scholarly journals First Report of Iris yellow spot virus Infecting Onion in Pakistan

Plant Disease ◽  
2013 ◽  
Vol 97 (11) ◽  
pp. 1517-1517 ◽  
Author(s):  
R. Iftikhar ◽  
S. Bag ◽  
M. Ashfaq ◽  
H. R. Pappu
Keyword(s):  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Spot Virus ◽  
Viral Pathogen ◽  
Widespread Occurrence ◽  
First Report ◽  
Allium Cepa L ◽  
Seed Crops ◽  
Agricultural Organization

Onion (Allium cepa L.) is an important vegetable crop in Pakistan. According to the Food and Agricultural Organization (FAO), Pakistan is the world's fifth largest onion producer. The area and production is 127.8 thousand hectares and 1.7 million tons, respectively, with a yield of 13.8 tons per hectare during 2012. The agro-ecological diversity in the country enables onion production almost year round. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus), transmitted principally by Thrips tabaci, is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). During March to May 2012, as part of a survey for tospoviruses in vegetables, symptoms suspected to be caused by IYSV were observed on bulb and seed onions grown in farmers' fields in Faisalabad, Nankana, Sheikhupura, and Sialkot districts of Punjab. Symptoms consisted of spindle-shaped, straw colored, irregular chlorotic lesions with occasional green islands on the leaves. Approximately 60% of the fields surveyed had about 30% of the plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific ELISA kit (Bioreba). IYSV infection was verified by RT-PCR with primers IYSV-F (TAAAACAAACATTCAAACAA) and IYSV-R (CTCTTAAACACATTTAACAAGCA) as forward and reverse primers, respectively. Amplicons of approximately 1,100 bp were obtained from the symptomatic samples, but not from healthy and water controls. The amplicons were cloned and sequenced. The IYSV-Pakistan isolates (GenBank Accession Nos. KF171103, KF171104, and KF171105) had the highest nucleotide sequence identity of 99% with the corresponding region of an IYSV isolate from Chile (DQ150107). To our knowledge, this is the first report of IYSV infecting onion in Pakistan. The relatively widespread occurrence of IYSV underscores the need for systematic surveys to assess its incidence and impact on onion bulb and seed crops so that appropriate management tactics can be developed. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 94:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Iris yellow spot virus in Onion in Mauritius

Plant Disease ◽  
2010 ◽  
Vol 94 (11) ◽  
pp. 1373-1373 ◽  
Author(s):  
K. Lobin ◽  
A. Saison ◽  
B. Hostachy ◽  
S. P. Benimadhu ◽  
H. R. Pappu
Keyword(s):  
Disease Incidence ◽  
Consensus Sequence ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Das Elisa

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by thrips (Thrips tabaci Lindeman) is an economically important viral pathogen of bulb and seed onion (Allium cepa) crops in many onion-growing areas of the world (2,3). In Africa, IYSV has been reported in Reunion (4) and South Africa (1). In June 2008, diamond-shaped lesions that are typical of IYSV were observed on onion seed scapes in an onion plot of 0.25 ha at Reduit in the central part of Mauritius. Disease incidence was 80% with a severity of 50 to 75% of the scape surface area. Lodging was observed in 25% of the symptomatic plants. Twenty-two symptomatic plants were tested and found to be positive for IYSV when tested by double antibody sandwich (DAS)-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). The presence of the virus was confirmed by reverse transcription (RT)-PCR tests with primers 917L: 5′-TAAAACTTAACTAACACAAA-3′ and 56U: 5′-TCCTAAGTATTCACCAT-3′ as forward and reverse primers, respectively, for specific sequences flanking the CP gene. Another set of primers specific to the small (S) RNA of IYSV (5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTT AACAAGCAC-3′) produced an amplicon of approximately 1.2 kb that includes the 772-bp nucleocapsid (N) gene. The 1.2-kb amplicon was cloned and four clones were sequenced and consensus sequence was used for comparisons. Sequence analysis showed that the N gene of the IYSV isolate from Mauritius (GenBank Accession No. HM218822) shared the highest nucleotide sequence identity (99%) with several known IYSV N gene sequences (Accession Nos. FJ785835 and AM900393) available in the GenBank, confirming the presence of IYSV in the onion crops in Mauritius. A survey was subsequently carried out from July to November 2008 in major onion-growing localities at La Marie, Henrietta, Reduit, and Plaine Sophie (center); Bassin, La Ferme, and La Chaumiere (west); Grand Sable, Petit Sable, and Plaisance (south, southeast); and Belle Mare, Trou d'Eau Douce, and Palmar (east) to monitor the distribution of the disease on the island. Symptomatic samples with diamond-to-irregularly shaped lesions were observed and 155 symptomatic and 35 nonsymptomatic samples were collected and screened by DAS-ELISA for IYSV and Tomato spotted wilt virus (TSWV), another tospovirus reported to infect onion elsewhere. Sixty-six percent of the symptomatic samples screened (102 of 155) tested positive for IYSV. No IYSV was detected in the symptomless samples. There was no serological indication of TSWV infection in the samples. Samples that tested positive for IYSV were collected from Belle mare, Palmar, and Trou d'eau douce in the east and La Ferme in the west. Cultivars infected were Gandiole, Local Red, and Veronique. No IYSV was detected in the bulbs. The vector, T. tabaci, was observed in infected onion parcels surveyed and is known to occur in all onion-producing areas of the island. To our knowledge, this is the first report of IYSV in onion in Mauritius. Further surveys and monitoring of IYSV incidence, along with its impact on the yield, need to be established. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Iris yellow spot virus Infecting Green Onion in Indonesia

