First Report of Iris yellow spot virus in Onion in Mauritius

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by thrips (Thrips tabaci Lindeman) is an economically important viral pathogen of bulb and seed onion (Allium cepa) crops in many onion-growing areas of the world (2,3). In Africa, IYSV has been reported in Reunion (4) and South Africa (1). In June 2008, diamond-shaped lesions that are typical of IYSV were observed on onion seed scapes in an onion plot of 0.25 ha at Reduit in the central part of Mauritius. Disease incidence was 80% with a severity of 50 to 75% of the scape surface area. Lodging was observed in 25% of the symptomatic plants. Twenty-two symptomatic plants were tested and found to be positive for IYSV when tested by double antibody sandwich (DAS)-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). The presence of the virus was confirmed by reverse transcription (RT)-PCR tests with primers 917L: 5′-TAAAACTTAACTAACACAAA-3′ and 56U: 5′-TCCTAAGTATTCACCAT-3′ as forward and reverse primers, respectively, for specific sequences flanking the CP gene. Another set of primers specific to the small (S) RNA of IYSV (5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTT AACAAGCAC-3′) produced an amplicon of approximately 1.2 kb that includes the 772-bp nucleocapsid (N) gene. The 1.2-kb amplicon was cloned and four clones were sequenced and consensus sequence was used for comparisons. Sequence analysis showed that the N gene of the IYSV isolate from Mauritius (GenBank Accession No. HM218822) shared the highest nucleotide sequence identity (99%) with several known IYSV N gene sequences (Accession Nos. FJ785835 and AM900393) available in the GenBank, confirming the presence of IYSV in the onion crops in Mauritius. A survey was subsequently carried out from July to November 2008 in major onion-growing localities at La Marie, Henrietta, Reduit, and Plaine Sophie (center); Bassin, La Ferme, and La Chaumiere (west); Grand Sable, Petit Sable, and Plaisance (south, southeast); and Belle Mare, Trou d'Eau Douce, and Palmar (east) to monitor the distribution of the disease on the island. Symptomatic samples with diamond-to-irregularly shaped lesions were observed and 155 symptomatic and 35 nonsymptomatic samples were collected and screened by DAS-ELISA for IYSV and Tomato spotted wilt virus (TSWV), another tospovirus reported to infect onion elsewhere. Sixty-six percent of the symptomatic samples screened (102 of 155) tested positive for IYSV. No IYSV was detected in the symptomless samples. There was no serological indication of TSWV infection in the samples. Samples that tested positive for IYSV were collected from Belle mare, Palmar, and Trou d'eau douce in the east and La Ferme in the west. Cultivars infected were Gandiole, Local Red, and Veronique. No IYSV was detected in the bulbs. The vector, T. tabaci, was observed in infected onion parcels surveyed and is known to occur in all onion-producing areas of the island. To our knowledge, this is the first report of IYSV in onion in Mauritius. Further surveys and monitoring of IYSV incidence, along with its impact on the yield, need to be established. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Download Full-text

First Report of Iris yellow spot virus Infecting Green Onion in Indonesia

Plant Disease ◽

10.1094/pdis-05-13-0503-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1665-1665 ◽

Cited By ~ 3

Author(s):

H. R. Pappu ◽

A. Rauf

Keyword(s):

Consensus Sequence ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

Viral Pathogen ◽

First Report ◽

Fta Cards ◽

Field Samples

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5′-AGCAAAGTGAGAGGACCACC-3′ and IYSV-239f: 5′ TGAGCCCCAATCAAGACG3′ (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 96:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

Download Full-text

First Report of Onion (Allium cepa) Naturally Infected with Iris yellow spot virus in Peru

Plant Disease ◽

10.1094/pd-90-0377a ◽

2006 ◽

Vol 90 (3) ◽

pp. 377-377 ◽

Cited By ~ 8

Author(s):

S. W. Mullis ◽

R. D. Gitaitis ◽

C. Nischwitz ◽

A. S. Csinos ◽

Z. C. Rafael Mallaupoma ◽

...

