scholarly journals First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
J. D. Postman ◽  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North America ◽  
Consensus Sequence ◽  
The United States ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Cdna Clones ◽  
Meristem Culture ◽  
Rt Pcr ◽  
First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

scholarly journals First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 463-463 ◽  
Author(s):  
I. E. Tzanetakis ◽  
J. D. Postman ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Ringspot Virus ◽  
Tobacco Streak Virus ◽  
Rapid Decline ◽  
Streak Virus ◽  
Black Raspberry ◽  
Rt Pcr ◽  
Indicator Plants ◽  
First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

scholarly journals First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease ◽  
2004 ◽  
Vol 88 (2) ◽  
pp. 223-223 ◽  
Author(s):  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
South Carolina ◽  
The United States ◽  
Cdna Clones ◽  
Broad Host Range ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Beet Pseudo Yellows Virus ◽  
Symptomatic Plant

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAGATGTCCRCTAATGATA 3′) that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004.

scholarly journals First Report of Catharanthus mosaic virus in Mandevilla in the United States

Plant Disease ◽  
2015 ◽  
Vol 99 (1) ◽  
pp. 165-165 ◽  
Author(s):  
D. Mollov ◽  
M. A. Guaragna ◽  
B. Lockhart ◽  
J. A. M. Rezende ◽  
R. Jordan
Keyword(s):  
United States ◽  
Amino Acid ◽  
Mosaic Virus ◽  
Consensus Sequence ◽  
The United States ◽  
Amino Acid Sequences ◽  
Universal Primers ◽  
Rt Pcr ◽  
First Report ◽  
Virus Particles

Mandevilla (Apocynaceae) is an ornamental tropical vine popular for its bright and attractive flowers. During 2012 to 2013, 12 Mandevilla sp. samples from Minnesota and Florida nurseries were submitted for analysis at the University of Minnesota Plant Disease Clinic. Plants showed mosaic symptoms, leaf deformation, premature leaf senescence, and vine dieback. Filamentous virus particles with modal lengths 700 to 900 nm were observed by transmission electron microscopy (TEM) in partially purified preparations from symptomatic leaves. Partially purified virions were obtained using 30% sucrose cushion centrifuged at 109,000 gmax for 2 h at 10°C (5). No other virus particles were observed in these samples, nor were any observed in non-symptomatic samples. One sample was submitted as potted plant (Mandevilla ‘Sunmandeho’ Sun Parasol Giant White) and was kept under greenhouse conditions for subsequent analyses. Total RNA (Qiagen) was extracted from this sample, and Potyvirus was detected using the universal primers Poty S (5′-GGN AAY AAY AGY GGN CAR CC-3′) and PV1 (5′-20(T)V-3′) (1) by reverse transcription (RT)-PCR (3). The amplified product was the expected ~1.7-kb, corresponding to the partial nuclear inclusion body gene, the coat protein (CP) gene, and the 3′ end untranslated region. The RT-PCR amplicon was cloned (NEB) and sequenced, and the 1,720-bp consensus sequence was deposited in GenBank (Accession No. KM243928). NCBI BLAST analysis at the nucleotide level revealed highest identity (83%) with an isolate of Catharanthus mosaic virus (CatMV) from Brazil (Accession No. DQ365928). Pairwise analysis of the predicted 256 amino acid CP revealed 91% identity with the CatMV Brazilian isolate (ABI94824) and 68% or less identity with other potyviruses. Two potyviruses are usually considered the same species if their CP amino acid sequences are greater than 80% identical (2). Serological analysis of the infected sample Mandevilla ‘Sunmandeho’ Sun Parasol Giant White using a CatMV specific antiserum (4) resulted in positive indirect ELISA reactions. CatMV has been previously reported in periwinkle (Catharanthus roseus) in Brazil (4). Based on the analyses by TEM, RT-PCR, nucleotide and amino acid sequence identities, and serological reactivity, we identify this virus as a U.S. Mandevilla isolate of CatMV. To our knowledge, this is the first report of Catharanthus mosaic virus both in the United States and in Mandevilla. References: (1) J. Chen et al. Arch Virol. 146:757, 2001. (2) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (3) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (4) S. C. Maciell et al. Sci. Agric. Piracicaba, Brazil. 68:687, 2011. (5) D. Mollov et al. Arch Virol. 158:1917, 2013.

scholarly journals First report of dasheen mosaic virus infecting taro (Colocasia esculenta) in Louisiana

