In silico evaluation of the impact of the Omicron variant on the sensitivity of RT-qPCR assays for SARS-CoV-2 detection using whole genome sequencing

Background The novel severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) variant of concern (VoC) Omicron (B.1.1.529) has rapidly spread around the world presenting a new threat to global public human health. Due to the large number of mutations possessed by Omicron, concerns have emerged over potentially reduced diagnostic accuracy of reverse transcription polymerase chain reaction (RT-qPCR), the gold standard diagnostic test for SARS-CoV-2. Here, we aimed to assess the impact of Omicron on the integrity and sensitivity of RT-qPCR assays used for coronavirus disease-2019 (COVID-19) diagnosis via in silico analysis employing whole genome sequencing data and evaluated the potential for false negatives or test failure due to mismatches between primers/probes and viral genome. Methods In silico sensitivity of 12 RT-qPCR tests (containing 30 primers and probe sets) developed for detection of SARS-CoV-2 reported by the World Health Organization (WHO) or available in the literature, was assessed for use in detecting SARS-CoV-2 Omicron BA.1 and BA.2 sublineages, obtained after removing redundancy from publicly available genomes from National Center for Biotechnology Information (NCBI) and Global Initiative on Sharing Avian Influenza Data (GISAID) databases. The mismatches between the amplicon regions of the SARS-CoV-2 Omicron VoC and primers and probe sets were evaluated, and the clustering analysis of the corresponding amplicon sequences was carried out. Results From the 232 representative SARS-CoV-2 BA.1 Omicron sublineage genomes analyzed, 229 showed substitutions at the forward primer annealing site for assay China-CDC N, 226 showed mismatches in the reverse primer annealing site for assay Thai N, and all 232 had substitution at the 3’ end of the reverse primer annealing site for assay HKUniv RdRp/Hel. Therefore, the lowest sensitivity was observed for assay ChinaCDC N, Thai N and HKUniv RdRp/Hel for SARS-CoV-2 BA.1 sublineage genomes. For 5 SARS-CoV-2 BA.2 Omicron sublineage genomes, false negative results were observed for assays ChinaCDC N, Thai N, HKUniv RdRp/Hel, SigmAldr S5, SigmAldr S6 and HKUniv S. Conclusion In this study, we observed three (25%) assays (ChinaCDC N, Thai N, and HKUniv RdRp/Hel) demonstrated potential for false negatives for the SARS-CoV-2 Omicron BA.1 sublineage, while four (33.3%) assays (ChinaCDC N, Thai N, HKUniv RdRp/Hel, HKUniv S, SigmAldr S5 and SigmAldr S6) demonstrated potential false negative results for the for SARS-CoV-2 Omicron BA.2 sublineage, which also has the potential for Spike (S) gene dropout despite lacking 69-70 deletion in the S gene. Further, amplicon clustering and additional substitutions analysis along with the sensitivity analysis could be used for modification and development of RT-qPCR assays for detection of SARS-CoV-2 Omicron VoC lineages.

Primer extension coupled with fragment analysis for rapid and quantitative evaluation of 5.8S rRNA isoforms

The ribosomal RNA 5.8S is one of the four rRNAs that constitute ribosomes. In human cells, like in all eukaryotes, it derives from the extensive processing of a long precursor containing the sequence of 18S, 5.8S and 28S rRNAs. It has been confirmed also in human cells the presence of three isoforms of 5.8S rRNA: one more abundant called 5.8S short, one called 5.8S long bearing 5 extra-nucleotides at its 5’ end and one 10 nucleotide shorter called 5.8S cropped. So far, little is known about 5.8S long specific role in cell biology and its function in human pathology. The lack of studies on the three 5.8S isoforms could be due to the techniques usually applied to study ribosome biogenesis, such as Northern blot with radioactively labelled probes, that require strict protective measures, and abundant and high-quality samples. To overcome this issue, we optimized a method that combines primer extension with a fluorescently labeled reverse primer designed on the 3’ of 5.8S rRNA sequence and fragment analysis. The resulting electropherogram shows the peaks corresponding to the three isoforms of 5.8S rRNA. The estimation of the area underneath the peaks allows to directly quantify the isoforms and to express their relative abundance. The relative abundance of 5.8S long and 5.8S short remains constant using scalar dilution of RNA and in samples subjected to partial degradation. 5.8S cropped abundance varies significantly in lower concentrate RNA samples. This method allows to analyze rapidly and safely the abundance of 5.8S rRNA isoforms in samples that have been so far considered not suitable such as poorly concentrated samples, RNA derived from frozen tissue or unique samples.

