First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

Download Full-text

First Report of Freesia sneak virus in Freesia sp. in Virginia

Plant Disease ◽

10.1094/pdis-93-9-0965b ◽

2009 ◽

Vol 93 (9) ◽

pp. 965-965 ◽

Cited By ~ 7

Author(s):

A. M. Vaira ◽

M. A. Hansen ◽

C. Murphy ◽

M. D. Reinsel ◽

J. Hammond

Keyword(s):

Nucleic Acid ◽

Mosaic Virus ◽

The United States ◽

Research Unit ◽

Yellow Mosaic Virus ◽

Cdna Clones ◽

Rt Pcr ◽

Degenerate Primers ◽

First Report ◽

Leaf Necrosis

In the spring of 2008, freesia, cvs. Honeymoon and Santana, with striking virus-like symptoms similar to freesia leaf necrosis disease were received by the Virginia Tech Plant Disease Clinic from a cut-flower nursery in Gloucester, VA and forwarded for analysis to the USDA-ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Approximately 25% of the plants had coalescing, interveinal, chlorotic, whitish, necrotic or dark brown-to-purple necrotic spots on leaves. Symptomatic plants were scattered within the planting. Fifteen symptomatic plants were collected between March and May of 2008, and nucleic acid extracts were analyzed for ophiovirus infection by reverse transcription (RT)-PCR with ophiovirus-specific degenerate primers (2). The diagnostic 136-bp ophiovirus product from the RdRp gene was amplified from 14 of 15 freesia plants tested. A partially purified virus preparation was analyzed by transmission electron microscopy and potyvirus- and ophiovirus-like particles were detected. The potyviruses, Freesia mosaic virus (FreMV) and Bean yellow mosaic virus (BYMV), each cause mosaic symptoms (3), although BYMV may induce necrosis late in the season. RT-PCR performed on the same nucleic acid samples using potyvirus coat protein (CP)-specific degenerate primers D335 and U335 (1) amplified the diagnostic 335-bp fragment from 2 of 15 plants. Cloned sequence from these plants was identified as FreMV. The ophiovirus CP gene was amplified by RT-PCR and cloned from two symptomatic freesia plants using primers FreSVf-CP-XhoI 5′-GACTCGAGAAATGTCTGGAAAATACTCTGTTC-3′ and FreSVf-CP-BamHI 5′-CCAGGATCCTTAGATAGTGAATCCATAAGCTG-3′, based on the sequence of Freesia sneak virus (FreSV) isolates from freesia (GenBank No. DQ885455) and lachenalia (4). The approximate 1.3-kb amplicon was cloned and sequences of two cDNA clones were identical (GenBank No. FJ807730). The deduced amino acid sequence showed 99% identity with the Italian FreSV CP sequence (GenBank No. DQ885455), confirming FreSV in the symptomatic freesia plants. To our knowledge, this is the first report of FreSV in Virginia and the United States. Soilborne freesia leaf necrosis disease has been reported in Europe since the 1970s (3); several viral causal agents have been hypothesized but recent findings correlate best with the ophiovirus. In Virginia, the presence of FreSV, but not FreMV, was strongly correlated with the leaf necrosis syndrome. FreSV, likely soilborne through Olpidium brassicae, may pose a new soilborne threat for bulbous ornamentals, since it has been recently detected also in Lachenalia spp. (Hyacinthaceae) from South Africa (4). Although specific testing of O. brassicae was not performed, the disease may potentially persist in the soil for years in O. brassicae resting spores and development of symptoms may be affected by environmental conditions (3). References: (1) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) A. M. Vaira et al. Arch.Virol. 148:1037, 2003. (3) A. M. Vaira et al. Acta Hortic. 722:191, 2006. (4) A. M. Vaira et al. Plant Dis. 91:770, 2007.

