scholarly journals First report of grapevine virus L infecting grapevine in southeast France

Plant Disease ◽  
2022 ◽  
Author(s):  
Laurence Svanella ◽  
Armelle Marais ◽  
Thierry Candresse ◽  
Marie Lefebvre ◽  
Jerome Lluch ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
Protein Gene ◽  
The United States ◽  
Read Length ◽  
Nucleic Acid Binding ◽  
Grapevine Virus ◽  
Total Rna ◽  
First Report ◽  
Grapevine Virus A ◽  
Hop Stunt Viroid

Grapevine virus L (GVL) is a recently described vitivirus (family Betaflexiviridae) with a positive-sense single-stranded RNA genome. It has so far been reported from China, Croatia, New-Zealand, the United States and Tunisia (Debat et al. 2019; Diaz-Lara et al. 2019; Alabi et al. 2020; Ben Amar et al. 2020). It has significant genetic variability (up to 26% of nucleotide divergence between isolates) and the existence of four phylogroups has been proposed (Alabi et al. 2020). In the frame of a project investigating the possible links between grapevine trunk diseases and grapevine virome, viral high throughput sequencing (HTS)-based testing was performed on symptomatic and asymptomatic grapevines collected in July 2019 in vineyards of four areas in France (Bourgogne, Charentes, Gard, Gironde) corresponding to five cultivars of Vitis vinifera (Cabernet franc, Cabernet Sauvignon, Chardonnay, Sauvignon, Ugni blanc). Total RNAs were purified from powder of 105 trunk wood samples using the Spectrum™ Plant Total RNA Kit (Sigma-Aldrich, Saint-Quentin-Fallavier, France) and RNA-seq libraries were prepared using Zymo-Seq RiboFree Total RNA Library Prep Kit (Ozyme, Saint Cyr l’Ecole, France). HTS was performed on a S4 lane of Illumina NovaSeq 6000 using a paired-end read length of 2x150 bp. The trimmed sequence reads obtained from Chardonnay plants CH30-75M (99.9 M) and CH37-19S (114 M) from a vineyard in Gard were analyzed using CLC Genomics Workbench v21 (Qiagen, Courtaboeuf, France) and revealed complex mixed infections. Besides contigs representing a complete GVL genome (average scaffold coverage: 6,197x and 2,970x, respectively), contigs from grapevine rupestris stem pitting virus (1,697x ; 1,124x), grapevine virus A (82x ; 95x), grapevine pinot gris virus (1,475x ; 866x), grapevine leafroll-associated virus 3 (5,122x ; 1,042x), hop stunt viroid (13,783x ; 29,514x) and grapevine yellow speckle viroid 1 (690x ; 1158x) were also identified. Plant CH37-19S was also co-infected by grapevine rupestris vein feathering virus (164x). The GVL contigs integrated respectively 320,000 and 152,000 reads (corresponding to 0.32% and 0.11% of filtered/trimmed reads, respectively). The GVL genomic sequences from each sample (7,616 nt) have been deposited in GenBank (Accession nos. OK042110 and OK042111, respectively). The two contigs are nearly identical (99.9% nt identity) and share respectively 97.5% and 95.9% with GVL-KA from the USA (MH643739) and GVL-RS from China (MH248020), the closest isolates present in GenBank. To confirm the presence of GVL, the original grapevines were resampled in the field and total RNAs were extracted as described above from cambial scrappings and leaves. Total RNAs were used for RT-PCR tests using primers targeting a 279-bp fragment corresponding to the 3’ end of the coat protein gene and part of the nucleic acid binding protein gene (Debat et al. 2019). The Sanger-derived sequences from the amplicons shared 100% nt identities with the corresponding sequences of the HTS assembled genomes, confirming the presence of GVL in both tissues of both grapevine samples. To our knowledge, this represents the first report of the occurrence of GVL in vineyards in France. Given the complex mixed infection present in the two analyzed grapevines, no conclusions can be drawn on the pathogenicity of GVL. Further efforts are needed to better understand GVL distribution and its potential pathogenicity to grapevine. References Alabi, O J., et al. 2020. Arch. of Virol. 165:1905-1909. Ben Amar, A., et al. 2020. Plant disease 104:3274. Debat, H., et al. 2019. Eur J Plant Pathol. 155:319. Diaz-Lara, A., et al. 2019. Arch. of Virol. 164:2573. Acknowledgments The authors are grateful to the “Plan National Dépérissement du Vignoble” (Mycovir project) for the financial support

scholarly journals Limited Genetic Variability Among American Isolates of Grapevine virus E from Vitis spp.