Keyword(s):

The United States ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Enzyme Linked Immunosorbent Assay ◽

Spot Virus ◽

First Report ◽

The Impact ◽

Das Elisa

Onions have become an important export crop for Peru during the last few years. The onions produced for export are primarily short-day onions and include Grano- or Granex-type sweet onions. The first of two growing seasons for onion in Peru occurs from February/March until September/October and the second occurs from September/October to December/January. Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), primarily transmitted by onion thrips (Thrips tabaci), has been reported in many countries during recent years, including the United States (1,2). In South America, the virus was reported in Brazil during 1999 (3) and most recently in Chile during 2005 (4). During 2003, an investigation of necrotic lesions and dieback in onions grown near the towns of Supe and Ica, Peru led to the discovery of IYSV in this region. Of 25 samples of symptomatic plants collected from five different fields near Supe, 19 tested strongly positive and an additional three tested weakly positive for IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkhart, IN). None of the samples tested positive for Tomato spotted wilt virus (TSWV). A number of onions with necrosis and dieback symptoms were also observed during 2004 and 2005. During September 2005, 25 plants with symptoms suspected to be caused by IYSV or TSWV in the Supe and Casma valleys were collected and screened for both viruses using DAS-ELISA. All plants screened were positive for IYSV. There was no serological indication of TSWV infection in these samples. The positive samples were blotted onto FTA cards (Whatman Inc., U.K.) to bind the viral RNA for preservation and processed according to the manufacturer's protocols. The presence of IYSV was verified by reverse transcription-polymerase chain reaction (RTPCR) using (5′-TCAGAAATCGAGAAACTT-3′) and (5′-TAATTATATCTATCTTTCTTGG-3′) as forward and reverse primers (1), respectively. The primers amplify the nucleocapsid (N) gene of IYSV, and the RT-PCR products from this reaction were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose to verify the presence of this amplicon in the samples. Subsequent to the September 2005 sampling, 72 additional samples from regions in northern and southern Peru were analyzed in the same manner. The amplicons obtained were cloned, sequenced, and compared with known IYSV isolates for further verification. Onions have become a significant export crop for Peru, and more research is needed to determine the impact of IYSV on the Peruvian onion export crop. To our knowledge, this is the first report of IYSV in onion in Peru. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) L. Pozzer et al. Plant Dis. 83:345, 1999. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

Download Full-text

First Report of Iris yellow spot virus on Onion (Allium cepa) in Texas

Plant Disease ◽

10.1094/pd-90-1359b ◽

2006 ◽

Vol 90 (10) ◽

pp. 1359-1359 ◽

Cited By ~ 7

Author(s):

M. E. Miller ◽

R. R. Saldana ◽

M. C. Black ◽

H. R. Pappu

Keyword(s):

Disease Incidence ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Onion Thrips ◽

Spot Virus ◽

Das Elisa ◽

Bulb Yield

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has emerged as a potentially devastating and widespread virus of onion. IYSV was first reported in the United States from Idaho in 1993 and has since spread to many of the onion-producing areas (1). In South America, the most recent reports of the virus on onion were from Peru and Chile (2,4). In 2005, onion plants in Uvalde County, Texas exhibited necrotic lesions on leaves typical of IYSV and disease incidence approached 100% in some fields with yield loss and quality problems. Five of six plants tested were positive for IYSV with double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA; Agdia Inc., Elkhart, IN). In 2006, similar lesions were observed on onion plants in Uvalde County and approximately 400 km south in Hidalgo and Cameron counties. Infection points generally started as a single plant near the edge of fields and spread to plants in a 3- to 4-m area after 1 to 2 weeks. Early-season disease incidence was low in onions grown for bulbs and transplants, <10% in 2006. Disease incidence increased in some fields until the crop was harvested. Leaves of symptomatic plants were tested for IYSV and Tomato spotted wilt virus (TSWV) using DAS-ELISA, and 18 of 23 samples from the Hidalgo County area and 12 of 21 samples from the Uvalde County area were positive for IYSV. All samples tested for TSWV from these counties were negative. Virus infection in some ELISA-positive plants was verified by reverse transcription-polymerase chain reaction (RT-PCR) using primers derived from the small RNA of IYSV. The primers flanked the IYSV nucleocapsid (N) gene (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′ (3). RT-PCR gave a PCR product of expected size (approximately 1.2 kb). The DNA amplicon was cloned and sequenced (GenBank Accession No. DQ658242). Nucleotide sequence analysis confirmed the identity of the amplicon as that of IYSV N gene and sequence comparisons with known IYSV N gene sequences showed 95 to 98% sequence identity. The primary vector of IYSV, onion thrips (Thrips tabaci), is a widespread and destructive pest of onion in south Texas. The year-to-year incidence of IYSV and the severity of the disease will probably depend on the onion thrips population levels. Bulb yield reduction could be severe during years with high thrips populations. More research is needed to determine the impact of IYSV on bulb yield in Texas, the relationship between IYSV incidence and T. tabaci population levels, and oversummering hosts. To our knowledge, this is the first known report of IYSV in Texas. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004, (2) S. W. Mullis et al. Plant Dis. 90:377, 2006, (3) H. Pappu et al. Arch. Virol. 151:1015, 2006. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

