scholarly journals Epidemiology and Management of Bacterial Spot of Almond Caused by Xanthomonas arboricola pv. pruni, a New Disease in California

Plant Disease ◽  
2020 ◽  
Vol 104 (6) ◽  
pp. 1685-1693 ◽  
Author(s):  
Stacey E. Haack ◽  
Layne Wade ◽  
Helga Förster ◽  
James E. Adaskaveg
Keyword(s):  
Disease Incidence ◽  
Management Strategies ◽  
Pcr Primers ◽  
Host Susceptibility ◽  
New Disease ◽  
Bacterial Spot ◽  
Immature Fruit ◽  
Specific Pcr ◽  
Xanthomonas Arboricola ◽  
Species Specific

Bacterial spot caused by Xanthomonas arboricola pv. pruni was first detected on almond in California in 2013, and it is reported herein as a new disease in California based on fulfilling Koch’s postulates and identification of the pathogen using species-specific PCR primers. Infected mummified fruit from the previous growing season and their peduncles were identified as primary overwintering sites of the bacterium on the tree. Twig cankers were not observed, and the pathogen was not recovered from dormant buds. Isolation from flowers and emerging leaves was only successful when they were collected within 20 cm of an infected, mummified fruit on the tree. Inoculation of flowers and immature fruit as well as immature and mature leaves resulted in disease development, indicating a long period of host susceptibility in the spring, but disease incidence was highest in fruit inoculations. In split-plot trials over 3 years, dormant applications in December or January with copper or copper-mancozeb significantly reduced the disease compared with untreated controls in seasons with high rainfall, but they had no effect in seasons with low rainfall. In-season applications of copper-mancozeb at petal fall or at full bloom and petal fall were also effective in reducing the disease. Phytotoxicity was observed after repeated applications of copper bactericides, especially in low-rainfall seasons. Dormant and in-season treatments of copper-mancozeb mixtures integrated with removal of mummified fruit are currently the best management strategies for bacterial spot of almond in California.

Multilocus Sequence Analysis and Copper Ion Resistance Detection of 60 Xanthomonas arboricola pv. juglandis Isolates from China

Plant Disease ◽  
2021 ◽  
Author(s):  
Benzhong Fu ◽  
Jieqian Zhu ◽  
Conard Lee ◽  
Lihua Wang
Keyword(s):  
Sequence Analysis ◽  
Copper Ion ◽  
Housekeeping Genes ◽  
Threshold Value ◽  
Pcr Primers ◽  
Multilocus Sequence Analysis ◽  
Nucleotide Polymorphisms ◽  
Specific Pcr ◽  
Resistant Strains ◽  
Xanthomonas Arboricola

Walnut bacterial blight caused by Xanthomonas arboricola pv. juglandis (Xaj) has serious repercussions for walnut production around the world. Between 2015 and 2017, disease samples were collected from six counties (Danjiangkou, Baokang, Suizhou, Shennongjia, Zigui, and Xingshan) in Hubei province, China. Fifty-nine Xaj strains were identified by morphology and specific PCR primers from 206 isolates. The genetic diversity of 60 Xaj strains (59 from Hubei plus one from Beijing) was evaluated by Multilocus Sequence Analysis (MLST), and their resistance to copper ion (Cu2+) treatment was determined. A Neighbor Joining phylogenetic dendrogram was constructed based on four sequences of housekeeping genes (atpD-dnaK-glnA-gyrB). Two groups of strains were identified whose clustering was consistent with that of glnA. The minimal inhibitory concentration of copper ion on representative Xaj strain DW3F3 (the first genome sequenced Xaj from China) was 115 μg/ml. Setting the copper resistant threshold value to 125 μg/ml, 47 and 13 strains were considered sensitive and resistant to Cu2+, respectively. Furthermore, five strains showed Cu2+ resistance at 270 μg/ml. Compared to the copB from sensitive strains, the copB gene in resistant strains had a 15-bp insertion and eight scattered single nucleotide polymorphisms. Interestingly, the clustering based on MLSA was distinct between Xaj copper ion resistant and sensitive strains.

scholarly journals First Report of Orange Rust of Sugarcane Caused by Puccinia kuehnii in Colombia

Plant Disease ◽  
2012 ◽  
Vol 96 (1) ◽  
pp. 143-143 ◽  
Author(s):  
M. Cadavid ◽  
J. C. Ángel ◽  
J. I. Victoria
Keyword(s):  
Internal Transcribed Spacer ◽  
Pcr Primers ◽  
The United States ◽  
Optical Microscope ◽  
First Report ◽  
5.8S Rdna ◽  
Specific Pcr ◽  
Plant Pathol ◽  
Species Specific ◽  
New Cultivars

