First Report of Catharanthus mosaic virus in Mandevilla in the United States

Mandevilla (Apocynaceae) is an ornamental tropical vine popular for its bright and attractive flowers. During 2012 to 2013, 12 Mandevilla sp. samples from Minnesota and Florida nurseries were submitted for analysis at the University of Minnesota Plant Disease Clinic. Plants showed mosaic symptoms, leaf deformation, premature leaf senescence, and vine dieback. Filamentous virus particles with modal lengths 700 to 900 nm were observed by transmission electron microscopy (TEM) in partially purified preparations from symptomatic leaves. Partially purified virions were obtained using 30% sucrose cushion centrifuged at 109,000 gmax for 2 h at 10°C (5). No other virus particles were observed in these samples, nor were any observed in non-symptomatic samples. One sample was submitted as potted plant (Mandevilla ‘Sunmandeho’ Sun Parasol Giant White) and was kept under greenhouse conditions for subsequent analyses. Total RNA (Qiagen) was extracted from this sample, and Potyvirus was detected using the universal primers Poty S (5′-GGN AAY AAY AGY GGN CAR CC-3′) and PV1 (5′-20(T)V-3′) (1) by reverse transcription (RT)-PCR (3). The amplified product was the expected ~1.7-kb, corresponding to the partial nuclear inclusion body gene, the coat protein (CP) gene, and the 3′ end untranslated region. The RT-PCR amplicon was cloned (NEB) and sequenced, and the 1,720-bp consensus sequence was deposited in GenBank (Accession No. KM243928). NCBI BLAST analysis at the nucleotide level revealed highest identity (83%) with an isolate of Catharanthus mosaic virus (CatMV) from Brazil (Accession No. DQ365928). Pairwise analysis of the predicted 256 amino acid CP revealed 91% identity with the CatMV Brazilian isolate (ABI94824) and 68% or less identity with other potyviruses. Two potyviruses are usually considered the same species if their CP amino acid sequences are greater than 80% identical (2). Serological analysis of the infected sample Mandevilla ‘Sunmandeho’ Sun Parasol Giant White using a CatMV specific antiserum (4) resulted in positive indirect ELISA reactions. CatMV has been previously reported in periwinkle (Catharanthus roseus) in Brazil (4). Based on the analyses by TEM, RT-PCR, nucleotide and amino acid sequence identities, and serological reactivity, we identify this virus as a U.S. Mandevilla isolate of CatMV. To our knowledge, this is the first report of Catharanthus mosaic virus both in the United States and in Mandevilla. References: (1) J. Chen et al. Arch Virol. 146:757, 2001. (2) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (3) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (4) S. C. Maciell et al. Sci. Agric. Piracicaba, Brazil. 68:687, 2011. (5) D. Mollov et al. Arch Virol. 158:1917, 2013.

Download Full-text

First Report of Apium virus Y on Cilantro, Celery, and Parsley in California

Plant Disease ◽

10.1094/pdis-92-8-1254b ◽

2008 ◽

Vol 92 (8) ◽

pp. 1254-1254 ◽

Cited By ~ 7

Author(s):

T. Tian ◽

H.-Y. Liu ◽

S. T. Koike

Keyword(s):