Plant Disease ◽  
2016 ◽  
Vol 100 (1) ◽  
pp. 159-163 ◽  
Author(s):  
J. Vargas-Asencio ◽  
M. Al Rwahnih ◽  
A. Rowhani ◽  
F. Celebi-Toprak ◽  
J. R. Thompson ◽  
...  
Keyword(s):  
Genetic Diversity ◽  
New York ◽  
Protein Gene ◽  
The United States ◽  
Nucleic Acid Binding ◽  
Grapevine Virus ◽  
Rt Pcr ◽  
Viral Cdna ◽  
Polymerase Chain ◽  
Binding Protein Gene

A survey for the presence of Grapevine virus E (GVE, genus Vitivirus, family Betaflexiviridae) in vineyards in New York and California was conducted using macroarray hybridization or reverse-transcription polymerase chain reaction (RT-PCR) assays. In New York, GVE was detected in 10 of 46 vines of Vitis labrusca, one V. riparia, and one Vitis hybrid. All GVE-infected New York vines were coinfected with Grapevine leafroll-associated virus-3. In California, GVE was detected in 8 of 417 vines of V. vinifera. All GVE-infected California vines were also coinfected by one of the leafroll-associated viruses and other vitiviruses. In order to assess the genetic diversity among GVE isolates, a viral cDNA was amplified by RT-PCR, and a 675-nucleotide region that included the 3′ terminus of the coat protein gene, a short intergenic region, and the 5′ terminus of the putative nucleic acid binding protein gene was sequenced. All 20 GVE isolates sequenced in this study were very closely related, with >98% nucleotide identity to the SA94 isolate from South Africa. These findings confirm the presence of GVE in major grape-growing regions of the United States and indicate a very low level of genetic diversity.

scholarly journals First report of grapevine virus H (GVH) in grapevine in Greece

Plant Disease ◽  
2021 ◽  
Author(s):  
Polina Panailidou ◽  
Leonidas Lotos ◽  
Chrysoula-Lyto Sassalou ◽  
E. Gagiano ◽  
Gerhard Pietersen ◽  
...  
Keyword(s):  
Sanger Sequencing ◽  
High Throughput Sequencing ◽  
De Novo ◽  
Virus Genome ◽  
Composite Sample ◽  
Grapevine Virus ◽  
Northern Greece ◽  
Total Rna ◽  
First Report ◽  
The Usa