Download Full-text

Identification and Incidence of Iris yellow spot virus, a New Pathogen in Onion and Leek in Greece

Plant Disease ◽

10.1094/pdis-93-7-0761a ◽

2009 ◽

Vol 93 (7) ◽

pp. 761-761 ◽

Cited By ~ 6

Author(s):

E. K. Chatzivassiliou ◽

V. Giavachtsia ◽

A. H. Mehraban ◽

K. Hoedjes ◽

D. Peters

Keyword(s):

Polyclonal Antibodies ◽

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

Sequence Comparisons ◽

Thrips Species ◽

Field Samples ◽

Das Elisa

Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an emerging and serious pathogen affecting several Allium spp. worldwide (2). The virus causes straw-colored, chlorotic or necrotic lesions that coalesce, occasionally resulting in an extensive necrosis on onion (A. cepa L.) leaves. From February to June 2008, 530 onion and 439 leek (A. porum L.) leaf samples showing a variety of lesions were collected from different areas of Greece. All plants sampled were infested with Thrips tabaci Lindeman, the sole thrips species identified as the vector of this virus. Samples were analyzed by double-antibody sandwich (DAS)-ELISA using polyclonal antibodies against the N protein of IYSV (Laboratory of Virology, Wageningen Agricultural University). A higher percentage of onion samples than leek samples were infected, with IYSV detected in 36, 44, 23.7, 61.7, 10, 55, 15.3, and 9.4% of onion samples from the prefectures of Evros, Heraklion, Kavala, Magnissia, Pella, Rodopi, Thessaloniki, and Viotia, respectively, and in 5, 0, 0, 9.3, and 13% of leek samples from Evros, Heraklion, Magnissia, Pella, and Thessaloniki, respectively. No leek samples were tested from Kavala, Rodopi, and Viotia. Sap extracts from some positive samples were mechanically inoculated onto Nicotiana benthamiana leaves, and infected plants developed typical IYSV symptoms and were positive in DAS-ELISA, confirming transmission from the field samples. Viral RNA was extracted from ELISA-positive onion and leek samples and an ~800-bp amplicon was obtained from both hosts by reverse-transcription (RT)-PCR and N-gene primers derived from IYSV (IY1: 5′-CCCGAGGATCCATGGCTACCGTTAGGG-3′ and IY2: 5′-CCCGAGGATCCAAATTAATTATATCTATCTTTCTTGG-3′) (1). These amplicons were cloned and sequenced (GenBank Accession No. FJ785835) and nucleotide sequence comparisons showed a 98 to 99% identity with a Dutch isolate of IYSV (GenBank Accession No AF001387). The virus was transmitted among onion seedlings in the laboratory using a leek population of T. tabaci. Infected seedlings, as determined by DAS-ELISA, developed symptoms similar to those observed in the field samples. To our knowledge, this is the first report of IYSV in Greece; however, the virus seems already to be very well established. References: (1) I. Cortez et al. Phytopathology 88:1276, 1998. (2) D. Gent et al. Plant. Dis. 90:1468, 2006.

Download Full-text

First Report of Iris yellow spot virus Infecting Onion in Pakistan

Plant Disease ◽

10.1094/pdis-05-13-0502-pdn ◽

2013 ◽

Vol 97 (11) ◽

pp. 1517-1517 ◽

Cited By ~ 3

Author(s):

R. Iftikhar ◽

S. Bag ◽

M. Ashfaq ◽

H. R. Pappu

Keyword(s):

Thrips Tabaci ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Spot Virus ◽

Viral Pathogen ◽

Widespread Occurrence ◽

First Report ◽

Allium Cepa L ◽

Seed Crops ◽

Agricultural Organization

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

Download Full-text

First Report of Iris yellow spot virus on Onion (Allium cepa) in Serbia

Plant Disease ◽

10.1094/pdis-92-8-1247a ◽

2008 ◽

Vol 92 (8) ◽

pp. 1247-1247 ◽

Cited By ~ 8

Author(s):

A. Bulajić ◽

J. Jović ◽

S. Krnjajić ◽

M. Petrov ◽

I. Djekić ◽

...