Download Full-text

First Report of Catharanthus mosaic virus in Mandevilla in the United States

Plant Disease ◽

10.1094/pdis-09-14-0913-pdn ◽

2015 ◽

Vol 99 (1) ◽

pp. 165-165 ◽

Cited By ~ 4

Author(s):

D. Mollov ◽

M. A. Guaragna ◽

B. Lockhart ◽

J. A. M. Rezende ◽

R. Jordan

Keyword(s):

United States ◽

Amino Acid ◽

Mosaic Virus ◽

Consensus Sequence ◽

The United States ◽

Amino Acid Sequences ◽

Universal Primers ◽

Rt Pcr ◽

First Report ◽

Virus Particles

Mandevilla (Apocynaceae) is an ornamental tropical vine popular for its bright and attractive flowers. During 2012 to 2013, 12 Mandevilla sp. samples from Minnesota and Florida nurseries were submitted for analysis at the University of Minnesota Plant Disease Clinic. Plants showed mosaic symptoms, leaf deformation, premature leaf senescence, and vine dieback. Filamentous virus particles with modal lengths 700 to 900 nm were observed by transmission electron microscopy (TEM) in partially purified preparations from symptomatic leaves. Partially purified virions were obtained using 30% sucrose cushion centrifuged at 109,000 gmax for 2 h at 10°C (5). No other virus particles were observed in these samples, nor were any observed in non-symptomatic samples. One sample was submitted as potted plant (Mandevilla ‘Sunmandeho’ Sun Parasol Giant White) and was kept under greenhouse conditions for subsequent analyses. Total RNA (Qiagen) was extracted from this sample, and Potyvirus was detected using the universal primers Poty S (5′-GGN AAY AAY AGY GGN CAR CC-3′) and PV1 (5′-20(T)V-3′) (1) by reverse transcription (RT)-PCR (3). The amplified product was the expected ~1.7-kb, corresponding to the partial nuclear inclusion body gene, the coat protein (CP) gene, and the 3′ end untranslated region. The RT-PCR amplicon was cloned (NEB) and sequenced, and the 1,720-bp consensus sequence was deposited in GenBank (Accession No. KM243928). NCBI BLAST analysis at the nucleotide level revealed highest identity (83%) with an isolate of Catharanthus mosaic virus (CatMV) from Brazil (Accession No. DQ365928). Pairwise analysis of the predicted 256 amino acid CP revealed 91% identity with the CatMV Brazilian isolate (ABI94824) and 68% or less identity with other potyviruses. Two potyviruses are usually considered the same species if their CP amino acid sequences are greater than 80% identical (2). Serological analysis of the infected sample Mandevilla ‘Sunmandeho’ Sun Parasol Giant White using a CatMV specific antiserum (4) resulted in positive indirect ELISA reactions. CatMV has been previously reported in periwinkle (Catharanthus roseus) in Brazil (4). Based on the analyses by TEM, RT-PCR, nucleotide and amino acid sequence identities, and serological reactivity, we identify this virus as a U.S. Mandevilla isolate of CatMV. To our knowledge, this is the first report of Catharanthus mosaic virus both in the United States and in Mandevilla. References: (1) J. Chen et al. Arch Virol. 146:757, 2001. (2) A. Gibbs and K. Ohshima. Ann. Rev. Phytopathol. 48:205, 2010. (3) R. L. Jordan et al. Acta Hortic. 901:159, 2011. (4) S. C. Maciell et al. Sci. Agric. Piracicaba, Brazil. 68:687, 2011. (5) D. Mollov et al. Arch Virol. 158:1917, 2013.

Download Full-text

First Report of Alternanthera mosaic virus Infection in Angelonia in the United States

Plant Disease ◽

10.1094/pdis-92-10-1473b ◽

2008 ◽

Vol 92 (10) ◽

pp. 1473-1473 ◽

Cited By ~ 7

Author(s):