Grapevine virus H (GVH) is a member of the genus Vitivirus in the family Betaflexiviridae (subfamily Trivirinae, order Tymovirales) that infects grapevine (Candresse et al., 2018). GVH was first identified in a symptomless grapevine of an unknown cultivar from Portugal in 2018 (Candresse et al. 2018), and since then the virus has been reported only from California (Diaz‑Lara et al. 2019). Several vitiviruses have been detected in Greek vineyards (Avgelis and Roubos 2000; Dovas and Katis 2003a; 2003b; Panailidou et al. 2019; Lotos et al. 2020), but no information was available on the presence of GVH. In the fall of 2020, in order to investigate the virome of a commercial vineyard of the cultivar Assyrtiko in northern Greece, a composite sample was made of leaves and petioles from nine vines exhibiting leafroll disease symptoms. Total RNA was extracted from the composite sample according to the protocol of White et al. (2008) and subjected to rRNA depletion, library construction (TruSeq Stranded Total RNA kit), and high-throughput sequencing (HTS) in a NovaSeq6000 platform (Illumina Inc.) at Macrogen (Korea). The resulting ~42 million 101-nt paired-end reads were analyzed in Geneious Prime 2020, and the assembled de novo contigs were subjected to a local BLASTn search, which revealed the presence of 18 grapevine infecting viruses and viroids, among which also a GVH-like contig (GeA-9). GeA-9 was 7,404 nucleotides (nt) long, covering 99.4% of the full virus genome and shared 98.2 % nt identity with a GVH isolate from the USA (MN716768). To confirm the presence of GVH, the nine samples of the cultivar Assyrtiko, used initially to produce the composite sample for HTS analysis, were tested individually by RT-PCR, using the primers GVH_F_2504 (5’-CTGCTTCGCTGAACATATGC-3’) and GVH_R_2835 (5’-ATCATTRTGATCGAGAGAGTAGTG-3’) that amplify a 331-nt segment of ORF1. GVH was detected in five out of the nine tested samples and one of these was reamplified and subjected to Sanger sequencing. The fragment of ORF1 obtained by Sanger sequencing (MW460005) was 97.5% identical to the nucleotide sequence of the corresponding GVH-like de novo contig (GeA-9) from HTS analysis and it shared 97.2% nt identity with GVH sequences reported from Portugal and USA, respectively (NC_040545 and MN716768), confirming the presence of GVH in the tested samples. This is the first report of GVH in grapevine in Greece, thus further increasing the number of vitiviruses known to infect Greek vineyards and also expanding the number of geographic locations in which GVH is recorded so far.

scholarly journals First report of Passiflora latent virus(Passiflora latent virus;PLV) infecting persimmon in Korea

Plant Disease ◽  
2020 ◽  
Author(s):  
In Sook Cho ◽  
Chang Youl Yang ◽  
Ju-Yeon Yoon ◽  
Tae Ryong Kwon ◽  
John Hammond ◽  
...  
Keyword(s):  
High Throughput Sequencing ◽  
The United States ◽  
Latent Virus ◽  
Diospyros Kaki ◽  
Rt Pcr ◽  
Genome Database ◽  
Total Rna ◽  
First Report ◽  
Contig Sequence ◽  
Pooled Sample

Passiflora latent virus (PLV), a member of the genus Carlavirus in the family Betaflexiviridae has been reported in Passiflora species in Australia, Germany, Israel, the United States, and New Zealand (Tang et al., 2008). In September 2019, leaves showing a virus-like disease with mosaic, curling and necrosis were collected from ten persimmon (Diospyros kaki Thunb.) orchards in Gyeongsang province, Korea. Total RNA from a pooled sample of leaves from 21 trees was extracted using RNeasy Plant Mini Kit (Qiagen, Germany) and subjected to high throughput sequencing. After pre-processing and Ribo-Zero rRNA Removal, a cDNA library was prepared using an Illumina TruSeq Stranded Total RNA Kit and sequenced on an Illumina NovaSeq 6000 system (Macrogen Inc. Korea). De novo assembly of the 74,862,810 reads was performed using Trinity software (r20140717); the initially assembled 213,476 contigs were screened against the NCBI viral genome database using BLASTN. By these means, 12 contigs derived from PLV were identified. Contigs with lengths of 209 to 802 nt shared nt identities of 90.70 to 94.82% with PLV isolates, covering a total of 5,169 nt (~61.6% of the full PLV genome). Two additional viruses were also detected from the pooled sample: persimmon cryptic virus (PeCV) and persimmon virus A (PeVA). To confirm PLV infection, reverse transcription-polymerase chain reaction (RT-PCR) was performed using virus-specific primers, PLV-F (5’-ACACAAAACTGCGTGTTGGA-3’) and PLV-R (5’-CAAGACCCACCTACCTCAGTGTG-3’), designed based on a 633 nt contig sequence in the polymerase gene. RT-PCR products of the expected 571 bp were obtained from two of 21 individual original samples; no asymptomatic plants were tested. Amplicons were cloned into the pGEM-T Easy Vector, and two clones per sample Sanger sequenced bidirectionally (BIONEER, Korea). The identical Sequence (GenBank LC556232) showed 99.65% nt identity to the contig, and 93.87% identity with the corresponding polymerase sequence of PLV-Rehovot isolate from passion fruit in Israel (MH379331). The two PLV positive samples showing leaf necrosis were also co-infected with PeVA, identified by RT-PCR using previously reported primers PeVAfor/ PeVArev (Morell et al., 2014), but not with PeCV (mixed with PeVA in only 1/21 plants; PeVA was found in 19/21 plants). None of the tested viruses were detected in two trees, displaying mosaic, and leaf curling, respectively. The foliar symptoms of PLV infection on passionfruit have been reported to vary throughout the year (Spiegel et al., 2007). No such observations in persimmon was possible, as the infected persimmon trees were removed and destroyed because they might pose a threat to the cultivation of passion fruits in Korea. To our knowledge, this is the first report of persimmon as a host of PLV anywhere in the world, and the first report of PLV in Korea in any host. A further survey is needed to determine possible presence of PLV on persimmon and Passiflora species.