Keyword(s):

Allium Cepa ◽

Disease Incidence ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Mechanical Transmission ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Seed Crop ◽

Das Elisa

Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is established in several European countries (France, Italy, The Netherlands, Poland, Slovenia, Spain, and the UK) and its distribution in the EU region has increased since 2002 (3). In July 2007, symptoms resembling those of IYSV were observed in an onion (Allium cepa) seed crop in the Sirig locality in Serbia. Onion plants exhibited characteristic symptoms of chlorotic or necrotic spindle and diamond-shaped lesions on the leaves and scapes. Symptomatic plants were found throughout the field and disease incidence was estimated at 80%. Leaf and scape samples were tested for the presence of IYSV and two other tospoviruses, Tomato spotted wilt virus (TSWV) and Impatiens necrotic spot virus (INSV), using commercial double-antibody sandwich (DAS)-ELISA diagnostic kits (Loewe Biochemica, Sauerlach, Germany). All samples tested negative for TSWV and INSV. IYSV was detected serologically in 26 of 34 onion samples. To determine an experimental host range, samples of IYSV-infected onion plants were homogenized in chilled 0.05 M phosphate buffer pH 7 containing 1 mM Na-EDTA, 5 mM Na-DIECA, and 5 mM Na-thioglycolate (2), and host plants were inoculated with the sap. Mechanical transmission of the virus occurred rarely. All inoculated test plants were assayed by DAS-ELISA and only four species tested positive for IYSV, but not in all replications. Inoculated Chenopodium quinoa developed local chlorotic lesions, Nicotiana tabacum cvs. Samsun and Prilep showed mild mosaic, while infected N. benthamiana were symptomless. For further confirmation of IYSV, conventional reverse transcription (RT)-PCR was performed on extracts made from symptomatic onion leaf material and from the ELISA-positive symptomless leaves of N. benthamiana. Total RNAs were extracted with an RNeasy Plant Mini Kit (Qiagen, Hilden, Germany) and RT-PCR was carried out with the OneStep RT PCR Kit (Qiagen) following the manufacturer's instructions. The primer pair, IYSV56U/IYSV917L, covering the entire nucleocapsid (NC) gene was used for both amplification and sequencing (1). A product of the correct predicted size (896 bp) was obtained from each of the plants assayed, and that derived from isolate 605-SRB was purified (QUIAqick PCR Purification Kit, Qiagen) and sequenced (GenBank Accession No. EU586203). BLAST analyses revealed 86 to 97% sequence identity with the NC gene from all other IYSV. The highest identity (97%) was with leek and onion isolates (GenBank Accession Nos. EF427447 and EF19888) from Spain. To our knowledge, this is the first report of IYSV infection of onion seed crop in Serbia. Thorough inspections and subsequent testing would be needed to establish the distribution and incidence of IYSV in Serbia. References: (1) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006. (2) P. Roggero et al. Plant Dis. 86:950, 2002. (3) C. Sansford and J. Woodhall. Pest Risk Analysis for Iris Yellow Spot Virus. Online publication. Central Science Laboratory, Sand Hutton, UK, 2007.

Download Full-text

First Report of Tomato yellow ring virus (Tospovirus, Bunyaviridae) Infecting Tomato in Kenya

Plant Disease ◽

10.1094/pdis-05-12-0462-pdn ◽

2012 ◽

Vol 96 (9) ◽

pp. 1384-1384 ◽

Cited By ~ 8

Author(s):

R. Birithia ◽

S. Subramanian ◽

J. Villinger ◽

J. W. Muthomi ◽

R. D. Narla ◽

...