Mosaic Virus ◽

Consensus Sequence ◽

Amino Acid Sequences ◽

Apium Graveolens ◽

Petroselinum Crispum ◽

Rt Pcr ◽

First Report ◽

Virus Particles ◽

Pcr Products ◽

Reverse Primer

Recently, Apium virus Y (ApVY) was detected in field-grown cilantro (Coriandrum sativum), celery (Apium graveolens), and parsley (Petroselinum crispum) in California. In 2003, cilantro plants growing in three different fields in California (Monterey, San Joaquin, and San Luis Obispo counties) expressed symptoms of mosaic, vein clearing, and stunting. When plant sap was examined by transmission electron microscopy, flexuous, rod-shaped virus particles were observed. Total RNA was extracted from the symptomatic cilantro plants and used as a template in reverse transcription (RT)-PCR using universal potyvirus primers according to Chen et al. (1). The RT-PCR product was cloned into pGEM-T (Promega, Madison, WI) and the insert of 1,713 bp was sequenced (GenBank Accession No. EU515125). Nucleotide sequences from clones derived from three different infected cilantro plants were 89 to 97% identical to ApVY sequences encoding partial sequence of polyprotein in GenBank (Accession Nos. AY049716, EU127499, AF207594, AF203529, and EU255632). In 2007, celery plants showing necrotic line patterns and necrotic lesions on lower leaves and petioles were observed in several fields in two coastal counties in California (Monterey and Santa Clara counties). Flexuous, rod-shaped virus particles were also observed in the sap of those plants. ELISA for Cucumber mosaic virus and RT-PCR for Celery mosaic virus were negative. ApVY specific primers were designed on the basis of a consensus sequence of ApVY identified from cilantro in 2003; reverse primer 5′-GGCTCTTGCTATAGACAAATAGT-3′ and forward primer 5′-GAAGACCAAGCCAATGTGTGTA-3′. The sequence of RT-PCR products (GenBank Accession No. EU515126) amplified from infected celery had 90 to 98% nucleotide identity to ApVY. When the deduced amino acid sequences of NIb and CP regions from both cilantro and celery were used for comparison, they showed 95 to 99% identity with the known ApVY GenBank sequences mentioned above. More than 10 asymptomatic parsley plants growing in fields adjacent to the infected celery were also tested for ApVY and found to be infected. ApVY was previously identified in three Apiaceae weeds in Australia (2) and in celery in New Zealand (3). To our knowledge, this is the first report of ApVY on cilantro, celery, and parsley in California. References: (1) J. Chen et al. Arch. Virol. 146:757, 2001. (2) J. Moran et al. Arch. Virol. 147:1855, 2002. (3) J. Tang et al. Plant Dis. 91:1682, 2007.

Download Full-text

First report of dasheen mosaic virus infecting taro (Colocasia esculenta) in Louisiana

Plant Disease ◽

10.1094/pdis-04-21-0854-pdn ◽

2021 ◽

Author(s):

Cesar Escalante ◽

David Galo ◽

Rodrigo Diaz ◽

Rodrigo Valverde

Keyword(s):

United States ◽

Mosaic Virus ◽

Consensus Sequence ◽

The United States ◽

Colocasia Esculenta ◽

Rt Pcr ◽

Serological Tests ◽

First Report ◽

Pcr Products ◽

The University

Taro [Colocasia esculenta (L.) Schott], also called dasheen or malanga is an important staple crop in many tropical and subtropical countries (Chaïr et al. 2016). In October 2020, taro plants showing foliar symptoms consisting of mosaic, feathery mottle, and vein clearing patterns were observed in the Hilltop Arboretum, the Bluebonnet Swamp Nature Center, the Louisiana State University Agricultural Center Botanic Gardens, and the University Lake, in Baton Rouge, Louisiana. Unidentified aphids were also observed infesting the plants showing the described symptoms. From each location, two foliar samples from symptomatic and two from asymptomatic plants were collected and tested by ELISA using antiserum for general potyvirus group (Agdia, Elkhart, IN). Seven of eight symptomatic samples tested positive while the asymptomatic samples were negative. The seven positive samples were used to perform an additional ELISA test using antiserum specific for dasheen mosaic virus (DsMV) (Agdia). All seven samples tested positive for DsMV. To confirm the identity of the virus, total RNA was extracted from the seven samples using the PureLink® Plant RNA Reagent Kit (Invitrogen, Carlsbad, CA). After DNA digestion with PerfeCta® DNase I (Qiagen, Beverly, MA), the RNA was used to perform reverse transcription polymerase chain reaction (RT-PCR) with primer set DMV 5708-5731-F/DMV 6131-6154-R which is specific for DsMV (Wang et al. 2017). RT-PCR was performed using the AccessQuickTM RT-PCR System (Promega, Madison, WI) following the reaction conditions described by Wang et al. PCR products of the expected size (~447 bp) were obtained with all seven samples and were Sanger-sequenced. A consensus sequence (MW284936) was obtained with the two sequences from samples collected at the University Lake and aligned with other sequences available in the GenBank using BLASTn. Our isolate of DsMV showed 90.6% nt identity to an isolate of DsMV from Ethiopia (MG602229). Mechanical inoculations to healthy taro plants were conducted using leaf tissue of symptomatic plants as source of inoculum. Inoculated plants exhibited mosaic symptoms three weeks after inoculation and were ELISA-positive for DsMV. Symptomatology, serological tests, RT-PCR testing, and DNA sequencing of RT-PCR products support that the symptomatic taro plants were infected with DsMV. Taro is a crop in Hawaii, but in the contiguous United States, it is mostly grown as an ornamental and is considered an invasive species. Its distribution is restricted to the southern continental states and Hawaii (Cozad et al. 2018). CABI, EPPO (1998) lists the presence of DsMV in several states of the United States, including Louisiana; however, there is no record in the literature of the identification of this virus in Louisiana. The potential impact of DsMV in taro and related ornamental species in southern United States is unknown. To the best of our knowledge, this is the first report documenting DsMV infecting taro in Louisiana.