Identification of Sarcoptes scabiei by Clinical Examination and Follow-up Examination in Medan City, Indonesia

Background: Scabies is a disease caused by the mite Sarcoptes scabiei var. hominis. In Indonesia, scabies ranks third out of the 12 most common skin diseases. In terms of disease screening, direct visualization of dermatitis from mites and microscopy of skin scrapings is less sensitive. PCR and dermoscopy examinations have a high sensitivity value to Sarcoptes mites. Aims: This study aims to identify Sarcoptes scabiei mites between clinical symptoms and supporting examinations, namely PCR and dermoscopy methods. Methods: This research is a cross-sectional study, with descriptive analytics. The number of samples of 50 people who met the inclusion criteria was examined by microscopic examination, dermoscopy, and PCR. We state it to be positive if we found scabies mites or their eggs on microscopy, delta wing sign, or jet wet contrail on dermoscopy and there is a 135bp DNA band on PCR. Results: 50 samples diagnosed with scabies based on cardinal sign of scabies, gender were 80% male and 20% female with an average age of 14 years. Based on the location of the rash, the most rashes were between the fingers and toes, each 26% and the least on the head as much as 2%. Based examination tools, no Sarcoptes scabiei mites were found through microscopic and dermoscopic examination, while the PCR examination found 12 positive samples of scabies. Conclusion: PCR examination is very sensitive and specific even in very small quantities, with the fore primer SSUDF and the reverse primer SSUDR. Further research is needed to assess the sensitivity and specificity of dermoscopy and PCR in diagnosing scabies.

Genetic Polymorphism of ITGA2 C807T Collagen Receptor Encoding Gene of Aspirin Therapy among Javanese-Indonesian Healthy Respondents

BACKGROUND: Aspirin is an antiplatelet drug commonly administered as primary and secondary prophylaxis to prevent thromboembolic events. However, there has been a common incidence of aspirin resistance that leads to a recurrent cerebrovascular disease. One of the causes of such event is the genetic polymorphisms of the integrin alpha-2 (ITGA2) gene that encodes the glycoprotein Ia (GPIa) receptor in the pharmacodynamics of aspirin. AIM: This study analyzed the genetic polymorphism of ITGA2 as the GPIa collagen receptor encoding gene of aspirin therapy among healthy Javanese, the largest ethnic group in Indonesia. METHODS: This cross-sectional study involved 100 respondents who met the inclusion criteria with their blood sample taken for DNA isolation. Identification of genetic polymorphism in the target SNPs was done using the PCR-RFLP method with 5’-CCTTAAAGCTACCGGCCCATGT-3’ forward primer and 5’-TTGGCCTATTAGCACCAAAACTTACC-3’ reverse primer as well as Hpy188Irestriction enzyme to fragment the target at position 244 in the C base. RESULTS: This study found that the dominant genotype and allele were CT (51%) and C (66.5%), respectively. CONCLUSION: The allele frequency of ITGA2 gene in this study was similar to that of the populations in other Asian countries. Further research regarding the effects of ITGA2 C807T polymorphism on the pharmacodynamics of aspirin as an antiplatelet is recommended to minimize atherothrombotic events and examine its interactions as a biomarker of the risk and prognosis of some cancer types.