Keyword(s):

Disease Incidence ◽

Consensus Sequence ◽

N Gene ◽

Fars Province ◽

Spot Virus ◽

First Report ◽

Thrips Species ◽

Tomato Isolate ◽

Potato Isolate ◽

Das Elisa

Tomato (Lycoperscion esculentum) is one of the most popular vegetables and a major source of nutrition and income for smallholders in Africa. Thrips-transmitted tospoviruses are among the economically important pathogens of tomatoes that cause significant crop losses worldwide (3). In surveys for Tomato spotted wilt virus (TSWV) in the major tomato production areas of Kenya between March 2010 and January 2012, tomato fruits with chlorotic ring spots on fruits with stem and leaf necrosis were observed frequently. The symptoms were more evident in the dry seasons and disease incidence ranged from 28 to 42%. The pathogen did not react with antiserum specific to TSWV (Agdia Biofords, Ervy, France) in double-antibody sandwich (DAS)-ELISA. Furthermore, the pathogen did not react with antiserum specific to Capsicum chlorosis virus (CaCV), Chrysanthemum stem necrosis virus (CSNV), Groundnut ring spot virus (GRSV), Impatiens necrotic spot virus (INSV), Iris yellow spot virus (IYSV), and Watermelon silver mottle virus (WSMoV) (Agdia Biofords and DSMZ, Germany) in DAS-ELISA, but reacted positively to antiserum specific to Tomato yellow fruit ring virus (TYFRV) (DSMZ, AS0526). The nucleocapsid (N) gene specific primers (TFfor: 5′-ACTCATTAAAATGCATCGTTCT-3′ and TFrev: 5′-CTAAGTAAACACCATGGCTACC-3′ as forward and reverse primers, respectively) were designed by choosing six conserved regions of the N gene sequences of known TYFRV and Tomato yellow ring virus (TYRV) sequences available from GenBank. Using these primers, TYRV infection of tomatoes collected from Loitokitok, Kenya (2.73°S, 37.51°E) was confirmed by reverse transcription (RT)-PCR. PCR products of approximately 912-bp were obtained from six out of 11 symptomatic tomato samples tested, but not from healthy and water controls. Amplicons were gel-purified using QuickClean II Gel Extraction Kit (GenScript, UK) and sequenced using TFfor and TFrev primers. A consensus sequence was generated using Geneious Pro 5.5.6 Software (Biomatters Ltd., Auckland, NZ). The BLAST revealed that the N-gene sequence of the Kenyan tomato isolate (GenBank Accession No. JQ955615) had sequence identity with the Cineraria isolate (98.5%) (Accession No. DQ788693.1) and the Anemone isolate (98.1%) (Accession No. DQ788694.1) of TYRV (4) from Fars Province, Iran; an Alstroemeria isolate (98.4%) (Accession No. HQ154130.1) and two tomato isolates (98.3%) (Accession Nos. HQ154131.1 and AY686718.1) of TYRV from northern Khorasan Province, Iran, and a tomato isolate (98.1%) (Accession No. AJ493270.1) of TYFRV from Varamin, Iran. The Kenyan tomato isolate differed from a TYFRV potato isolate (87.5%) from Iran (Accession No. EU126931.1) (1), a TYRV potato isolate (87.5%) from Iran (Accession No. JF836812.1); a soybean isolate of TYRV (87.4%) from Iran (Accession No. DQ462163.1) (2), and showed significant divergence from that of Polygonum ringspot virus from Italy (81%) (Accession No. EF445397.1). To our knowledge, this is the first report of TYRV infecting tomatoes in Kenya. Further surveys and monitoring of TYRV incidence and distribution in the region, vector competence of thrips species, and impact on the crop yield are in progress. References: (1) A. R. Golnaraghi et al. Plant Dis. 92:1280, 2008. (2) A. Hassani-Mehraban et al. Arch. Virol. 152:85, 2007. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) R. Rasoulpour and K. Izadpanah, Austral. Plant Pathol. 36:285, 2007.