B. E. Lockhart ◽

M. L. Daughtrey

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Mosaic Virus ◽

Genomic Sequence ◽

Nutrient Deficiency ◽

Leaf Tissue ◽

The United States ◽

Nucleotide Sequence Analysis ◽

Degenerate Primers ◽

First Report

Stunting, chlorosis, and light yellow mottling resembling symptoms of nutrient deficiency were observed in angelonia (Angelonia angustifolia) in commercial production in New York. Numerous, filamentous particles 520 to 540 nm long and spherical virus particles 30 nm in diameter were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts of symptomatic Angelonia leaf tissue. Two viruses, the filamentous potexvirus Alternanthera mosaic virus (AltMV) and the spherical carmovirus Angelonia flower break virus (AnFBV) were subsequently identified on the basis of nucleotide sequence analysis of amplicons generated by reverse transcription (RT)-PCR using total RNA isolated from infected leaf tissue. A 584-bp portion of the replicase-encoding region of the AltMV genome was obtained with the degenerate primers Potex 2RC (5′-AGC ATR GNN SCR TCY TG-3′) and Potex 5 (5′-CAY CAR CAR GCM AAR GAT GA-3′) (3). Forward (AnFBV CP 1F-5′-AGC CTG GCA ATC TGC GTA CTG ATA-3′) and reverse (AnFBV CP 1R-5′-AAT ACC GCC CTC CTG TTT GGA AGT-3′) primers based on the published AnFBV genomic sequence (GenBank Accession No. NC_007733) were used to amplify a portion of the viral coat protein (CP) gene. The nucleotide sequence of the amplicon generated using the potexvirus-specific primers (GenBank Accession No. EU679362) was 99% identical to the published AltMV (GenBank Accession No. NC_007731) sequence and the nucleotide sequence of the amplicon obtained using the AnFBV CP primers was 99% identical to the published AnFBV genomic sequence (GenBank Accession No. EU679363). AnFBV occurs widely in angelonia (1) and AltMV has been identified in phlox (2). These data confirm the presence of AltMV and AnFBV in diseased angelonia plants showing stunting and nutrient deficiency-like symptoms and substantiates, to our knowledge, this first report of AltMV in angelonia in the United States. References: (1) S. Adkins et al. Phytopathology 96:460, 2006. (2) J. Hammond et al. Arch. Virol. 151:477, 2006. (3) R. A. A. van der Vlugt and M. Berendeson. Eur. J. Plant Pathol. 108:367, 2002.

Download Full-text

First Report of Cucumber green mottle mosaic virus on Melon in the United States

Plant Disease ◽

10.1094/pdis-02-14-0176-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1163-1163 ◽

Cited By ~ 35

Author(s):

T. Tian ◽

K. Posis ◽

C. J. Maroon-Lango ◽

V. Mavrodieva ◽

S. Haymes ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

Seed Production ◽

Citrullus Lanatus ◽

The United States ◽

Rt Pcr ◽

First Report ◽

Rigid Rod ◽

Yolo County ◽

Das Elisa

In July 2013, a melon (Cucumis melo var. Saski) field in Yolo County, California, was inspected as part of a phytosanitary inspection for seed production. The leaves of the plants showed mosaic, green mottle, and blotches. When plant sap was examined using a transmission electron microscope, rigid rod-shaped particles were observed. Melon plant samples were analyzed by both CDFA and USDA APHIS PPQ laboratories and tested positive using DAS-ELISA against Cucumber green mottle mosaic virus (CGMMV) (Agdia, Elkhart, IN). To confirm the presence of CGMMV, total RNA was analyzed by RT-PCR using primers CGMMV-F5370 5′-CTAATTATTCTGTCGTGGCTGCGGATGC-3′ and CGMMV-R6390 5′-CTTGCAGAATTACTGCCCATA-3′ designed by PPQ based on 21 genomic sequences of CGMMV found worldwide. The 976-bp amplicon was sequenced (GenBank Accession No. KJ453559) and BLAST analysis showed the sequence was 95% identical to MP and CP region of CGMMV isolates reported from Russia (GQ495274, FJ848666), Spain (GQ411361), and Israel (KF155231), and 92% to the isolates from China (KC852074), Korea (AF417243), India (DQ767631), and Japan (D12505). These analyses confirm the virus was CGMMV. To our knowledge, this is the first report of CGMMV in the United States. Based on our sequence data, a second set of primers (CGMMV-F5796 5′-TTGCGTTTAGTGCTTCTTATGT-3′ and CGMMV-R6237 5′-GAGGTGGTAGCCTCTGACCAGA-3′), which amplified a 440-bp amplicon from CGMMV CP region, was designed and used for testing all the subsequent field and seed samples. Thirty-seven out of 40 randomly collected Saski melon samples tested positive for CGMMV, suggesting the virus was widespread in the field. All the melon samples also tested positive for Squash mosaic virus (SqMV) using DAS-ELISA (Agdia). Therefore, the symptoms observed likely resulted from a mixed infection. The melon field affected by CGMMV was immediately adjacent to fields of cucumber (Cucumis sativus var. Marketmore 76) and watermelon (Citrullus lanatus var. Sugar Baby) crops, both for seed production with no barrier between the crops. CGMMV was also detected from symptomatic plants from both fields. Seed lots used for planting all three crops were tested and only the melon seed was positive for CGMMV, suggesting the seed as the source of infection. The sequenced 440-bp RT-PCR amplicons from CGMMV-infected cucumber and watermelon plants and melon seeds were 99% identical to the CGMMV from the field melon. A cucumber plant infected with CGMMV but not SqMV was used for mechanical inoculation at the Contained Research Facility at University of California, Davis. Inoculated cucumber, melon, and watermelon plants showed green mottle and mosaic similar to that observed in the field. CGMMV is a highly contagious virus and damage by this virus on cucurbit crops has been reported in regions where CGMMV is present (2). CGMMV was detected on cucumber grown in greenhouses in Canada with 10 to 15% yield losses reported due to this virus (1). The three cucurbit crops in Yolo County were planted in an isolated area with no other cucurbits nearby. Measures, including destroying all the cucurbit plant material, have been taken to eradicate the virus. Use of CGMMV free cucurbit seed is necessary for prevention of this disease. References: (1) K.-S. Ling et al. Plant Dis. 98:701, 2014. (2) J. Y. Yoon et al. J. Phytopathol. 156:408, 2008.