Symptoms of sugarcane orange rust were first observed in July 2010 on sugarcane (interspecific hybrid of Saccharum L. species) cv. CC 01-1884 planted in the La Cabaña Sugar Mill, Puerto Tejada, Colombia. Morphological features of uredinial lesions and urediniospores inspected with an optical microscope and scanning electron microscopy were distinct from common rust of sugarcane caused by Puccinia melanocephala Syd. & P. Syd., revealing spores identical morphologically to those described for the fungus P. kuehnii (Kruger) E. Butler, causal agent of sugarcane orange rust (1,3). Uredinial lesions were orange and distinctly lighter in color than pustules of P. melanocephala. Urediniospores were orange to light cinnamon brown, mostly ovoid to pyriform, variable in size (27.3 to 39.2 × 16.7 to 21.2 μm), with pronounced apical wall and moderately echinulate with spines evenly distributed. Paraphyses, telia, and teliospores were not observed. Species-specific PCR primers designed from the internal transcribed spacer (ITS)1, ITS2, and 5.8S rDNA regions of P. melanocephala and P. kuehnii were used to differentiate the two species (2). The primers Pm1-F and Pm1-R amplified a 480-bp product from P. melanocepahala DNA in leaf samples with symptoms of common rust. By contrast, the primers Pk1-F and Pk1-R generated a 527-bp product from presumed P. kuehnii DNA in leaf samples with signs of orange rust, confirming the identity as P. kuehnii. The Centro de Investigación de la Caña de Azúcar de Colombia (Cenicaña) started a survey of different cultivars in nurseries and experimental and commercial fields in the Cauca River Valley and collected leaf samples for additional analyses. Experimental cvs. CC 01-1884, CC 01-1866, and CC 01-1305 were found to be highly susceptible to orange rust and were eliminated from regional trials, whereas commercial cvs. CC 85-92 and CC 84-75, the most widely grown cultivars, were resistant. With the discovery of orange rust of sugarcane in Colombia, Cenicaña has incorporated orange rust resistance in the selection and development of new cultivars. To our knowledge, this is the first report of P. kuehnii on sugarcane in Colombia. Orange rust has also been reported from the United States, Cuba, Mexico, Guatemala, Nicaragua, El Salvador, Costa Rica, Panama, Ecuador, and Brazil. References: (1) J. C. Comstock et al. Plant Dis. 92:175, 2008. (2) N. C. Glynn et al. Plant Pathol. 59:703, 2010. (3) E. V. Virtudazo et al. Mycoscience 42:167, 2001.

scholarly journals First Report of Bacterial Spot Caused by Xanthomonas arboricola pv. pruni on Japanese Plum in Taiwan

Plant Disease ◽  
2013 ◽  
Vol 97 (6) ◽  
pp. 835-835 ◽  
Author(s):  
Y. M. Shen ◽  
T. C. Huang ◽  
C. H. Chao ◽  
H. L. Liu
Keyword(s):  
First Record ◽  
Tween 20 ◽  
Post Inoculation ◽  
Bacterial Spot ◽  
Japanese Plum ◽  
Specific Pcr ◽  
Leaf Spots ◽  
Plastic Bags ◽  
Xanthomonas Arboricola ◽  
Specific Pcr Assay

Prunus salicina Lindl., also known as Japanese plum, is a temperate-zone fruit tree grown in mountainous areas of Taiwan. The planted area in Taiwan is approximately 3,000 ha. In June 2011, more than 20% of plum fruits harvested in an orchard in Lishan (elevation about 2,000 m) showed black, mostly circular, sunken necrotic lesions. Leaves with a shot-hole appearance and cankered branches were found when investigating the orchard. Bacteria were isolated from symptomatic fruits, leaves, and branches. Isolation on nutrient agar detected colonies that were yellow, mucoid, gram-negative, Xanthomonas-like, and induced hypersensitive responses on tomatoes. Three voucher isolates, BCRC80476, BCRC80478, and BCRC80481, obtained from the fruit, leaf, and branch, respectively, were deposited in the Bioresource Collection and Research Center, Hsinchu, Taiwan. Molecular analyses were conducted for species identification. Sequences of the gyrB gene of the three voucher isolates (GenBank Accession Nos. KC202288, KC202289, and KC202287) were 100% identical to that of Xanthomonas arboricola pv. pruni pathotype strain ICMP51 (2). In addition, DNA fragments of the xopE3 gene (an X. arboricola pv. pruni specific T3E gene, approximately 381 bp) were PCR amplified using the primer pair fw-5′CCGACATTGCCGTCAGCGATCACG3′ and rv-5′AGCGTTCTTGGGTGTGTTGAGCATTTG3′ (1). The bacterial isolates were identified as X. arboricola pv. pruni on the basis of the colony characteristics, sequence homology, and the specific PCR assay. Pathogenicity was confirmed by inoculation of greenhouse-potted P. salicina plants with strains BCRC80476, BCRC80478, and BCRC80481 using bacterial suspensions (6.7 × 108 CFU per ml) in 0.01% Tween 20. Five plants were evenly sprayed with inoculum of each bacterial isolate and covered with plastic bags for 3 days. One week post inoculation, at an average temperature of 19°C, the 15 inoculated plants produced brown-purple spots delimited by a chlorotic margin on the leaves. Three weeks post inoculation, the necrotic leaf spots completely deteriorated, leaving a shot-hole appearance, and the branches showed lesions similar to those observed in the fields. The pathogen was reisolated from the symptomatic tissues, fulfilling Koch's postulates. Control plants sprayed with 0.01% Tween 20 remained symptomless. To our knowledge, this is the first record of X. arboricola pv. pruni causing bacterial spot on P. salicina in Taiwan. References: (1) A. Hajri et al. Appl. Environ. Microbiol. 78:371, 2012. (2) J. M. Young et al. Syst. Appl. Microbiol. 31:366, 2008.