Plant Disease ◽  
2013 ◽  
Vol 97 (12) ◽  
pp. 1665-1665 ◽  
Author(s):  
H. R. Pappu ◽  
A. Rauf
Keyword(s):  
Consensus Sequence ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Fta Cards ◽  
Field Samples

Green onion (Allium fistulosum L.) is an important vegetable crop for small-holder farmers for domestic consumption in Indonesia. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by Thrips tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). In Asia, IYSV has been reported in India and Sri Lanka (2,4). In April 2013, symptoms suspected to be caused by IYSV were observed on a 1-month-old green onion crop grown for their leaves in a farmer's field in Cipendawa, Pacet, Cianjur District, West Java. Symptoms consisted of elliptical to spindle-shaped, straw colored, irregular, chlorotic lesions with occasional green islands on the leaves. Approximately 25% of the field had plants with these symptoms. The presence of the virus was confirmed with an IYSV-specific Agdia Flash kit. IYSV infection was confirmed by RT-PCR with primers specific to the nucleoprotein (N) gene of IYSV. Primers 465c: 5′-AGCAAAGTGAGAGGACCACC-3′ and IYSV-239f: 5′ TGAGCCCCAATCAAGACG3′ (3) were used as forward and reverse primers, respectively, using total nucleic acids eluted from FTA cards that were previously coated with freshly prepared sap extracts from field samples. Amplicons of approximately 240 bp were obtained from four symptomatic plants tested but not from healthy and water controls. The amplicons were cloned and sequenced. Consensus sequence was derived from three clones. Comparison with IYSV N gene sequences available in GenBank showed sequence identity of 95 to 99% confirming the identity of the virus as IYSV. To our knowledge, this is the first report of IYSV infecting onion in Indonesia. The finding in Java underscores the need for conducting surveys in Java as well as other onion-growing regions of Indonesia to gain a better understanding of its incidence, distribution, and potential impact. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) B. Mandal et al. Plant Dis. 96:468, 2012. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) K. S. Ravi et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Iris yellow spot virus on Garlic in India

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1066-1066 ◽  
Author(s):  
S. J. Gawande ◽  
A. Khar ◽  
K. E. Lawande
Keyword(s):  
Natural Infection ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Spot Virus ◽  
First Report ◽  
Qiagen Gmbh ◽  
The World ◽  
Seed Crops