Download Full-text

First Report of Turnip mosaic virus Infecting Brassica carinata (Ethiopian Mustard) in the United States

Plant Disease ◽

10.1094/pdis-05-13-0500-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1664-1664 ◽

Cited By ~ 3

Author(s):

B. Babu ◽

H. Dankers ◽

S. George ◽

D. Wright ◽

J. Marois ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

The United States ◽

Turnip Mosaic Virus ◽

Brassica Carinata ◽

Rt Pcr ◽

First Report ◽

Ethiopian Mustard ◽

Plant Pathol ◽

Pcr Assays

Brassica carinata L. Braun (Ethiopian mustard) is an annual oil seed crop currently being evaluated for its potential use as a source of biofuel. Due to its high content of erucic acid, it provides a biodegradable non-fossil fuel feedstock that has many applications ranging from biofuels to other industrial uses such as polymers, waxes, and surfactants. Moreover, high glucosinolate content adds the scope of B. carinata being used as a bio-fumigant. B. carinata is amenable to low input agriculture and has great economic potential to be used as a winter crop, especially in the southeastern United States. Virus-like leaf symptoms including mosaic, ringspot, mottling, and puckering were observed on B. carinata (cvs. 080814 EM and 080880 EM) in field trials at Quincy, FL, during spring 2013, with disease incidence of >80%. A more extensive survey of the same field location indicated that mosaic symptoms were the most common. Viral inclusion assays (1) of leaves with a range of symptoms indicated the presence of potyvirus-like inclusion bodies. Total RNA extracts (RNeasy Plant Mini Kit, Qiagen Inc., Valencia, CA) from six symptomatic samples and one non-symptomatic B. carinata sample were subjected to reverse transcription (RT)-PCR assays using SuperScript III One-Step RT-PCR System (Invitrogen, Life Technologies, NY), and two sets of potyvirus-specific degenerate primers MJ1-F and MJ2-R (2) and NIb2F and NIb3R (3), targeting the core region of the CP and NIb, respectively. The RT-PCR assays using the CP and NIb specific primers produced amplicons of 327 bp and 350 bp, respectively, only in the symptomatic leaf samples. The obtained amplicons were gel-eluted and sequenced directly (GenBank Accession Nos. KC899803 to KC899808 for CP and KC899809 to KC899813 for NIb). BLAST analysis of these sequences revealed that they came from Turnip mosaic virus (TuMV). Pairwise comparisons of the CP (327 bp) and NIb (350 bp) segments revealed 98 to 99% and 96 to 98% nucleotide identities, respectively, with corresponding sequences of TuMV isolates. These results revealed the association of TuMV with symptomatic B. carinata leaf samples. Although TuMV has been reported from B. carinata in Zambia (4), this is the first report of its occurrence on B. carinata in the United States. Considering the importance of B. carinata as a biofuel source, this report underscores the need for developing effective virus management strategies for the crop. References: (1) R. G. Christie and J. R. Edwardson. Plant Dis. 70:273, 1986. (2) M. Grisoni et al. Plant Pathol. 55:523, 2006. (3) L. Zheng et al. Plant Pathol. 59:211, 2009. (4) D. S. Mingochi and A. Jensen. Acta Hortic. 218:289, 1988.