Plant Disease ◽  
2021 ◽  
Author(s):  
Cesar Escalante ◽  
David Galo ◽  
Rodrigo Diaz ◽  
Rodrigo Valverde
Keyword(s):  
United States ◽  
Mosaic Virus ◽  
Consensus Sequence ◽  
The United States ◽  
Colocasia Esculenta ◽  
Rt Pcr ◽  
Serological Tests ◽  
First Report ◽  
Pcr Products ◽  
The University

Taro [Colocasia esculenta (L.) Schott], also called dasheen or malanga is an important staple crop in many tropical and subtropical countries (Chaïr et al. 2016). In October 2020, taro plants showing foliar symptoms consisting of mosaic, feathery mottle, and vein clearing patterns were observed in the Hilltop Arboretum, the Bluebonnet Swamp Nature Center, the Louisiana State University Agricultural Center Botanic Gardens, and the University Lake, in Baton Rouge, Louisiana. Unidentified aphids were also observed infesting the plants showing the described symptoms. From each location, two foliar samples from symptomatic and two from asymptomatic plants were collected and tested by ELISA using antiserum for general potyvirus group (Agdia, Elkhart, IN). Seven of eight symptomatic samples tested positive while the asymptomatic samples were negative. The seven positive samples were used to perform an additional ELISA test using antiserum specific for dasheen mosaic virus (DsMV) (Agdia). All seven samples tested positive for DsMV. To confirm the identity of the virus, total RNA was extracted from the seven samples using the PureLink® Plant RNA Reagent Kit (Invitrogen, Carlsbad, CA). After DNA digestion with PerfeCta® DNase I (Qiagen, Beverly, MA), the RNA was used to perform reverse transcription polymerase chain reaction (RT-PCR) with primer set DMV 5708-5731-F/DMV 6131-6154-R which is specific for DsMV (Wang et al. 2017). RT-PCR was performed using the AccessQuickTM RT-PCR System (Promega, Madison, WI) following the reaction conditions described by Wang et al. PCR products of the expected size (~447 bp) were obtained with all seven samples and were Sanger-sequenced. A consensus sequence (MW284936) was obtained with the two sequences from samples collected at the University Lake and aligned with other sequences available in the GenBank using BLASTn. Our isolate of DsMV showed 90.6% nt identity to an isolate of DsMV from Ethiopia (MG602229). Mechanical inoculations to healthy taro plants were conducted using leaf tissue of symptomatic plants as source of inoculum. Inoculated plants exhibited mosaic symptoms three weeks after inoculation and were ELISA-positive for DsMV. Symptomatology, serological tests, RT-PCR testing, and DNA sequencing of RT-PCR products support that the symptomatic taro plants were infected with DsMV. Taro is a crop in Hawaii, but in the contiguous United States, it is mostly grown as an ornamental and is considered an invasive species. Its distribution is restricted to the southern continental states and Hawaii (Cozad et al. 2018). CABI, EPPO (1998) lists the presence of DsMV in several states of the United States, including Louisiana; however, there is no record in the literature of the identification of this virus in Louisiana. The potential impact of DsMV in taro and related ornamental species in southern United States is unknown. To the best of our knowledge, this is the first report documenting DsMV infecting taro in Louisiana.

scholarly journals First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 648-648 ◽  
Author(s):  
R. L. Jordan ◽  
M. A. Guaragna ◽  
T. Van Buren ◽  
M. L. Putnam
Keyword(s):  
United States ◽  
Amino Acid ◽  
Mosaic Virus ◽  
The United States ◽  
Cdna Clones ◽  
Gene Products ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
First Report

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

scholarly journals First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 701-701
Author(s):  
K.-S. Ling ◽  
R. Li ◽  
D. Groth-Helms ◽  
F. M. Assis-Filho
Keyword(s):  
United States ◽  
Dominican Republic ◽  
Mosaic Virus ◽  
Potato Spindle Tuber Viroid ◽  
The United States ◽  
Disease Outbreak ◽  
Ringspot Virus ◽  
Rt Pcr ◽  
Spot Virus ◽  
Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

scholarly journals First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Gardenia Orellana ◽  
Alexander V Karasev
Keyword(s):  
United States ◽  
Leaf Tissue ◽  
The United States ◽  
Universal Primers ◽  
Rt Pcr ◽  
Universal Primer ◽  
Tissue Samples ◽  
First Report ◽  
Specific Pcr ◽  
Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

First Report of a 16SrI (Aster Yellows) Group Phytoplasma in Phlox in the United States

