Characterization and Mapping of retr04, retr05 and retr06 Broad-Spectrum Resistances to Turnip Mosaic Virus in Brassica juncea, and the Development of Robust Methods for Utilizing Recalcitrant Genotyping Data

Turnip mosaic virus (TuMV) induces disease in susceptible hosts, notably impacting cultivation of important crop species of the Brassica genus. Few effective plant viral disease management strategies exist with the majority of current approaches aiming to mitigate the virus indirectly through control of aphid vector species. Multiple sources of genetic resistance to TuMV have been identified previously, although the majority are strain-specific and have not been exploited commercially. Here, two Brassica juncea lines (TWBJ14 and TWBJ20) with resistance against important TuMV isolates (UK 1, vVIR24, CDN 1, and GBR 6) representing the most prevalent pathotypes of TuMV (1, 3, 4, and 4, respectively) and known to overcome other sources of resistance, have been identified and characterized. Genetic inheritance of both resistances was determined to be based on a recessive two-gene model. Using both single nucleotide polymorphism (SNP) array and genotyping by sequencing (GBS) methods, quantitative trait loci (QTL) analyses were performed using first backcross (BC1) genetic mapping populations segregating for TuMV resistance. Pairs of statistically significant TuMV resistance-associated QTLs with additive interactive effects were identified on chromosomes A03 and A06 for both TWBJ14 and TWBJ20 material. Complementation testing between these B. juncea lines indicated that one resistance-linked locus was shared. Following established resistance gene nomenclature for recessive TuMV resistance genes, these new resistance-associated loci have been termed retr04 (chromosome A06, TWBJ14, and TWBJ20), retr05 (A03, TWBJ14), and retr06 (A03, TWBJ20). Genotyping by sequencing data investigated in parallel to robust SNP array data was highly suboptimal, with informative data not established for key BC1 parental samples. This necessitated careful consideration and the development of new methods for processing compromised data. Using reductive screening of potential markers according to allelic variation and the recombination observed across BC1 samples genotyped, compromised GBS data was rendered functional with near-equivalent QTL outputs to the SNP array data. The reductive screening strategy employed here offers an alternative to methods relying upon imputation or artificial correction of genotypic data and may prove effective for similar biparental QTL mapping studies.

Nuclear Exportin 1 (XPO1) Binds to the Nuclear Localization/Export Signal of the Turnip Mosaic Virus NIb to Promote Viral Infection

The nuclear localization signal (NLS) and nuclear export signal (NES) are key signatures of proteins for controlling nuclear import and export. The NIb protein of turnip mosaic virus (TuMV) is an RNA-dependent RNA polymerase (RdRP) that is absolutely required for viral genome replication. Previous studies have shown that NIb is a nucleocytoplasmic shuttling protein and contains four putative NES and four putative NLS motifs. Here, we analyzed the function of these NESs and NLSs, and identified two functional NESs and one functional NLS. Mutation of the identified functional NESs or NLS inhibited viral RNA accumulation and systemic infection. Exportin 1 (XPO1) is a nuclear export receptor that binds directly to cargo proteins harboring a leucine-rich NES and translocates them to the cytoplasm. We found that XPO1 contains two NIb-binding domains, which recognize the NLS and NES of NIb, respectively, to mediate the nucleocytoplasmic transport of NIb and promote viral infection. Taken together, these data suggest that the nucleocytoplasmic transport of NIb is modulated by XPO1 through its interactions with the functional NLS and NES of NIb to promote viral infection.

Turnip mosaic virus P1 suppresses JA biosynthesis by degrading cpSRP54 that delivers AOCs onto the thylakoid membrane to facilitate viral infection

Jasmonic acid (JA) is a crucial hormone in plant antiviral immunity. Increasing evidence shows that viruses counter this host immune response by interfering with JA biosynthesis and signaling. However, the mechanism by which viruses affect JA biosynthesis is still largely unexplored. Here, we show that a highly conserved chloroplast protein cpSRP54 was downregulated in Nicotiana benthamiana infected by turnip mosaic virus (TuMV). Its silencing facilitated TuMV infection. Furthermore, cpSRP54 interacted with allene oxide cyclases (AOCs), key JA biosynthesis enzymes, and was responsible for delivering AOCs onto the thylakoid membrane (TM). Interestingly, TuMV P1 protein interacted with cpSRP54 and mediated its degradation via the 26S proteosome and autophagy pathways. The results suggest that TuMV has evolved a strategy, through the inhibition of cpSRP54 and its delivery of AOCs to the TM, to suppress JA biosynthesis and enhance viral infection. Interaction between cpSRP54 and AOCs was shown to be conserved in Arabidopsis and rice, while cpSRP54 also interacted with, and was degraded by, pepper mild mosaic virus (PMMoV) 126 kDa protein and potato virus X (PVX) p25 protein, indicating that suppression of cpSRP54 may be a common mechanism used by viruses to counter the antiviral JA pathway.