Garlic (Allium sativum) is a spice crop of prime importance in India as well as other parts of the world. Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) is an important pathogen of onion bulb and seed crops in many parts of the world (3). The virus is also known to infect garlic and other Allium spp. (2–4). IYSV infection of garlic was reported from Reunion Island (4) and the United States (1). In February 2010, straw-colored, spindle-shaped spots with poorly defined ends were observed on the leaves of a garlic crop at the research farm of the Directorate of Onion and Garlic Research in the Pune District of Maharashtra State, India, 105 days after planting. The spots coalesced to form larger patches on the leaves, suggesting possible IYSV infection. Symptoms were visible on older leaves and more prevalent on cv. G-41, G-282, AC50, AC200, AC283, and Godavari than on other cultivars. The incidence of symptomatic plants was estimated at 5% for G-41 and AC-200, 8% for G-282 and AC283, and 10% for AC50. Leaves were sampled from 40 symptomatic plants per cultivar with each sample composited from young, middle, and older (basal) leaves of the plant. Samples were assayed by double-antibody sandwich-ELISA (Loewe Biochemica GmbH, Sauerlach, Germany) and each tested positive for the virus. Total RNA was extracted from the leaves of ELISA-positive plants using the RNAeasy Plant Mini kit (Qiagen GmbH, Hilden, Germany) and tested by reverse transcription-PCR assay using primers IYSV-F (5′-TCAGAAATCGAGAAACTT-3′) and IYSV-R (5′-TAATTATATCTATCTTTCTTGG-3′) (2) designed to amplify 797 bp of the nucleocapsid (N) gene of IYSV. Amplicons of expected size were obtained and cloned into a pDrive vector (Qiagen GmbH). The recombinant clone was sequenced (GenBank Accession No. HM173691). Sequence comparisons showed 98 to 100% nt identity with other IYSV N gene sequences in GenBank (Nos. EU310294 and EU310286). A phylogenetic analysis of the deduced amino acid sequences of the N gene showed that the garlic isolate of IYSV grouped most closely with onion IYSV isolates from India (GenBank Nos. EU310294, EU310286, EU310300, and EU310296). To our knowledge, this is the first report of natural infection of garlic by IYSV in India. Additional surveys and evaluations are needed to obtain a better understanding of the potential impact of IYSV on garlic production in India. References: (1) S. Bag et al. Plant Dis. 93:839, 2009. (2) A. Bulajic et al. Plant Dis. 93:976, 2009. (3) D. Gent et al. Plant Dis. 90:1468, 2006. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

scholarly journals First Report of Onion (Allium cepa) Naturally Infected with Iris yellow spot virus in Peru

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 377-377 ◽  
Author(s):  
S. W. Mullis ◽  
R. D. Gitaitis ◽  
C. Nischwitz ◽  
A. S. Csinos ◽  
Z. C. Rafael Mallaupoma ◽  
...  
Keyword(s):  
The United States ◽  
Thrips Tabaci ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Enzyme Linked Immunosorbent Assay ◽  
Spot Virus ◽  
First Report ◽  
The Impact ◽  
Das Elisa

Onions have become an important export crop for Peru during the last few years. The onions produced for export are primarily short-day onions and include Grano- or Granex-type sweet onions. The first of two growing seasons for onion in Peru occurs from February/March until September/October and the second occurs from September/October to December/January. Iris yellow spot virus (IYSV [family Bunyaviridae, genus Tospovirus]), primarily transmitted by onion thrips (Thrips tabaci), has been reported in many countries during recent years, including the United States (1,2). In South America, the virus was reported in Brazil during 1999 (3) and most recently in Chile during 2005 (4). During 2003, an investigation of necrotic lesions and dieback in onions grown near the towns of Supe and Ica, Peru led to the discovery of IYSV in this region. Of 25 samples of symptomatic plants collected from five different fields near Supe, 19 tested strongly positive and an additional three tested weakly positive for IYSV using double antibody sandwich-enzyme linked immunosorbent assay (DAS-ELISA) (Agdia Inc., Elkhart, IN). None of the samples tested positive for Tomato spotted wilt virus (TSWV). A number of onions with necrosis and dieback symptoms were also observed during 2004 and 2005. During September 2005, 25 plants with symptoms suspected to be caused by IYSV or TSWV in the Supe and Casma valleys were collected and screened for both viruses using DAS-ELISA. All plants screened were positive for IYSV. There was no serological indication of TSWV infection in these samples. The positive samples were blotted onto FTA cards (Whatman Inc., U.K.) to bind the viral RNA for preservation and processed according to the manufacturer's protocols. The presence of IYSV was verified by reverse transcription-polymerase chain reaction (RTPCR) using (5′-TCAGAAATCGAGAAACTT-3′) and (5′-TAATTATATCTATCTTTCTTGG-3′) as forward and reverse primers (1), respectively. The primers amplify the nucleocapsid (N) gene of IYSV, and the RT-PCR products from this reaction were analyzed with gel electrophoresis with an ethidium bromide stain in 0.8% agarose to verify the presence of this amplicon in the samples. Subsequent to the September 2005 sampling, 72 additional samples from regions in northern and southern Peru were analyzed in the same manner. The amplicons obtained were cloned, sequenced, and compared with known IYSV isolates for further verification. Onions have become a significant export crop for Peru, and more research is needed to determine the impact of IYSV on the Peruvian onion export crop. To our knowledge, this is the first report of IYSV in onion in Peru. References: (1) L. du Toit et al. Plant Dis. 88:222, 2004. (2) S. W. Mullis et al. Plant Dis. 88:1285, 2004. (3) L. Pozzer et al. Plant Dis. 83:345, 1999. (4) M. Rosales et al. Plant Dis. 89:1245, 2005.