2016 ◽  
Vol 17 (3) ◽  
pp. 198-199
Author(s):  
Andrew E. Sathoff ◽  
Deepak Rajendran ◽  
Seth D. Wannemuehler ◽  
Katarina Sweeney ◽  
Fazal Manan ◽  
...  
Keyword(s):  
United States ◽  
North America ◽  
Flowering Time ◽  
Flower Color ◽  
The United States ◽  
Aster Yellows ◽  
First Report ◽  
Color Range ◽  
Small Grains ◽  
Herbaceous Perennial

Phlox are herbaceous perennial ornamentals native to North America grown for their flower color, range in flowering time, scent, and differing forms. Candidatus Phytoplasma asteris, first found to occur in Chinese asters, is spread by aster leafhoppers and in 2001 was reported to be a serious threat to phlox. There have been several reports of Ca. P. asteris in garlic and small grains in Minnesota. This is the first report of Candidatus Phytoplasma asteris in phlox in Minnesota and the United States. Accepted for publication 28 June 2016. Published 6 September 2016.

scholarly journals Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 292-297 ◽  
Author(s):  
Mohamad Chikh-Ali ◽  
Hayam Alruwaili ◽  
Dalton Vander Pol ◽  
Alexander V. Karasev
Keyword(s):  
United States ◽  
Saudi Arabia ◽  
Seed Potato ◽  
Potato Virus ◽  
Potato Virus Y ◽  
The United States ◽  
Tuber Quality ◽  
Rt Pcr ◽  
First Report ◽  
Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

scholarly journals First Report of the Occurrence of Grapevine fanleaf virus in Washington State Vineyards

Plant Disease ◽  
2008 ◽  
Vol 92 (8) ◽  
pp. 1250-1250 ◽  
Author(s):  
T. Mekuria ◽  
R. R. Martin ◽  
R. A. Naidu
Keyword(s):  
Pacific Northwest ◽  
Mixed Infection ◽  
Consensus Sequence ◽  
Amino Acid Level ◽  
Pairwise Comparison ◽  
The United States ◽  
Washington State ◽  
Rt Pcr ◽  
Grapevine Fanleaf Virus ◽  
First Report

Grapevine fanleaf virus (GFLV; genus Nepovirus, family Comoviridae), responsible for fanleaf degeneration disease, is one of the most important viruses of grapevines worldwide (1). During our reconnaissance studies during 2007, dormant wood cuttings from individual grapevines of wine grape cv. Chardonnay were collected randomly from two geographically separate vineyards in eastern Washington State. Extracts made from cambial scrapings of these cuttings were tested separately for different viruses by single-tube reverse transcription (RT)-PCR using virus-specific primers. Two of the thirty-one grapevines in one vineyard tested positive for GLFV as mixed infection with Grapevine leafroll-associated virus (GLRaV)-3. In another vineyard, six of the twenty-six grapevines tested positive for GFLV as mixed infection with GLRaV-1, GLRaV-3, and Grapevine virus A (GVA) A forward primer (5′-ACCGGATTGACGTGGGTGAT, corresponding to nucleotides [nt] 2231–2250) and reverse primer (5′-CCAAAGTTGGTTTCCCAAGA, complementary to nt 2533–2552) specific to RNA-2 of GFLV-F13 isolate (GenBank Accession No. X16907) were used in RT-PCR assays for the detection of GFLV (4). Primers used for RT-PCR detection of GLRaV-1, GLRaV-2, and GVA were described in Martin et al (2) and Minafra et al (3). The RT-PCR results indicated mixed infection of GFLV with GLRaV-1, GLRaV-3, and GVA. To confirm the presence of GFLV, the 322-bp sequence representing a portion of the coat protein encoded by RNA-2 genomic segment was cloned into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Amplicons obtained from six individual grapevines in the two vineyards were used for cloning. Three independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 99 to 100% nucleotide sequence identity among themselves, indicating that GFLV isolates from the two vineyards may be identical. A comparison of the consensus sequence (GenBank Accession No. EU573307) with corresponding sequences of other GFLVs deposited in GenBank showed 89 to 91% identity at the nucleotide level and 95 to 99% identity at the amino acid level. However, mixed infection of GFLV with different viruses in the two vineyards suggests separate introduction of the planting material. ELISA with GFLV-specific antibodies further confirmed the presence of the virus in samples that were positive in RT-PCR. To our knowledge, this is the first report of GFLV in grapevines grown in the Pacific Northwest states of the United States. Further investigations are being carried out on the distribution, symptoms, molecular variability, and nematode vector transmission of GFLV. References: (1) P. Andret-Link et al. J. Plant Pathol. 86:183, 2004. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Minafra et al. Arch. Virol. 142:417, 1997 (4) A. Rowhani et al. Phytopathology 83:749, 1993.

Sign in / Sign up

Export Citation Format

Share Document