus pathogen in onion bulb and seed crops in the United States and several parts of the world (1). The virus is exclusively transmitted by onion thrips (Thrips tabaci). Besides onion and other susceptible crops such as garlic, leek, chives, and several ornamentals, weeds could be serving as potential reservoir sources of virus inoculum. There are reports of several weeds found naturally infected with IYSV (1,2,4). However, there is no report of IYSV infection of a grass species. Leaves of green foxtail (Setaria viridis (L.) Beauv.) were collected from two naturally occurring plants approximately 30 m apart in a weed trial conducted in commercial onions grown in Box Elder County, UT on 24 September 2008. Notes of IYSV symptoms on green foxtail were made only on the two grass plants sampled. Density of green foxtail in the weed trial was low and was not recorded. Leaves on both plants displayed a range of symptoms that included streaking, purpling, and chlorotic and necrotic lesions along leaf margins oriented along the axis of longitudinal venation. Samples were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). ELISA values of the grass samples were 2.64 and 2.23 for each plant sampled. Negative and positive control readings were 0.24 and 4.33, respectively. All absorbance readings were made at 405 nm. To provide a contrast of the grass data in context to the onion field where the weed trial was located, final visual assessments of onions in the field were made on 4 September 2009. Approximately 300 onion plants were assessed for incidence and severity of disease. Incidence of the disease among onions was 100% and the severity of iris yellow spot on leaves was 20 lesions per leaf. The average ELISA value over 30 individual onions arbitrarily sampled from the field on the same day was 3.50, and the ELISA values among the samples ranged from 1.37 to 4.38. The negative and positive controls were 0.19 and 4.40, respectively. To further verify the presence of IYSV in the grass specimen, reverse transcription-PCR was performed on total nucleic acid extracts obtained from the symptomatic parts of the leaves. Primers specific to the nucleocapsid (N) gene coded by the small (S)-RNA of IYSV were used (3). The forward and reverse primer pairs, 5′-TCAGAAATCGAGAAACTT-3′ and 5′-CACCAATGTCTTCAACAATCTT-3′, respectively, amplify a 751-nt fragment of the N gene (3). An amplicon of expected size was obtained, cloned, and sequenced. The nucleotide sequence analysis and comparison with known IYSV S-RNA sequences showed that the amplicon from foxtail (GenBank Accession No. FJ652594) samples had the highest nucleotide sequence identity (98%) with the corresponding region of an IYSV isolate from Jefferson County, OR (GenBank Accession No. DQ233479). To our knowledge, this is the first report of natural infection of a grass species by IYSV and the first report of a Tospovirus infecting a grass species. The data suggests grasses may serve as a new host reservoir for IYSV. The increasing number of weed hosts of IYSV warrants further study on the role of these weeds as hosts for onion thrips and in IYSV epidemiology. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) C. Nischwitz et al. Plant Dis. 91:1518, 2007. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) R. Sampangi et al. Plant Dis. 91:1683, 2007.

scholarly journals First Report of Natural Infection of Garlic with Iris yellow spot virus in the United States

Plant Disease ◽  
2009 ◽  
Vol 93 (8) ◽  
pp. 839-839 ◽  
Author(s):  
S. Bag ◽  
P. Rogers ◽  
R. Watson ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
Natural Infection ◽  
Sandwich Elisa ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Sequence Comparisons ◽  
First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to onion bulb and seed production in several onion-growing regions of the United States (1,3). While garlic (Allium sativum) was reported to be infected with IYSV in Réunion Island (4), there have been no confirmed reports of natural infection of garlic in the United States. Garlic plants showing near-diamond-shaped lesions were found in August of 2008 in Marion County, Oregon. The 0.4046-ha (1-acre) field plot consisted of various true-seeded garlic varieties and was adjacent to three onion fields that showed IYSV symptoms. Symptoms were observed on 5% of the garlic plants with most of the symptomatic plants displaying small and diffuse straw-colored spots. Seven of these symptomatic plants were selected for testing. Of these, two showed characteristic diamond-shaped, elongated, straw-colored lesions on garlic scapes. However, the lesions were more diffuse with less-defined edges compared with the characteristic diamond-shaped lesions that are often associated with IYSV infection (1). All symptomatic plants were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). To verify IYSV infection, total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV by reverse transcription (RT)-PCR with primers 5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTTAACAAGCAC-3′, which flank the nucleocapsid (N) gene coded by the small RNA of IYSV (2). An approximate 1.1-kb amplicon was obtained from all symptomatic plants and cloned and sequenced. Nucleotide sequence comparisons using BLAST showed that a consensus of three clones derived from the amplicon from garlic (No. FJ514257) was 85 to 99% identical with IYSV sequences available in GenBank (Nos. AF001387, AB180918, and AB286063), confirming the identity of IYSV. To our knowledge, this is the first report of natural infection of IYSV infection of garlic in the United States. Additional surveys and testing are needed to obtain a better understanding of IYSV incidence in garlic to evaluate its impact on garlic production. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Sign in / Sign up

Export Citation Format

Share Document