scholarly journals First report of grapevine rupestris vein feathering virus in wine grapes in Idaho

Plant Disease ◽  
2021 ◽  
Author(s):  
Jennifer Dahan ◽  
Brandon Thompson ◽  
Jungmin Lee ◽  
Alexander V Karasev
Keyword(s):  
High Throughput Sequencing ◽  
The United States ◽  
Washington State ◽  
Vitis Vinifera L ◽  
Wine Grape ◽  
Rt Pcr ◽  
Wine Grapes ◽  
Pairwise Identity ◽  
First Report ◽  
Hop Stunt Viroid

Grapevine rupestris vein feathering virus (GRVFV) was found associated with chlorotic discolorations of leaf veins in a Greek grapevine cultivar (El Beaino et al. 2001; Abou Ghanem-Sabanadzovic et al. 2003) or with Syrah decline (Al Rwahnih et al. 2009). In the United States, GRVFV was reported to occur in California (Al Rwahnih et al. 2009) and in Washington State (Chingandu et al. 2021). Wine grape production in Idaho is known to be affected by several viruses, such as grapevine leafroll-associated virus 3 (GLRaV-3; Mekuria et al. 2009; Thompson et al. 2019a), grapevine fleck virus (GFkV; Kanuya et al. 2012), and grapevine red blotch virus (GRBV; Thompson et al. 2019b), but the GRVFV status was not addressed previously. In 2018, leaf and petiole samples from five declining Chardonnay vines were collected from a single vineyard in Canyon County of Idaho. Ribodepleted total RNA prepared from these samples was subjected to a high-throughput sequencing (HTS) analysis on a MiSeq platform as described previously (Thompson et al. 2019a), yielding between 3,623,716 and 4,467,149 300-bp paired-end reads. Briefly, raw reads were adapter and quality cleaned, mapped against the Vitis vinifera L., reference genome. Unmapped paired reads were assembled, producing between 829 and 1,996 contigs over 1,000-nt in length. All five samples were found to contain GLRaV-3 and the two common viroids, hop stunt viroid and grapevine yellow speckle viroid, while four contigs ranging in size from 1,361 to 6,736 and exhibiting homology with the GRVFV were found in three out of the five Chardonnay samples analyzed. Those GRVFV-specific contigs had 98.5-98.7% pairwise identity. A nearly complete genome of GRVFV-ID was assembled from the HTS data of one sample, and the 3’-terminus of the genome was acquired using the RACE methodology; the 6,736-nt sequence has been deposited in the GenBank database under the accession number MZ027155. BLASTn analysis of this sequence revealed 90.7% identity to the closest match in the GenBank database (MH544699, isolate SK931from Slovakia). In the fall of 2020, six commercially operating vineyards in Canyon and Nez Perce Counties of Idaho, including the original one, were sampled for the total of 26 sampled plants of white and red wine grape cultivars, based on visual symptoms of leaf reddening, leaf rolling, and chlorosis, and tested by reverse transcription (RT)-PCR using newly designed GRVFV-specific primers, GRVFV-F1 (5’- GAAGCAACAGTGCCCGTCTC -3’) and GRVFV-R1 (5’- AGGTCGCTTTACGGACCTTTTCTT -3’). Four plants were found positive for GRVFV by RT-PCR; these positive samples came from three vineyards in Canyon County, from the same wine grape cultivar, Chardonnay. Amplified RT-PCR products were directly sequenced using conventional Sanger methodology, and confirmed to represent 662-nt segments of the GRVFV genome exhibiting 98.6-99.1% pairwise identity to the HTS-derived full-length genome of GRVFV-ID (MZ027155). The four corresponding partial sequences were deposited under the accession numbers MZ020577 to MZ020580. This close identity between the GRVFV sequences from three different Idaho vineyards, coming from the same cultivar Chardonnay, may suggest a common origin of the original GRVFV infection, possibly the same supplier of the original Chardonnay planting material. The California GRVFV sequence AY706994 was 80% identical to the GRVFV-ID, while the recently reported partial sequences of GRVFV from Washington State (MT782067-MT782070; Chingandu et al. 2021) were found to be only 82-85% identical to the GRVFV-ID. Presence of GRVFV might have contributed to the decline of the original Chardonnay vines, although the exact role of GRVFV in a mixed infection with GLRaV-3 is not clear at the moment. To the best of our knowledge, this is the first report of GRVFV in wine grapes in Idaho.