Download Full-text

First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Plant Disease ◽

10.1094/pdis-92-4-0648a ◽

2008 ◽

Vol 92 (4) ◽

pp. 648-648 ◽

Cited By ~ 3

Author(s):

R. L. Jordan ◽

M. A. Guaragna ◽

T. Van Buren ◽

M. L. Putnam

Keyword(s):

United States ◽

Amino Acid ◽

Mosaic Virus ◽

The United States ◽

Cdna Clones ◽

Gene Products ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

First Report

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

First Report of Beet necrotic yellow vein virus on Red Table Beet in Brazil

Plant Disease ◽

10.1094/pdis-10-14-1045-pdn ◽

2015 ◽

Vol 99 (3) ◽

pp. 423-423 ◽

Cited By ~ 4

Author(s):

J. A. M. Rezende ◽

V. M. Camelo ◽

D. Flôres ◽

A. P. O. A. Mello ◽

E. W. Kitajima ◽

...

Keyword(s):

Amino Acid ◽

Sugar Beet ◽

Hairy Root ◽

Contaminated Soil ◽

The United States ◽

Amino Acid Sequences ◽

Yellow Vein ◽

Polymyxa Betae ◽

Rt Pcr ◽

First Report

Beet necrotic yellow vein virus (BNYVV) is an economically important pathogen of sugar beet (Beta vulgaris var. saccharifera) in several European, and Asian countries and in the United States (3). The virus is transmitted by the soil-inhabiting plasmodiophorid Polymyxa betae and causes the rhizomania disease of sugar beet. In November 2012, plants of B. vulgaris subsp. vulgaris cv. Boro (red table beet) exhibiting mainly severe characteristic root symptom of rhizomania were found in a commercial field located in the municipality of São José do Rio Pardo, State of São Paulo, Brazil. No characteristic virus-inducing foliar symptom was observed on diseased plants. The incidence of diseased plants was around 70% in the two visited crops. As the hairy root symptom is indicative of infection by BNYVV, the present study aimed to detect and identify this virus associated with the diseased plants. Preliminary leaf dip analysis by transmission electron microscopy revealed the presence of very few benyvirus-like particles. Total RNA was extracted from roots of three symptomatic plants and one asymptomatic plant according to Toth et al. (3). One-step reverse-transcription–polymerase chain reaction (RT-PCR) was performed as described by Morris et al. (2) with primers that amplify part of the coat protein gene at RNA2. The initial assumption that the hairy root symptom was associated with BNYVV infection was confirmed by the amplification of a fragment of ~500 bp from all three symptomatic samples. No amplicon was obtained from the asymptomatic control plant. Amplicons were directly sequenced, and the consensus nucleotide and deduced amino acid sequences showed 100% identity. The nucleotide sequence for one amplicon (Accession No. KM433683) was compared with other sequences deposited in GenBank. The nucleotide (468 nt) and deduced amino acid (156 aa) sequences shared 93 to 100 and 97 to 99% identity, respectively with the corresponding nucleotide and amino acid sequences for other isolates of type A of BNYVV. The virus was transmitted to three of 10 red table beet plants inoculated with contaminated soil, and infection was confirmed by nested RT-PCR, as described by Morris et al. (1), and nucleotide sequencing. This is the first report on the occurrence of BNYVV in Brazil, which certainly will affect the yield of red table beet in the producing region. Therefore, mapping of the occurrence of BNYVV in red table beet-producing areas in Brazil for containment of the spread of the virus is urgent. In the meantime, precautions should be taken to control the movement of contaminated soil and beet roots, carrots, or any vegetable grown on infested land that might introduce the virus to still virus-free regions. References: (1) J. Morris et al. J. Virol. Methods 95:163, 2001. (2) D. D. Sutic et al. Handbook of Plant Virus Diseases. CRC Press, Boca Raton, Florida, 1999. (3) I. K. Toth et al. Methods for the Detection and Quantification of Erwinia carotovora subsp. atroseptica (Pectobacterium carotovorum subsb. atrosepticum) on Potatoes: A Laboratory Manual. Scottish Crop Research Institute, Dundee, Scotland, 2002.