Download Full-text

First Report of Cucumber mosaic virus in Anemone sp. in the United States

Plant Disease ◽

10.1094/pdis-93-4-0431b ◽

2009 ◽

Vol 93 (4) ◽

pp. 431-431 ◽

Cited By ~ 1

Author(s):

I. E. Tzanetakis

Keyword(s):

United States ◽

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Protein A ◽

The United States ◽

University Of Arkansas ◽

Degenerate Primers ◽

First Report ◽

Complete Coat Protein ◽

The University

In the spring of 2008, more than a dozen, aphid-infested, anemone plants (Anemone sp.) grown at the campus of the University of Arkansas in Fayetteville showed stunting and mosaic, whereas only two were asymptomatic. Leaf homogenates from four symptomatic plants were inoculated onto Nicotiana benthamiana that became stunted and developed severe mosaic approximately 7 days postinoculation, whereas buffer-inoculated plants remained asymptomatic. Double-stranded RNA (dsRNA) extraction (4) from symptomatic anemone revealed the presence of four predominant bands of approximately 3.2, 2.9, 2.2, and 0.9 kbp, a pattern indicative of cucumovirus infection. Cucumber mosaic virus (CMV) is the only cucumovirus reported in anemone in Europe (2) and Israel (3), and for this reason, anemone and N. benthamiana plants were tested by Protein A ELISA with antisera against CMV developed by H. A. Scott. ELISA verified the presence of CMV in symptomatic anemone and inoculated N. benthamiana, while asymptomatic plants were free of the virus. Using cucumovirus degenerate primers, essentially as described by Choi et al. (1), a region of approximately 940 bases that includes the complete coat protein gene of the virus was amplified from symptomatic anemone and N. benthamiana but not asymptomatic plants of either species. This anemone isolate (GenBank Accession No. FJ375723) belongs to the IA subgroup of CMV because it shares 99% nucleotide and 100% amino acid sequence identities with the Fny isolates of the virus. To my knowledge, this is the first report of CMV infecting anemone in the United States and an important discovery for the ornamental industry since anemone is commonly grown together with several ornamental hosts of CMV in nursery and garden settings. References: (1) S. K. Choi et al. J. Virol. Methods 83:67, 1999. (2) M. Hollings. Ann. Appl. Biol. 45:44, 1957 (3) G. Loebenstein. Acta Hortic. 722:31, 2006 (4) I. E. Tzanetakis and R. R. Martin, J. Virol. Methods 149:167, 2008.

Download Full-text

First Report of Grapevine leafroll-associated virus 5 in Spain

Plant Disease ◽

10.1094/pdis-07-10-0508 ◽

2010 ◽

Vol 94 (12) ◽

pp. 1507-1507 ◽

Cited By ~ 4

Author(s):

C. V. Padilla ◽

E. Cretazzo ◽

I. Hita ◽

N. López ◽

V. Padilla ◽

...

Keyword(s):