scholarly journals Molecular Diagnostics for the Sigatoka Disease Complex of Banana

2007 ◽  
Vol 97 (9) ◽  
pp. 1112-1118 ◽  
Author(s):  
Mahdi Arzanlou ◽  
Edwin C. A. Abeln ◽  
Gert H. J. Kema ◽  
Cees Waalwijk ◽  
Jean Carlier ◽  
...  
Keyword(s):  
Management Strategies ◽  
Leaf Tissue ◽  
Pcr Primers ◽  
Disease Diagnosis ◽  
Life Cycles ◽  
Diagnostic Tools ◽  
Disease Epidemiology ◽  
Disease Complex ◽  
Real Time Quantitative Pcr ◽  
Species Specific

The Sigatoka disease complex of banana involves three related ascomycetous fungi, Mycosphaerella fijiensis, M. musicola, and M. eumusae. The exact distribution of these three species and their disease epidemiology remain unclear, because their symptoms and life cycles are rather similar. Disease diagnosis in the Mycosphaerella complex of banana is based on the presence of host symptoms and fungal fruiting structures, which hamper preventive management strategies. In the present study, we have developed rapid and robust species-specific molecular-based diagnostic tools for detection and quantification of M. fijiensis, M. musicola, and M. eumusae. Conventional species-specific polymerase chain reaction (PCR) primers were developed based on the actin gene that detected DNA at as little as 100, 1, and 10 pg/μl from M. fijiensis, M. musicola, and M. eumusae, respectively. Furthermore, TaqMan real-time quantitative PCR assays were developed based on the β-tubulin gene and detected quantities of DNA as low as 1 pg/μl for each Mycosphaerella sp. from pure cultures and DNA at 1.6 pg/μl per milligram of dry leaf tissue for M. fijiensis that was validated using naturally infected banana leaves.

scholarly journals Immunological and Molecular Analyses of the Borrelia hermsii Factor H and Factor H-Like Protein 1 Binding Protein, FhbA: Demonstration of Its Utility as a Diagnostic Marker and Epidemiological Tool for Tick-Borne Relapsing Fever

2006 ◽  
Vol 74 (8) ◽  
pp. 4519-4529 ◽  
Author(s):  
Kelley M. Hovis ◽  
Martin E. Schriefer ◽  
Sonia Bahlani ◽  
Richard T. Marconi
Keyword(s):  
Binding Protein ◽  
Pcr Primers ◽  
Factor H ◽  
Antigenic Structure ◽  
Diagnostic Tools ◽  
Relapsing Fever ◽  
Borrelia Hermsii ◽  
Specific Pcr ◽  
Epidemiological Tool ◽  
Species Specific

ABSTRACT It has been demonstrated that Borrelia hermsii, a causative agent of relapsing fever, produces a factor H (FH) and FH-like protein 1 (FHL-1) binding protein. The binding protein has been designated FhbA. To determine if FH/FHL-1 binding is widespread among B. hermsii isolates, a diverse panel of strains was tested for the FH/FHL-1 binding phenotype and FhbA production. Most isolates (23/24) produced FhbA and bound FH/FHL-1. Potential variation in FhbA among isolates was analyzed by DNA sequence analyses. Two genetically distinct FhbA types, designated fhbA1 and fhbA2, were delineated, and type-specific PCR primers were generated to allow for rapid differentiation. Pulsed-field gel electrophoresis and hybridization analyses demonstrated that all isolates that possess the gene carry it on a 200-kb linear plasmid (lp200), whereas isolates that lack the gene lack lp200 and instead carry an lp170. To determine if FhbA is antigenic during infection and to assess the specificity of the response, recombinant FhbA1 (rFhbA1) and rFhbA2 were screened with serum from infected mice and humans. FhbA was found to be expressed and antigenic and to elicit a potentially type-specific FhbA response. To localize the epitopes of FhbA1 and FhbA2, truncations were generated and screened with infection serum. The epitopes were determined to be conformationally defined. Collectively, these analyses indicate that FH/FHL-1 binding is a widespread virulence mechanism for B. hermsii and provide insight into the genetic and antigenic structure of FhbA. The data also have potential implications for understanding the epidemiology of relapsing fever in North America and can be applied to the future development of species-specific diagnostic tools.

Sign in / Sign up

Export Citation Format

Share Document