The Effects of Turnip Mosaic Virus Infections on the Deposition of Secondary Cell Walls and Developmental Defects in Arabidopsis Plants Are Virus-Strain Specific

Two isolates of Turnip mosaic virus (UK 1 and JPN 1), representative of two different viral strains, induced differential alterations on secondary cell wall (SCW) development in Arabidopsis thaliana, suggesting cell-type specific effects of these viral infections. These potential effects were analyzed in inflorescence stems and flowers of infected plants, together with other possible cellular effects of the infections. Results obtained from macroscopic and histochemical analyses showed that infection with either virus significantly narrowed stem area, but defects in SCW were only found in JPN 1 infections. In flowers, reduced endothecium lignification was also found for JPN 1, while UK 1 infections induced severe floral cell and organ development alterations. A transcriptomic analysis focused on genes controlling and regulating SCW formation also showed notable differences between both viral isolates. UK 1 infections induced a general transcriptional decrease of most regulatory genes, whereas a more complex pattern of alterations was found in JPN 1 infections. The role of the previously identified viral determinant of most developmental alterations, the P3 protein, was also studied through the use of viral chimeras. No SCW alterations or creeping habit growth were found in infections by the chimeras, indicating that if the P3 viral protein is involved in the determination of these symptoms, it is not the only determinant. Finally, considerations as to the possibility of a taxonomical reappraisal of these TuMV viral strains are provided.

Construction of Full-Length Infectious Clones of Turnip Mosaic Virus Isolates Infecting Perilla Frutescens and Genetic Analysis of Recently Emerged Strains of Tumv in Korea

Perilla is an annual herb with a unique aroma and taste and has been cultivated in Korea for hundreds of years. Owing to the highly edible and medicinal value of Perilla plants, it has been widely cultivated in many Asian and European countries. Recently, several viruses have been reported to cause diseases in Perilla in Korea, including turnip mosaic virus (TuMV) which is known as a brassica pathogen due to its significant damage to brassica crops. In this study, we determined the complete genome sequences of two new TuMV isolates originating from Perilla in Korea. Full-length infectious cDNA clones of these two isolates were constructed and their infectivity was tested by agroinfiltration on Nicotiana benthamiana and sap inoculation on Chinese cabbage and radish. In addition, we analyzed the phylogenetic relationship of six new Korean TuMV isolates and determined their respective affiliation with the four major groups. We also conducted recombination analysis for isolates recently occurring in Korean using RDP4 software, which provided new insight into the evolutionary relationships among Korean isolates of TuMV.

The potyviral protein 6K1 reduces plant protease activity during Turnip mosaic virus infection

Potyviral genomes encode just 11 major proteins and multifunctionality is associated to most of these proteins at different stages of virus life cycle. The potyviral protein 6K1 is required for potyvirus replication at the early stages of viral infection and may mediate cell-to-cell movement at later stages.Our study demonstrates that the 6K1 protein from Turnip mosaic virus (TuMV) reduces the abundance of transcripts related to jasmonic acid biosynthesis and transcripts that encode cysteine protease inhibitors when expressed in trans in Nicotiana benthamiana relative to controls. Furthermore, 6K1 stability increases when lipoxygenase and cysteine protease activity is inhibited chemically, linking a mechanism to the rapid turnover of 6K1 when expressed in trans. Using transient expression, we show 6K1 is degraded rapidly at early time points in the infection process, whereas at later stages of infection protease activity is reduced and 6K1 becomes more stable, resulting in higher TuMV accumulation in systemic leaves. There was no impact of 6K1 transient expression on TuMV accumulation in local leaves. Together, these results suggest a novel function for the TuMV 6K1 protein which has not been reported previously and enhances our understanding of the complex interactions occurring between plants and potyviruses.