scholarly journals First Report of Iris yellow spot virus Infecting Onion in Kenya and Uganda

Plant Disease ◽  
2011 ◽  
Vol 95 (9) ◽  
pp. 1195-1195 ◽  
Author(s):  
R. Birithia ◽  
S. Subramanian ◽  
H. R. Pappu ◽  
P. Sseruwagi ◽  
J. W. Muthomi ◽  
...  
Keyword(s):  
Sri Lanka ◽  
Nucleotide Sequence ◽  
Nucleotide Sequence Identity ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Sequence Identity ◽  
Small Holder

Onion (Allium cepa L.) is one of the key vegetables produced by small-holder farmers for the domestic markets in Sub-Saharan Africa. Biotic factors, including infestation by thrips pests such as Thrips tabaci Lindeman, can inflict as much as 60% yield loss. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) transmitted by T. tabaci is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (2,4). In Africa, IYSV has been reported in Reunion (1) and South Africa (3). In September 2009, symptoms suspected to be caused by IYSV were observed on onions and leeks cultivated in Nairobi, Kenya. Symptoms consisted of spindle-shaped, straw-colored, irregular chlorotic lesions with occasional green islands on the leaves. The presence of the virus was confirmed with IYSV-specific Agdia Flash kits (Agdia Inc., Elkart, IN). Subsequently, surveys were undertaken in small-holder farms in onion production areas of Makueni (January 2010) and Mwea (August 2010) in Kenya and Kasese (January 2010) and Rwimi (January 2010) in Uganda. The incidence of disease in these locations ranged between 27 and 72%. Onion leaves showing symptoms of IYSV infection collected from both locations tested positive for the virus by double-antibody sandwich-ELISA with IYSV-specific antiserum (Agdia Inc). IYSV infection was confirmed by reverse transcription-PCR with primers IYSV-465c: 5′-AGCAAAGTGAGAGGACCACC-3′ and IYSV-239f: 5′-TGAGCCCCAATCAAGACG3′ (3) as forward and reverse primers, respectively. Amplicons of approximately 240 bp were obtained from all symptomatic test samples but not from healthy and water controls. The amplicons were cloned and sequenced from each of the sampled regions. Consensus sequence for each isolate was derived from at least three clones. The IYSV-Kenya isolate (GenBank Accession No. HQ711616) had the highest nucleotide sequence identity of 97% with the corresponding region of IYSV isolates from Sri Lanka (GenBank Accession No. GU901211), followed by the isolates from India (GenBank Accession Nos. EU310287 and EU310290). The IYSV-Uganda isolate (GenBank Accession No. HQ711615) showed the highest nucleotide sequence identity of 95% with the corresponding region of IYSV isolates from Sri Lanka (GenBank Accession No. GU901211) and India (95% with GenBank Accession Nos. EU310274 and EU310297). To our knowledge, this is the first report of IYSV infecting onion in Kenya and Uganda. Further surveys and monitoring of IYSV incidence and distribution in the region, along with its impact on the yield, are under investigation. References: (1) L. J. du Toit et al. Plant Dis. 91:1203, 2007. (2) D. H. Gent et al. Plant Dis. 88:446, 2004. (3) H. R. Pappu et al. Plant Dis 92:588, 2008. (4) H. R. Pappu et al. Virus Res. 141:219, 2009.

scholarly journals First Report of Iris yellow spot virus Infection of Garlic and Egyptian Leek in Egypt

Plant Disease ◽  
2012 ◽  
Vol 96 (4) ◽  
pp. 594-594 ◽  
Author(s):  
E. E. Hafez ◽  
A. A. Abdelkhalek ◽  
A. A. El-Morsi ◽  
O. A. El-Shahaby
Keyword(s):  
Plant Species ◽  
Natural Infection ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Sri Lankan ◽  
Spot Virus ◽  
Viral Pathogen ◽  
First Report ◽  
Sequence Identity ◽  
Das Elisa