United States ◽

Amino Acid ◽

The United States ◽

Amino Acid Identity ◽

Wine Industry ◽

Rt Pcr ◽

Acid Identity ◽

First Report ◽

Virus Indexing ◽

Homologous Genes

Grapevine leafroll-associated viruses (GLRaVs) cause significant reductions in yield and quality in the wine industry worldwide. At least nine different GLRaVs have been found in different regions of the world. In the process of virus indexing of candidate grapevine clones for certification, which includes grafting of scions onto rootstocks, we observed strong leafroll symptoms 1 year after grafting with one vine of cv. Estaladina in Castilla y León, Spain and one vine of cv. Tempranillo in La Rioja, Spain, collected in 2008 and 2007, respectively. Both vines tested positive by real-time reverse transcription (RT)-PCR with TaqMan probes specific for Grapevine leafroll-associated virus 5 and double-antibody sandwich (DAS)-ELISA with a mix of monoclonal antibodies that recognizes GLRaV-4, 5, 6, 7, and 9 (Bioreba, Reinach, Switzerland). RNA extracts of both GLRaV-5 positive vines were analyzed by conventional RT-PCR with a pair of consensus degenerated primers derived from GLRaV-5 hsp70 sequences available in GenBank: LR5HYF (5′-TGGGATGAAYAARTTCAATGC-3′) and LR5HYR (5′-TGAAATTCCTCATRTARGAGC-3′) that amplified a 250-bp fragment. Amplicons were cloned and the comparison of the amino acid sequences (Estaladina isolate, Est110: Accession No. HM208622; Tempranillo isolate, Tem020: Accession No. HM208618) showed in the case of the Est110 isolate, 100 and 82.6% identity, respectively, with the homologous genes of one GLRaV-5 isolate from the United States (AF233934 [3]) and Argentina (EU815935 [2]). For isolate Tem020, the hsp70 gene showed 97.1 and 81.2% amino acid identity with the homologous hsp70 genes of the United States and Argentina isolates. The coat protein (cp) genes of both isolates were also amplified and cloned using the specific GLRaV-5 primers, LR53413 (5′-CGTGATACAAGGTAGGACAACCGT-3′) and LR53843 (5′-CTTGCACTATCGCTGCCGTGAAT-3′), designed according to the sequence of AF233934. Fragments were of the expected size (430 bp) and the nucleotide sequences were obtained (Est110: Accession No. HM363522; Tem020: Accession No. HM363523) and used for pairwise nucleotide comparisons. The Est110 isolate showed 96.7 and 97.5% amino acid identity with the isolates from the United States and Argentina, respectively, while the Tem020 isolate showed 94.8 and 95.6% identity, respectively. Amino acid identity of Est110 and Tem020 cp genes was 100% when compared with the homologous genes of isolates AF233934 and EU815935. To our knowledge this is the first report of GRLaV-5 in Spain. Since 2008, we have detected eight additional vines positive for this virus in 200 clones analyzed for certification, suggesting that the incidence of GLRaV-5 in Spain could be widespread. This research indicates that virus indexing for GLRaV should be included in certification schemes for grapevine candidate clones (1) in Spain. References: (1) Anonymous. OEPP/EPPO Bull. 38:422, 2008. (2) S. Gomez Talquenca et al. Virus Genes 38:184, 2009. (3) F. Osman et al. J. Virol. Methods 141:22, 2007.

Download Full-text

First Report of Beet pseudo yellows virus in Blackberry in the United States

Plant Disease ◽

10.1094/pdis.2004.88.2.223c ◽

2004 ◽

Vol 88 (2) ◽

pp. 223-223 ◽

Cited By ~ 15

Author(s):

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

South Carolina ◽

The United States ◽

Cdna Clones ◽

Broad Host Range ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

First Report ◽

Beet Pseudo Yellows Virus ◽

Symptomatic Plant

Blackberry (Rubus sp.) plants in Arkansas, North Carolina, and South Carolina during the last 3 years have shown symptoms typical of virus infection, including vein yellowing, line pattern, and mottle, and in certain cases, decline and death. All of the symptomatic plants used in our studies were infected with Blackberry yellow vein associated virus (BYVaV) (1). We cloned cDNA derived from dsRNA extracted from a symptomatic plant from South Carolina and identified two cDNA clones (approximate size of 700 and 900 bp, in addition to those that corresponded to a sequence of BYVaV) with sequences identical to the sequence (GenBank Accession No. AY 268107) of Beet pseudo yellows virus (BPYV) heat shock protein 70 homolog gene. Total RNA extracts from the symptomatic plant were tested using reverse transcription-polymerase chain reaction (RT-PCR) with oligonucleotide primers BP CPm F (5′ TTCATATTAAGGATGCGCAGA 3′) and BP CPm R (5′ TGAAAGATGTCCRCTAATGATA 3′) that amplified a fragment of the minor coat protein (CPm) gene of BPYV. A PCR amplicon of the expected size (334 bp) was generated, and sequencing confirmed the results of the random cloning. We also detected the virus in a second blackberry plant from South Carolina with RT-PCR. To our knowledge, this is the first report of blackberry as a host of BPYV and the third new host of BPYV identified in the last few months (2,3). The naturalization of Trialeuroides vaporariorum, the greenhouse whitefly in the southern United States, and the broad host range of virus and vector make BPYV a potential threat for many crops in North America. References: (1) I. E. Tzanetakis et al. (Abstr.) Phytopathology 93:S85, 2003. (2) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003. (3) W. M. Wintermantel. Plant Dis. 88:82, 2004.