Download Full-text

First Report of Cucumber green mottle mosaic virus on Melon in the United States

Plant Disease ◽

10.1094/pdis-02-14-0176-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1163-1163 ◽

Cited By ~ 35

Author(s):

T. Tian ◽

K. Posis ◽

C. J. Maroon-Lango ◽

V. Mavrodieva ◽

S. Haymes ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

Seed Production ◽

Citrullus Lanatus ◽

The United States ◽

Rt Pcr ◽

First Report ◽

Rigid Rod ◽

Yolo County ◽

Das Elisa

In July 2013, a melon (Cucumis melo var. Saski) field in Yolo County, California, was inspected as part of a phytosanitary inspection for seed production. The leaves of the plants showed mosaic, green mottle, and blotches. When plant sap was examined using a transmission electron microscope, rigid rod-shaped particles were observed. Melon plant samples were analyzed by both CDFA and USDA APHIS PPQ laboratories and tested positive using DAS-ELISA against Cucumber green mottle mosaic virus (CGMMV) (Agdia, Elkhart, IN). To confirm the presence of CGMMV, total RNA was analyzed by RT-PCR using primers CGMMV-F5370 5′-CTAATTATTCTGTCGTGGCTGCGGATGC-3′ and CGMMV-R6390 5′-CTTGCAGAATTACTGCCCATA-3′ designed by PPQ based on 21 genomic sequences of CGMMV found worldwide. The 976-bp amplicon was sequenced (GenBank Accession No. KJ453559) and BLAST analysis showed the sequence was 95% identical to MP and CP region of CGMMV isolates reported from Russia (GQ495274, FJ848666), Spain (GQ411361), and Israel (KF155231), and 92% to the isolates from China (KC852074), Korea (AF417243), India (DQ767631), and Japan (D12505). These analyses confirm the virus was CGMMV. To our knowledge, this is the first report of CGMMV in the United States. Based on our sequence data, a second set of primers (CGMMV-F5796 5′-TTGCGTTTAGTGCTTCTTATGT-3′ and CGMMV-R6237 5′-GAGGTGGTAGCCTCTGACCAGA-3′), which amplified a 440-bp amplicon from CGMMV CP region, was designed and used for testing all the subsequent field and seed samples. Thirty-seven out of 40 randomly collected Saski melon samples tested positive for CGMMV, suggesting the virus was widespread in the field. All the melon samples also tested positive for Squash mosaic virus (SqMV) using DAS-ELISA (Agdia). Therefore, the symptoms observed likely resulted from a mixed infection. The melon field affected by CGMMV was immediately adjacent to fields of cucumber (Cucumis sativus var. Marketmore 76) and watermelon (Citrullus lanatus var. Sugar Baby) crops, both for seed production with no barrier between the crops. CGMMV was also detected from symptomatic plants from both fields. Seed lots used for planting all three crops were tested and only the melon seed was positive for CGMMV, suggesting the seed as the source of infection. The sequenced 440-bp RT-PCR amplicons from CGMMV-infected cucumber and watermelon plants and melon seeds were 99% identical to the CGMMV from the field melon. A cucumber plant infected with CGMMV but not SqMV was used for mechanical inoculation at the Contained Research Facility at University of California, Davis. Inoculated cucumber, melon, and watermelon plants showed green mottle and mosaic similar to that observed in the field. CGMMV is a highly contagious virus and damage by this virus on cucurbit crops has been reported in regions where CGMMV is present (2). CGMMV was detected on cucumber grown in greenhouses in Canada with 10 to 15% yield losses reported due to this virus (1). The three cucurbit crops in Yolo County were planted in an isolated area with no other cucurbits nearby. Measures, including destroying all the cucurbit plant material, have been taken to eradicate the virus. Use of CGMMV free cucurbit seed is necessary for prevention of this disease. References: (1) K.-S. Ling et al. Plant Dis. 98:701, 2014. (2) J. Y. Yoon et al. J. Phytopathol. 156:408, 2008.

Download Full-text

First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽

10.1094/pdis-05-13-0500-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1664-1664 ◽

Cited By ~ 3

Author(s):

B. Babu ◽

H. Dankers ◽

S. George ◽

D. Wright ◽

J. Marois ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

The United States ◽

Turnip Mosaic Virus ◽

Brassica Carinata ◽

Rt Pcr ◽

First Report ◽

Ethiopian Mustard ◽

Plant Pathol ◽

Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

Download Full-text

First Report of Grapevine leafroll-associated virus 5 in Spain

Plant Disease ◽

10.1094/pdis-07-10-0508 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1507-1507 ◽

Cited By ~ 4

Author(s):

C. V. Padilla ◽

E. Cretazzo ◽

I. Hita ◽

N. López ◽

V. Padilla ◽

...