Egyptian leek (Allium ampeloprasum), garlic (A. sativum), and onion (A. cepa) are key vegetables produced by small- and large-scale farmers in Egypt for national and international markets. Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an economically important viral pathogen of bulb and seed onion crops in many onion-growing areas of the world (1,3). During February and March of 2011, symptoms of spindle-shaped, straw-colored, irregular lesions with occasional green islands were observed on onion, garlic, and Egyptian leek cultivated on large and small farms in Dakahlia, Gharbia, Kalubia, Menofia, Qena, and Assiut governorates in Egypt. The presence of IYSV was confirmed by specific double antibody sandwich (DAS)-ELISA Flash Kits (Agdia Inc., Elkhart, IN) (2). A survey was carried out by collecting 100 plant samples (10 asymptomatic and 90 symptomatic) of each plant species from fields in the governorates of Dakahlia, Gharbia, Kalubia, Menofia, Qena, and Assiute and testing the plants using DAS-ELISA. For onion and garlic, 45% of the symptomatic samples and 0% of the asymptomatic plants tested positive. For leek, 34% of the symptomatic samples tested positive and 0% of the asymptomatic samples. ELISA-positive samples were tested using a reverse transcription (RT)-PCR assay with primers specific to the S RNA of IYSV (forward primer 5′-TAAAACAAACATTCAAACAA-3′ and reverse primer 5′-CTCTTAAACACATTTAACAAGCAC-3′) (2). Amplicons of approximately 1,100 bp were obtained from all symptomatic samples that were ELISA positive, but none of the asymptomatic plants nor the sterile water control sample produced PCR amplicons. The amplicons were cloned (at least three clones per plant species) using the TOPO TA Cloning Kit (Invitrogen, Grand Island, NY), and sequenced. The Egyptian onion IYSV isolate (GenBank No. JN541273) had the greatest nucleotide sequence identity (86%) with the corresponding S RNA region of IYSV isolates from India (GenBank Nos. EU310290, EU310284, and EU310276). The Egyptian garlic IYSV isolate (GenBank No. JN541275) showed the strongest identity (93%) with that of a Sri Lankan IYSV isolate (GenBank No. GU901211). The Egyptian leek IYSV isolate (GenBank No. JN541274) exhibited 91% sequence identity with that of the same Sri Lankan isolate (No. GU901211). To our knowledge, this is the first report of IYSV infecting garlic and Egyptian leek in Egypt. IYSV infection of onion was reported previously from the agricultural farm of the Faculty of Agriculture, Cairo University, Giza (4), but to our knowledge, this is the first report of natural infection by the virus in commercial onion production in Egypt. Further surveys and monitoring of IYSV incidence and distribution in the entire Egyptian governorate are under investigation. References: (1) D. H. Gent et al. Plant Dis. 88:446, 2004. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) A. Manal et al. Egypt. J. Virol. 3:49, 2006.

scholarly journals Iris yellow spot virus in Onion Seed Crops in South Africa

Plant Disease ◽  
2007 ◽  
Vol 91 (9) ◽  
pp. 1203-1203 ◽  
Author(s):  
L. J. du Toit ◽  
J. T. Burger ◽  
A. McLeod ◽  
M. Engelbrecht ◽  
A. Viljoen
Keyword(s):  
South Africa ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Western Cape ◽  
Spot Virus ◽  
Total Rna ◽  
Onion Seed ◽  
Seed Crops ◽  
Np Gene