Download Full-text

First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽

10.1094/pdis.2004.88.8.907b ◽

2004 ◽

Vol 88 (8) ◽

pp. 907-907 ◽

Cited By ~ 18

Author(s):

J. D. Postman ◽

I. E. Tzanetakis ◽

R. R. Martin

Keyword(s):

United States ◽

North America ◽

Consensus Sequence ◽

The United States ◽

Ringspot Virus ◽

Yellow Vein ◽

Cdna Clones ◽

Meristem Culture ◽

Rt Pcr ◽

First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

Download Full-text

The Occurrence of Bean common mosaic virus and Cucumber mosaic virus in Yardlong Beans in Indonesia

Plant Disease ◽

10.1094/pdis-94-4-0478b ◽

2010 ◽

Vol 94 (4) ◽

pp. 478-478 ◽

Cited By ~ 4

Author(s):

T. A. Damayanti ◽

O. J. Alabi ◽

A. Rauf ◽

R. A. Naidu

Keyword(s):

United States ◽

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Disease Incidence ◽

The United States ◽

Bean Common Mosaic Virus ◽

Degenerate Primers ◽

Specific Primers ◽

Vein Clearing ◽

Yardlong Bean

Yardlong bean (Vigna unguiculata subsp. sesquipedalis) is extensively cultivated in Indonesia for consumption as a green vegetable. During the 2008 season, a severe outbreak of a virus-like disease occurred in yardlong beans grown in farmers' fields in Bogor, Bekasi, Subang, Indramayu, and Cirebon of West Java, Tanggerang of Banten, and Pekalongan and Muntilan of Central Java. Leaves of infected plants showed severe mosaic to bright yellow mosaic and vein-clearing symptoms, and pods were deformed and also showed mosaic symptoms on the surface. In cv. 777, vein-clearing was observed, resulting in a netting pattern on symptomatic leaves followed by death of the plants as the season advanced. Disease incidence in the Bogor region was approximately 80%, resulting in 100% yield loss. Symptomatic leaf samples from five representative plants tested positive in antigen-coated plate-ELISA with potyvirus group-specific antibodies (AS-573/1; DSMZ, German Resource Center for Biological Material, Braunschweig, Germany) and antibodies to Cucumber mosaic virus (CMV; AS-0929). To confirm these results, viral nucleic acids eluted from FTA classic cards (FTA Classic Card, Whatman International Ltd., Maidstone, UK) were subjected to reverse transcription (RT)-PCR using potyvirus degenerate primers (CIFor: 5′-GGIVVIGTIGGIWSIGGIAARTCIAC-3′ and CIRev: 5′-ACICCRTTYTCDATDATRTTIGTIGC-3′) (3) and degenerate primers (CMV-1F: 5′-ACCGCGGGTCTTATTATGGT-3′ and CMV-1R: 5′ ACGGATTCAAACTGGGAGCA-3′) specific for CMV subgroup I (1). A single DNA product of approximately 683 base pairs (bp) with the potyvirus-specific primers and a 382-bp fragment with the CMV-specific primers were amplified from ELISA-positive samples. These results indicated the presence of a potyvirus and CMV as mixed infections in all five samples. The amplified fragments specific to potyvirus (four samples) and CMV (three samples) were cloned separately into pCR2.1 (Invitrogen Corp., Carlsbad, CA). Two independent clones per amplicon were sequenced from both orientations. Pairwise comparison of these sequences showed 93 to 100% identity among the cloned amplicons produced using the potyvirus-specific primers (GenBank Accessions Nos. FJ653916, FJ653917, FJ653918, FJ653919, FJ653920, FJ653921, FJ653922, FJ653923, FJ653924, FJ653925, and FJ653926) and 92 to 97% with a corresponding nucleotide sequence of Bean common mosaic virus (BCMV) from Taiwan (No. AY575773) and 88 to 90% with BCMV sequences from China (No. AJ312438) and the United States (No. AY863025). The sequence analysis indicated that BCMV isolates from yardlong bean are more closely related to an isolate from Taiwan than with isolates from China and the United States. The CMV isolates (GenBank No. FJ687054) each were 100% identical and 96% identical with corresponding sequences of CMV subgroup I isolates from Thailand (No. AJ810264) and Malaysia (No. DQ195082). Both BCMV and CMV have been documented in soybean, mungbean, and peanut in East Java of Indonesia (2). Previously, BCMV, but not CMV, was documented on yardlong beans in Guam (4). To our knowledge, this study represents the first confirmed report of CMV in yardlong bean in Indonesia and is further evidence that BCMV is becoming established in Indonesia. References: (1) J. Aramburu et al. J. Phytopathol. 155:513, 2007. (2) S. K. Green et al. Plant Dis. 72:994, 1988. (3) C. Ha et al. Arch. Virol. 153:25, 2008. (4) G. C. Wall et al. Micronesica 29:101, 1996.

Download Full-text