Construction of Full-length Infectious cDNA Clones of Two Korean Isolates of Turnip Mosaic Virus Breaking Resistance in Brassica Napus

In this work, two new Turnip mosaic virus (TuMV) strains (Canola-12 and Canola-14) overcoming resistance in canola (Brassica napus) were isolated from a B. napus sample which showed typical TuMV-like symptoms and was collected from Gimcheon city, South Korea in 2020. Complete genomes and infectious clones of each isolate were obtained. Phylogenetic analysis indicated that the strains isolated from canola belonged to the World-B group. Both infectious clones which were driven by 35S and T7 promoters induced systemic symptoms on Nicotiana benthamiana and B. napus. To our knowledge, this is the first report of TuMV infecting B. napus in South Korea.

First Report of Turnip Mosaic Virus in Peanut (Arachis hypogaea L.) in China

Peanut (Arachis hypogaea L.) is an important source of edible oil in China but its yield and quality in agricultural production are affected by a number of diseases including those caused by viruses. The four viruses most commonly reported to affect the production of peanut worldwide are peanut stripe virus, cucumber mosaic virus, peanut stunt virus and peanut bud necrosis virus (Srinivasan et al. 2017; Xu et al. 2017). During a disease survey in June 2020, virus-like disease symptoms including mosaic and necrotic spots were observed in field peanut plants in Yuyao county, Zhejiang, China (Supplementary Fig S1). These symptoms differed from those caused by the four major peanut viruses (Dunoyer et al. 2020; Srinivasan et al. 2017; Takahashi et al. 2018; Xu et al. 2017). To identify the putative viral agent(s) associated with the virus-like disease in these plants, leaves from six plants in the same field were collected, pooled and subjected to high throughput RNA-Seq sequencing (HTS). The TruSeq RNA Sample Preparation Kit (Illumina, California, USA) was used to construct cDNA library according to the manufacturer’s instructions. An Illumina NovaSeq 6000 platform (Illumina) with PE150 bp and CLC Genomic Workbench 11 (QIAGEN) was used for sequencing and data analysis. After data collection and analysis, a total of 18,592 contigs were generated from de novo assembly of the clean paired-end reads (35,935,936). After comparing with sequences deposited in GenBank using BLASTn, four assembled contigs (ranging from 4,969 to 8,937 nt in length) were found to share 94.9%-95.9% identity to the turnip mosaic virus (TuMV, genus Potyvirus). No other virus sequences were detected in the data. To confirm the presence of TuMV and to obtain its full-length sequence, total RNA was extracted from a single plant selected from initial sample pool by using the plant RNA extraction KIT (Aidlab, Beijing, China). Five primer pairs (Supplementary Table 1), which were anticipated to result in overlapping amplicons covering all but the 5’-end of the genome, were designed based on the TuMV contig sequences and the complete nucleotide sequence of TuMV was subsequently amplified by the reverse transcription polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE) using the commercial SUPERSWITCH™ 5’RACE cDNA Kit (Tiosbio, Beijing, China). All the PCR products were subsequently cloned into pEASY®-T5 Zero (TransGen Biotech, Beijing, China), and three clones of each fragment were randomly selected and sequenced by Sanger sequencing at Ykang (Ykang, Hangzhou, China). The complete sequence of the TuMV isolate (designated isolate Ningbo) was deposited in GenBank under accession number MZ062212. BLASTn analysis showed that TuMV-Ningbo shared a sequence identity of 96.0% with a Brassica isolate of TuMV in China (HQ446216) and 95.9% with a Brassica isolate in the Czech Republic (LC537547). Phylogenetic analysis grouped the three into a cluster (Supplementary Fig S2), suggesting Ningbo as a member of the world-B Group (Kawakubo et al. 2021). A western blot analysis of leaf sap using a TuMV CP antibody prepared by our laboratory (unpublished data) confirmed the presence of TuMV in all of the samples used for the HTS analysis. Peanut and Nicotiana benthamiana plants growing in the green house were also mechanically inoculated with peanut leaf sap obtained from one of samples. Seven days after inoculation, mosaic and leaf curing symptoms were observed on inoculated plants and the infection of TuMV was subsequently confirmed by RT-PCR (primers TuMV-CP: 5'- GCAGGTGAAACGCTTGATGC -3' and 5'- CAACCCCTGAACGCCCAGTA-3') and western blot assay. In contrast, no symptoms nor TuMV were detected in the mock-inoculated plants. TuMV is an important pathogen of brassica crops and is known to have a worldwide host range. However, to our knowledge, this is the first report of TuMV infection in peanut in China and the finding suggests that the threat of TuMV should be considered when interplanting peanuts and cruciferous vegetables, as in common in this region of China.