scholarly journals Updating the Quarantine Status of Prunus Infecting Viruses in Australia

Viruses ◽  
2020 ◽  
Vol 12 (2) ◽  
pp. 246 ◽  
Author(s):  
Wycliff M. Kinoti ◽  
Narelle Nancarrow ◽  
Alison Dann ◽  
Brendan C. Rodoni ◽  
Fiona E. Constable
Keyword(s):  
Polymerase Chain Reaction ◽  
High Throughput Sequencing ◽  
Mottle Virus ◽  
Rt Pcr ◽  
Chain Reaction ◽  
Virus Family ◽  
First Report ◽  
Hop Stunt Viroid ◽  
Polymerase Chain ◽  
Stem Pitting

One hundred Prunus trees, including almond (P. dulcis), apricot (P. armeniaca), nectarine (P. persica var. nucipersica), peach (P. persica), plum (P. domestica), purple leaf plum (P. cerasifera) and sweet cherry (P. avium), were selected from growing regions Australia-wide and tested for the presence of 34 viruses and three viroids using species-specific reverse transcription-polymerase chain reaction (RT-PCR) or polymerase chain reaction (PCR) tests. In addition, the samples were tested using some virus family or genus-based RT-PCR tests. The following viruses were detected: Apple chlorotic leaf spot virus (ACLSV) (13/100), Apple mosaic virus (ApMV) (1/100), Cherry green ring mottle virus (CGRMV) (4/100), Cherry necrotic rusty mottle virus (CNRMV) (2/100), Cherry virus A (CVA) (14/100), Little cherry virus 2 (LChV2) (3/100), Plum bark necrosis stem pitting associated virus (PBNSPaV) (4/100), Prune dwarf virus (PDV) (3/100), Prunus necrotic ringspot virus (PNRSV) (52/100), Hop stunt viroid (HSVd) (9/100) and Peach latent mosaic viroid (PLMVd) (6/100). The results showed that PNRSV is widespread in Prunus trees in Australia. Metagenomic high-throughput sequencing (HTS) and bioinformatics analysis were used to characterise the genomes of some viruses that were detected by RT-PCR tests and Apricot latent virus (ApLV), Apricot vein clearing associated virus (AVCaV), Asian Prunus Virus 2 (APV2) and Nectarine stem pitting-associated virus (NSPaV) were also detected. This is the first report of ApLV, APV2, CGRMV, CNRNV, LChV1, LChV2, NSPaV and PBNSPaV occurring in Australia. It is also the first report of ASGV infecting Prunus species in Australia, although it is known to infect other plant species including pome fruit and citrus.

scholarly journals First Report of Tomato chlorosis virus Infecting Sweet Pepper in Costa Rica