Keyword(s):

United States ◽

Amino Acid ◽

The United States ◽

Amino Acid Identity ◽

Wine Industry ◽

Rt Pcr ◽

Acid Identity ◽

First Report ◽

Virus Indexing ◽

Homologous Genes

Grapevine leafroll-associated viruses (GLRaVs) cause significant reductions in yield and quality in the wine industry worldwide. At least nine different GLRaVs have been found in different regions of the world. In the process of virus indexing of candidate grapevine clones for certification, which includes grafting of scions onto rootstocks, we observed strong leafroll symptoms 1 year after grafting with one vine of cv. Estaladina in Castilla y León, Spain and one vine of cv. Tempranillo in La Rioja, Spain, collected in 2008 and 2007, respectively. Both vines tested positive by real-time reverse transcription (RT)-PCR with TaqMan probes specific for Grapevine leafroll-associated virus 5 and double-antibody sandwich (DAS)-ELISA with a mix of monoclonal antibodies that recognizes GLRaV-4, 5, 6, 7, and 9 (Bioreba, Reinach, Switzerland). RNA extracts of both GLRaV-5 positive vines were analyzed by conventional RT-PCR with a pair of consensus degenerated primers derived from GLRaV-5 hsp70 sequences available in GenBank: LR5HYF (5′-TGGGATGAAYAARTTCAATGC-3′) and LR5HYR (5′-TGAAATTCCTCATRTARGAGC-3′) that amplified a 250-bp fragment. Amplicons were cloned and the comparison of the amino acid sequences (Estaladina isolate, Est110: Accession No. HM208622; Tempranillo isolate, Tem020: Accession No. HM208618) showed in the case of the Est110 isolate, 100 and 82.6% identity, respectively, with the homologous genes of one GLRaV-5 isolate from the United States (AF233934 [3]) and Argentina (EU815935 [2]). For isolate Tem020, the hsp70 gene showed 97.1 and 81.2% amino acid identity with the homologous hsp70 genes of the United States and Argentina isolates. The coat protein (cp) genes of both isolates were also amplified and cloned using the specific GLRaV-5 primers, LR53413 (5′-CGTGATACAAGGTAGGACAACCGT-3′) and LR53843 (5′-CTTGCACTATCGCTGCCGTGAAT-3′), designed according to the sequence of AF233934. Fragments were of the expected size (430 bp) and the nucleotide sequences were obtained (Est110: Accession No. HM363522; Tem020: Accession No. HM363523) and used for pairwise nucleotide comparisons. The Est110 isolate showed 96.7 and 97.5% amino acid identity with the isolates from the United States and Argentina, respectively, while the Tem020 isolate showed 94.8 and 95.6% identity, respectively. Amino acid identity of Est110 and Tem020 cp genes was 100% when compared with the homologous genes of isolates AF233934 and EU815935. To our knowledge this is the first report of GRLaV-5 in Spain. Since 2008, we have detected eight additional vines positive for this virus in 200 clones analyzed for certification, suggesting that the incidence of GLRaV-5 in Spain could be widespread. This research indicates that virus indexing for GLRaV should be included in certification schemes for grapevine candidate clones (1) in Spain. References: (1) Anonymous. OEPP/EPPO Bull. 38:422, 2008. (2) S. Gomez Talquenca et al. Virus Genes 38:184, 2009. (3) F. Osman et al. J. Virol. Methods 141:22, 2007.