Download Full-text

First Report of Iris yellow spot virus Infection of Garlic and Egyptian Leek in Egypt

Plant Disease ◽

10.1094/pdis-10-11-0902 ◽

2012 ◽

Vol 96 (4) ◽

pp. 594-594 ◽

Cited By ~ 6

Author(s):

E. E. Hafez ◽

A. A. Abdelkhalek ◽

A. A. El-Morsi ◽

O. A. El-Shahaby

Keyword(s):

Plant Species ◽

Natural Infection ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

Sri Lankan ◽

Spot Virus ◽

Viral Pathogen ◽

First Report ◽

Sequence Identity ◽

Das Elisa

Egyptian leek (Allium ampeloprasum), garlic (A. sativum), and onion (A. cepa) are key vegetables produced by small- and large-scale farmers in Egypt for national and international markets. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). During February and March of 2011, symptoms of spindle-shaped, straw-colored, irregular lesions with occasional green islands were observed on onion, garlic, and Egyptian leek cultivated on large and small farms in Dakahlia, Gharbia, Kalubia, Menofia, Qena, and Assiut governorates in Egypt. The presence of IYSV was confirmed by specific double antibody sandwich (DAS)-ELISA Flash Kits (Agdia Inc., Elkhart, IN) (2). A survey was carried out by collecting 100 plant samples (10 asymptomatic and 90 symptomatic) of each plant species from fields in the governorates of Dakahlia, Gharbia, Kalubia, Menofia, Qena, and Assiute and testing the plants using DAS-ELISA. For onion and garlic, 45% of the symptomatic samples and 0% of the asymptomatic plants tested positive. For leek, 34% of the symptomatic samples tested positive and 0% of the asymptomatic samples. ELISA-positive samples were tested using a reverse transcription (RT)-PCR assay with primers specific to the S RNA of IYSV (forward primer 5′-TAAAACAAACATTCAAACAA-3′ and reverse primer 5′-CTCTTAAACACATTTAACAAGCAC-3′) (2). Amplicons of approximately 1,100 bp were obtained from all symptomatic samples that were ELISA positive, but none of the asymptomatic plants nor the sterile water control sample produced PCR amplicons. The amplicons were cloned (at least three clones per plant species) using the TOPO TA Cloning Kit (Invitrogen, Grand Island, NY), and sequenced. The Egyptian onion IYSV isolate (GenBank No. JN541273) had the greatest nucleotide sequence identity (86%) with the corresponding S RNA region of IYSV isolates from India (GenBank Nos. EU310290, EU310284, and EU310276). The Egyptian garlic IYSV isolate (GenBank No. JN541275) showed the strongest identity (93%) with that of a Sri Lankan IYSV isolate (GenBank No. GU901211). The Egyptian leek IYSV isolate (GenBank No. JN541274) exhibited 91% sequence identity with that of the same Sri Lankan isolate (No. GU901211). To our knowledge, this is the first report of IYSV infecting garlic and Egyptian leek in Egypt. IYSV infection of onion was reported previously from the agricultural farm of the Faculty of Agriculture, Cairo University, Giza (4), but to our knowledge, this is the first report of natural infection by the virus in commercial onion production in Egypt. Further surveys and monitoring of IYSV incidence and distribution in the entire Egyptian governorate are under investigation. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) A. Manal et al. Egypt. J. Virol. 3:49, 2006.

Download Full-text

First Report of Iris yellow spot virus Infecting Onion in Pennsylvania

Plant Disease ◽

10.1094/pdis-03-12-0254-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 1

Author(s):

C. A. Hoepting ◽

M. F. Fuchs

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Nucleotide Sequence Identity ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