SuperSelective primer pairs for sensitive detection of rare somatic mutations

SuperSelective primers, by virtue of their unique design, enable the selective exponential amplification of rare DNA fragments containing somatic mutations in the presence of abundant closely related wild-type DNA fragments. However, when a SuperSelective primer is used in conjunction with a conventional reverse primer, linear amplification of the abundant wild-type fragments occurs, and this may lead to a late arising signal that can be confused with the late arising signal from the rare mutant fragments. We have discovered that the use of a pair of SuperSelective primers, one specific for the target mutation in a plus strand, and the other specific for the same mutation in the complementary minus strand, but both possessing 3′-terminal nucleotides that are complementary to the mutation, significantly suppresses the linear amplification of the related wild-type sequence, and prevents the generation of false mutant sequences due to mis-incorporation by the DNA polymerase. As a consequence, the absence of mutant fragments in a sample does not give rise to a false-positive signal, and the presence of mutant fragments in a sample is clearly distinguishable as a true-positive signal. The use of SuperSelective primer pairs should enhance the sensitivity of multiplex PCR assays that identify and quantitate somatic mutations in liquid biopsies obtained from patients with cancer, thereby enabling the choice of a targeted therapy, the determination of its effectiveness over time, and the substitution of a more appropriate therapy as new mutations arise.

Optimization of annealing temperature for amplification of EhoscnOla locus in pranajiwa (Euchresta horsfieldii) plant collected from mountains, urban and coastal areas in Bali

Pranajiwa plant is a medicinal plant that grows wildly and is classified as a rare plant. Currently, its existence is increasingly threatened. Pranajiwa grows around Indonesia and is known with several scientific names and morphological features due to unclear identification. Molecular identification is recommended to clarify its species. DNA Barcoding is considered the suitable method to identify pranajiwa plant molecularly. The purpose of this study was to optimized the PCR annealing temperature of EhcSnOla locus barcoding marker of pranajiwa plants collected from the coastal (Jimbaran), urban (Renon), and mountain (Bedugul) areas, representing three different areas in Bali. Research procedures include total DNA extraction, PCR procedure, and electrophoresis. The primers used in this study were EhoScnOla forward primer and EhoscnOla reverse primer. Five different temperatures were used for annealing temperature optimization: 51°C, 52°C, 55°C, 57°C, and 60°C. The result showed that all temperatures produced a clear, thick, and single electrophoresis band, indicating that all temperatures were suitable for the annealing temperature and the most optimal temperature is in the Mountains sample (Bedugul) which is 60°C. The Jimbaran, Renon, and Bedugul samples produced 882, 820, and 889 bp, respectively. EhcSnOla locus can be used as the barcoding marker to identify pranajiwa molecularly.

Variation of prolactin and β-Lactoglobulin genes in the Indonesian FH Cattle

Prolactin is a polypeptide hormone, encoded by the prolactin (PRL) gene, synthesized and secreted by anterior pituitary, and affecting milk yield and composition. β-Lactoglobulin (BLG) is the major whey proteinin the milk of ruminants. This study was conducted to identify the PRL and LGB genes polymorphism in the Indonesian FH cattle. A total of 139 individual cattle blood samples from West Java were used to obtain DNA samples through the DNA extraction process. Identification of the PRL and LGB genes was performed using PCR-RFLP method with RsaI (PRL gene) and HaeIII (BLG gene) restriction enzymes. The PRL gene was amplified using forward primer 5’-ccaaatccactgaattatgctt-3’ and reverse primer 5’-acagaaatcacctctctcattca-3’. The BLG gene was amplified using forward primer 5’-tgtgctggacaccgactacaaaaag-3’ and reverse primer 5’-gctcccggtatatgaccaccctct-3’. The PRL and BLG genes in the Indonesia FH cattle were polymorphic based on the PCR-RFLP analysis but the heterozygosity value was low. There were two alleles (G and A) and three genotypes (GG, GA, and AA) identified in the PRL gene of the Indonesian FH cattle with genotype frequencies were 0.914, 0.079, and 0,007 for GG, GA, and AA genotypes respectively. There were two genotypes (CC and CG) identified in the BLG gene with genotype frequencies were 0.91 (CC), and 0.09 (CG). Information about the PRL and BLG genes polymorphism in this study can be considered for further study to analyse its association with milk yield trait.