Download Full-text

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽

10.1094/pdis.2004.88.8.907b ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 18

Author(s):

J. D. Postman ◽

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

North America ◽

Consensus Sequence ◽

The United States ◽

Ringspot Virus ◽

Yellow Vein ◽

Cdna Clones ◽

Meristem Culture ◽

Rt Pcr ◽

First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Download Full-text

First Report of Plantago asiatica mosaic virus in Imported Asiatic and Oriental Lilies (Lilium hybrids) in the United States

Plant Disease ◽

10.1094/pdis-08-14-0792-pdn ◽

2015 ◽

Vol 99 (2) ◽

pp. 292-292 ◽

Cited By ~ 8

Author(s):

J. Hammond ◽

D. Bampi ◽

M. D. Reinsel

Keyword(s):

United States ◽

The Netherlands ◽

Mosaic Virus ◽

Consensus Sequence ◽

Chenopodium Quinoa ◽

The United States ◽

Rt Pcr ◽

Protein Amino Acid ◽

Lily Symptomless Virus ◽

Plantago Asiatica

Asiatic and Oriental hybrid lilies (Lilium sp., Liliaceae) are bulbous ornamentals valued for their flowers. Bulbs of several varieties of each lily type, imported from the Netherlands, were purchased in spring 2013 from retail nurseries and grown in a cool greenhouse; additional bulbs were obtained in 2014. After flowering in 2013, but prior to leaf senescence, necrotic streaking was observed in midstem leaves of several plants. RNA extracted from leaves of several individual plants was subjected to reverse-transcription–polymerase chain reaction (RT-PCR) assay using NSNC-odT primed cDNA and PCR with primers PxDeg/BNSNC or potyS/BNSNC to amplify potexvirus/carlavirus and potyvirus products respectively (2,3,4). Sequencing of a c. 1.7-kb PCR product from one lily identified Lily symptomless virus (LSV). Mechanical inoculation of pooled lily leaf samples to Nicotiana benthamiana, N. glutinosa, and Chenopodium quinoa (not hosts of LSV) yielded chlorotic or necrotic local lesions on C. quinoa and systemic mosaic with necrotic spotting, streaking, or apical necrosis on N. benthamiana; electron microscopy revealed potexvirus-like flexuous particles. RT-PCR from C. quinoa and N. benthamiana with PxDeg/BNSNC yielded a c. 1.3-kb product, which was cloned and sequenced; the consensus sequence (KM205357) had 98.7% nucleotide identity to a Dutch isolate of Plantago asiatica mosaic virus (PlAMV, KF471012; 78.5 to 87.8% to other isolates), and 99.0% coat protein amino acid identity to KF471012 (88.9 to 93.2% to other isolates). The 2013 lilies were stored overwinter at 4°C, and RNA was extracted from roots of individual bulbs. Primers PlAMV CP-F2 (TTCGTCACCCTCAGCGG) and PlAMV CP-R3 (AAACGGTAAAATACACACCGGG) were designed based on alignment of KM205357 with all PlAMV sequences available in GenBank. RT-PCR using PlAMV CP-F2/CP-R3 yielded products of the expected 511 bp from 20 bulbs and no product from a no-template control. ELISA of root and bulbscale samples using PlAMV-lily specific antibody and conjugate (a gift of R. Miglino, BKD, The Netherlands) confirmed PlAMV in seven of 20 bulbs positive by RT-PCR. Bioassay of PCR-positive lilies on N. benthamiana, C. quinoa, and Tetragonia expansa confirmed infection in three out of eight by both symptoms and ELISA. Altogether nine out of 13 Asiatic lilies (four of four cultivars: America, Connecticut King, Grand Cru, and Pink Pixie) and 11 Oriental lilies (cvs. Stargazer and Starfighter) were found to be infected with PlAMV by RT-PCR, of which seven were confirmed by bioassay and/or ELISA. Bulbs obtained in 2014 were tested only by ELISA; five of 18 Asiatic lilies (three of six cultivars: Connecticut King, Crimson Pixie, and Yellow Electric) and three of 13 Oriental lilies (three of six cultivars: Anastasia, Casa Blanca, and Garden Party) were found to be infected. PlAMV was reported in lilies in the Netherlands in 2010, with losses of up to 80% in greenhouse cut-flower production (1). The Nandina mosaic isolate (PlAMV-NMV) has been known in the United States since 1976 (5), but PlAMV infection of lily has not previously been documented in the United States. Both RT-PCR and ELISA tests also detected PlAMV-NMV. The degree of damage observed in the Netherlands suggests that growers should seek bulb stocks free of PlAMV. References: (1) Anonymous. https://www.vwa.nl/txmpub/files/?p_file_id=2001424 , accessed June 11, 2014. (2) S. Chen et al. Acta Biochim. Biophys. Sin. 43:465, 2011. (3) J. Hammond et al. Arch. Virol. 151:477, 2006. (4) J. Hammond and M. Reinsel. Acta Hort. 901:119, 2011. (5) P. Moreno et al. Proc. Am. Phytopathol. Soc. 3:319, 1976.

Download Full-text