In December 2006, symptoms typical of iris yellow spot caused by Iris yellow spot virus (IYSV; genus Tospovirus, family Bunyaviridae) were observed on scapes (seed stalks) in an onion (Allium cepa L.) seed crop in the Klein Karoo of the Western Cape Province, South Africa. Symptoms included diamond-shaped chlorotic or necrotic lesions on the scapes, some of which had ‘green-islands’ with nested diamond-shaped lesions, as well as indistinct, circular to irregular, chlorotic or necrotic lesions of various sizes. At the time symptoms were observed, approximately 5% of the scapes had lodged as a result of extensive lesions resembling those caused by IYSV. The crop was 2 to 3 weeks from harvest. Symptomatic tissue from two plants (two samples from one plant and four samples from the other plant) was tested for IYSV by reverse-transcriptase (RT)-PCR. Total RNA was extracted from symptomatic scape tissue with the SV Total RNA Isolation System (Promega, Madison, WI) according to the manufacturer's instructions. First strand cDNA was synthesized with the RevertAid H Minus First Strand cDNA Synthesis kit (Fermentas Inc., Hanover, MD), followed by PCR amplification with primers IYSV-For (TGG YGG AGA TGY RGA TGT GGT) and IYSV-Rev (ATT YTT GGG TTT AGA AGA CTC ACC), which amplify the nucleocapsid (NP) gene of IYSV. An amplicon of expected size (approximately 750 bp) was observed for each of the symptomatic plants assayed and was sequenced. Comparison of the sequence (GenBank Accession No. EF579801) with GenBank sequences revealed 95% sequence identity with the NP gene of IYSV GenBank Accession No. EF419888, with eight amino acid differences. The known geographic distribution of IYSV in onion bulb or seed crops has increased rapidly in recent years in many areas of the world (1). To our knowledge, this is the first confirmation of IYSV in South Africa. Approximately 6,100 ha of onion bulb crops are grown annually in South Africa in the Western Cape, Kwazulu Natal, Limpopo, and Northern Cape provinces, and 600 ha of onion seed crops are grown primarily in the semi-arid regions of the Western Cape. Examination of an additional 10 onion seed crops in the Klein Karoo during January 2007 revealed the presence of iris yellow spot in three more crops at approximately 5% incidence in each crop. The four symptomatic crops had all been planted as bulb-to-seed crops, using vernalized bulbs produced on the same farm. This suggests that IYSV may have been disseminated into the seed crops on the vernalized bulbs, either as infected bulb tissue or in viruliferous thrips on the bulbs. Reference: (1) D. H. Gent et al. Plant Dis. 90:1468, 2006.

scholarly journals First Report of Iris yellow spot virus on Onion and Leek in Western Oregon

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 468-468 ◽  
Author(s):  
D. H. Gent ◽  
R. R. Martin ◽  
C. M. Ocamb
Keyword(s):  
United States ◽  
Disease Incidence ◽  
The United States ◽  
Yellow Spot ◽  
Onion Bulb ◽  
Spot Virus ◽  
First Report ◽  
Seed Crop ◽  
Onion Seed ◽  
Seed Crops

Onion (Allium cepa) and leek (Allium porrum) are grown on approximately 600 ha in western Oregon annually for bulb and seed production. During July and August of 2006, surveys of onion bulb crops and onion and leek seed crops in western Oregon found plants with symptoms of elongated to diamond-shaped, straw-colored lesions characteristic of those caused by Iris yellow spot virus (IYSV) (1–4). Symptomatic plants were collected from fields of an onion bulb crop, an onion seed crop, and two leek seed crops located in Marion County. The onion bulb crop had been planted in the spring of 2006, and the onion and leek seed crops had been planted in the fall of 2005, all direct seeded. Cultivar names were not provided for proprietary purposes. Symptomatic plants in the onion bulb crop and leek seed crop generally were found near the borders of the field. Disease incidence was less than 5% and yield losses in these crops appeared to be negligible. In the onion seed crop, symptomatic plants were found throughout the field and disease incidence was approximately 20%. Approximately 1% of the onion plants in this field had large necrotic lesions that caused the seed stalks (scapes) to lodge. The presence of IYSV was confirmed from symptomatic leaves and scapes by ELISA (Agdia Inc., Elkhart, IN) using antiserum specific to IYSV. RNA was extracted from symptomatic areas of onion leaves and scapes, and a portion of the nucleocapsid gene was amplified by reverse transcription-PCR. The amplicons were sequenced and found to share more than 99% nucleotide and amino acid sequence identity with an onion isolate of IYSV from the Imperial Valley of California (GenBank Accession No. DQ233475). In the Pacific Northwest region of the United States, IYSV has been confirmed in the semi-arid regions of central Oregon (1), central Washington (2), and the Treasure Valley of eastern Oregon and southwest Idaho (3). To our knowledge, this is the first report of the disease on a host crop in the mild, maritime region west of the Cascade Mountain Range and the first report of IYSV on leek seed crops in the United States, which complements a simultaneous report of IYSV on commercial leek in Colorado. The presence of IYSV may have implications for the iris and other ornamental bulb industries in western Oregon and western Washington. This report underscores the need for further research to determine the impact of the disease on allium crops and other hosts and the development of effective management programs for IYSV and the vector, Thrips tabaci. References: (1) F. J. Crowe and H. R. Pappu. Plant Dis. 89:105, 2005. (2) L. J. du Toit et al. Plant Dis. 88:222, 2004. (3) J. M. Hall et al. Plant Dis. 77:952, 1993. (4) H. F. Schwartz et al. Plant Dis. 91:113, 2007.

Sign in / Sign up

Export Citation Format

Share Document