First Report ◽

Sequence Identity ◽

Das Elisa

Iris yellow spot virus (IYSV; genus Tospovirus; family Bunyaviridae) is an economically important pathogen of onion. It is vectored by onion thrips (Thrips tabaci Lindeman) and causes widespread disease of onion in all major onion growing states in the western United States (1). In the eastern United States, IYSV was first reported in Georgia in 2004 (4) and then in New York in 2006 (2). In mid-July of 2010, symptomatic onion (Allium cepa) plants (cv. Candy) were found in New Holland, Pennsylvania, in Lancaster County on a small, diversified commercial farm (40.06°N, 76.06°W). Bleached, elongated lesions with tapered ends occurred on middle-aged leaves on approximately 30% of the 13,760 plants in an area approximately one tenth of an acre. Leaf tissue from five symptomatic plants tested positive for IYSV in a double-antibody sandwich (DAS)-ELISA with IYSV-specific serological reagents from Agdia Inc. (Elkhart, IN). A reverse transcription (RT)-PCR assay was used to verify the presence of IYSV in a subset of symptomatic leaf samples that reacted to IYSV antibodies in DAS-ELISA. Primers specific to the nucleocapsid (N) gene of IYSV (5′-ACTCACCAATGTCTTCAAC-3′ and 5′-GGCTTCCTCTGGTAAGTGC-3′) were used to characterize a 402-bp fragment (3). The resulting amplicons were ligated in TOPO TA cloning vector (Invitrogen, Carlsbad, CA) and two clones of each isolate were sequenced in both directions. Sequence analysis showed a consensus sequence for the partial N gene of the five IYSV isolates from Pennsylvania (GenBank Accession No. JQ952568) and an 87 to 100% nucleotide sequence identity with other IYSV N gene sequences that are available in GenBank. The highest nucleotide sequence identity (100%) was with an IYSV isolate from Texas (GenBank Accession No. DQ658242) and the lowest was with an isolate from India (GenBank Accession No. EU310291). To our knowledge, this is the first report of IYSV infection of onion in Pennsylvania. This finding confirms further spread of the virus within North America. Further study is warranted to determine the impact of IYSV on the Pennsylvania onion industry and to determine viable management strategies, if necessary. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004 (2) C. A. Hoepting et al. Plant Dis. 91:327, 2007 (3) C. L. Hsu et al. Plant Dis. 95:735-743. (4) S. W. Mullis et al. Plant Dis. 88: 1285, 2004.

Download Full-text

First Report of Iris yellow spot virus on Garlic in India

Plant Disease ◽

10.1094/pdis-94-8-1066c ◽

2010 ◽

Vol 94 (8) ◽

pp. 1066-1066 ◽

Cited By ~ 9

Author(s):

S. J. Gawande ◽

A. Khar ◽

K. E. Lawande

Keyword(s):

Natural Infection ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

First Report ◽

Qiagen Gmbh ◽

The World ◽

Seed Crops

Garlic (Allium sativum) is a spice crop of prime importance in India as well as other parts of the world. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important pathogen of onion bulb and seed crops in many parts of the world (3). The virus is also known to infect garlic and other Allium spp. (2–4). IYSV infection of garlic was reported from Reunion Island (4) and the United States (1). In February 2010, straw-colored, spindle-shaped spots with poorly defined ends were observed on the leaves of a garlic crop at the research farm of the Directorate of Onion and Garlic Research in the Pune District of Maharashtra State, India, 105 days after planting. The spots coalesced to form larger patches on the leaves, suggesting possible IYSV infection. Symptoms were visible on older leaves and more prevalent on cv. G-41, G-282, AC50, AC200, AC283, and Godavari than on other cultivars. The incidence of symptomatic plants was estimated at 5% for G-41 and AC-200, 8% for G-282 and AC283, and 10% for AC50. Leaves were sampled from 40 symptomatic plants per cultivar with each sample composited from young, middle, and older (basal) leaves of the plant. Samples were assayed by double-antibody sandwich-ELISA (Loewe Biochemica GmbH, Sauerlach, Germany) and each tested positive for the virus. Total RNA was extracted from the leaves of ELISA-positive plants using the RNAeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany) and tested by reverse transcription-PCR assay using primers IYSV-F (5′-TCAGAAATCGAGAAACTT-3′) and IYSV-R (5′-TAATTATATCTATCTTTCTTGG-3′) (2) designed to amplify 797 bp of the nucleocapsid (N) gene of IYSV. Amplicons of expected size were obtained and cloned into a pDrive vector (Qiagen GmbH). The recombinant clone was sequenced (GenBank Accession No. HM173691). Sequence comparisons showed 98 to 100% nt identity with other IYSV N gene sequences in GenBank (Nos. EU310294 and EU310286). A phylogenetic analysis of the deduced amino acid sequences of the N gene showed that the garlic isolate of IYSV grouped most closely with onion IYSV isolates from India (GenBank Nos. EU310294, EU310286, EU310300, and EU310296). To our knowledge, this is the first report of natural infection of garlic by IYSV in India. Additional surveys and evaluations are needed to obtain a better understanding of the potential impact of IYSV on garlic production in India. References: (1) S. Bag et al. Plant Dis. 93:839, 2009. (2) A. Bulajic et al. Plant Dis. 93:976, 2009. (3) D. Gent et al. Plant Dis. 90:1468, 2006. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Download Full-text