Molecular Characterization of Hemagglutinin-Neuraminidase Protein Virus Newcastle disease (ND) in Surabaya during 2003 and 2016

This study aimed to determine the mutation of amino acid, nucleotide homology, phylogenetic tree, epitope prediction of Hemagglutinin-Neuraminidase protein Newcastle Disease (ND) Virus isolated from traditional market around Surabaya. Samples were from 37 chicken with cloacal swab and one positive samples for control (LaSota). Samples were inoculated on embyonate chicken eggs and identified with HA test confirmed with HI test. Positive samples processed by PCR using forward and reverse primer with 503 bp RNA target. The PCR result then analyzed with sequencing. Result of sequencing analysis showed that theres similiarity between samples amino acid and vaccine isolate its effect the percentage of nucleotide homology and phylogenetic relation between isolate. Epitope NGAANNSGWGAPIHDPDYIGG have high immunogenic value at all of isolate which good as vaccine candidate.

ΩqPCR measures telomere length from single-cells in base pair units

ΩqPCR determines absolute telomere length in kb units from single cells. Accuracy and precision of ΩqPCR were assessed using 800 bp and 1600 bp synthetic telomeres inserted into plasmids, which were measured to be 819 ± 19.6 and 1590 ± 42.3 bp, respectively. This is the first telomere length measuring method verified in this way. The approach uses Ω-probes, a DNA strand containing sequence information that enables: (i) hybridization with the telomere via the 3′ and 5′ ends that become opposed; (ii) ligation of the hybridized probes to circularize the Ω-probes and (iii) circularized-dependent qPCR due to sequence information for a forward primer, and for a reverse primer binding site, and qPCR hydrolysis probe binding. Read through of the polymerase during qPCR occurs only in circularized Ω-probes, which quantifies their number that is directly proportional to telomere length. When used in concert with information about the cell cycle stage from a single-copy gene, and ploidy, the MTL of single cells measured by ΩqPCR was consistent with that obtained from large sample sizes by TRF.

Primer Design and Analysis for Detection of mecA gene

MecA is a gene that causes antibiotic resistance and it contained in Staphylococcus aureus. The gene can be detected using pairs of primer (forward and reverse). Primes is short nucleotide that are used as attachment point for DNA polymerase and as a barrier for the fragment DNA target to be amplified with Polymerase Chain Reaction (PCR). The aims of this study were to design and analysis the nucleotide primer sequences of MecA. This research using in silico method of NCBI (National Center of Biotechnology Information) application, clone manager10, oligoanalyzer3.1, perlprimer and primer3plus. The results of design and candidate primer analysis showed that the first candidate of forward and reverse primer that falls with in the criteria with base sequences 18-30, 40-60 GC%, Tm 50-60, 3’ dimer ≤3, stability ≥1,2, secondary structure >-16 Kcal/mol, runs ≤5, repeats ≤4, hairpins>-3 Kcal/mol. The conclusion is the first candidate of forward primer with 19 base pair (5’GTGAAGCAACCATCGTTAC'3), %GC 47Tm 58oC, 3’dimer 2, stability 1.6, secondary structure -1,95 dan -3,61 Kcal/mol, runs 2, hairpins -0,1 start 53844 and the first candidate of reverse primer with 21 base pair (5’CCTTCTACACCTCCATATCAC'3), %GC 47, Tm 58oC, 3’dimer 0, stability 1.3, secondary structure -4,74 dan -5,38 Kcal/mol, runs 2, hairpins -2.5 dan start 55852. The both of primer can be use for identification of MecA gene by PCR method