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1482-1482 ◽  
Author(s):  
J. A. Vargas ◽  
E. Hernández ◽  
N. Barboza ◽  
F. Mora ◽  
P. Ramírez
Keyword(s):  
Costa Rica ◽  
The United States ◽  
Sweet Pepper ◽  
Nutritional Deficiencies ◽  
Total Rna ◽  
First Report ◽  
Leaf Curling ◽  
Pcr Products ◽  
Tomato Chlorosis Virus ◽  
Pepper Plants

In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5′-TGGATCTCACTGGTTGCTTG-3′)-ToCVp22RQR (5′-TAGTGTTTCAGCGCCAACAG-3′) primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5′-CATTGGTTGGGGATTACGTC-3′)-ToCVCPmRQR (5′-TCTCAGCCTTGACTTGAGCA-3′) primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) A. Solorzano-Morales et al. Plant Dis. 95:497, 2011. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008. (4) S. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of Grapevine virus A in Russian Grapevines

Plant Disease ◽  
2016 ◽  
Vol 100 (12) ◽  
pp. 2541 ◽  
Author(s):  
E. V. Porotikova ◽  
U. D. Dmitrenko ◽  
V. A. Volodin ◽  
Y. A. Volkov ◽  
S. M. Gorislavets ◽  
...  
Keyword(s):  
Grapevine Virus ◽  
First Report ◽  
Grapevine Virus A

scholarly journals First Report of Grapevine Kizil Sapak Virus in Grapevine in China

Plant Disease ◽  
2021 ◽  
Author(s):  
Fang Ren ◽  
Zunping Zhang ◽  
Xudong Fan ◽  
Guojun Hu ◽  
Yafeng Dong
Keyword(s):  
Complete Genome ◽  
High Throughput Sequencing ◽  
Pairwise Comparison ◽  
Bioinformatic Analysis ◽  
Rt Pcr ◽  
Illumina Hiseq ◽  
First Report ◽  
Hop Stunt Viroid ◽  
Pcr Products ◽  
Rapid Amplification

Grapevine Kizil Sapak virus (GKSV) is a novel member of the family Betaflexiviridae classified into the proposed genus Fivivirus within the subfamily Trivirinae. It was first discovered in USA from a grapevine originating from Turkmenistan (Al Rwahnih et al. 2019) and later in France from a grapevine accession from Iran (Marais et al. 2020). In October 2019, an asymptomatic grapevine cv. ‘Crimson Seedless’ (native to USA) was collected from Xinjiang province in China and analyzed by high-throughput sequencing (HTS). Ribosome-depleted RNA preparations were used for library synthesis followed by HTS on an Illumina HiSeq X-ten platform. A total of 29,141,024 cleaned reads were obtained, and 7,878 contigs were generated using CLC Genomics Workbench 9.5 (QIAGEN). One long contig (7,328 bp) showed 88.2% nucleotide (nt) identity with the sequence of GKSV-127 (MN172165) via Blastx, with an average coverage of 284-X. Bioinformatic analysis of the remaining contigs showed the presence of Grapevine leafroll-associated virus 4, Grapevine rupestris vein feathering virus, Grapevine fabavirus, grapevine yellow speckle viroid-1 (GYSVd-1), GYSVd-2 and Hop stunt viroid in the sample. The presence of GKSV was checked by RT-PCR using the primer GKSV-F/R (Al Rwahnih et al. 2019); the 1,240 bp PCR product was cloned using a pTOPO-T vector (Aidlab, China) and sequenced. In pairwise comparison, the obtained nt sequences shared 92.6 to 95.2% identity to the corresponding HTS sequence, confirming the presence of GKSV in the sample. The complete GKSV genome sequence was obtained as two pieces of overlapping DNA sequence using primers GKSV-20A/20B (5’-TAGTCTGGATTTCCCTACCT/5’-CTCCCTAAACTGATTTGATG) and GKSV-25A/25B (5’-GCCACTGGTGAATGAAAAGA/5’-CTAAATGAATGGGCAGGTAT) designed based on the HTS-generated sequence. The 5’ and 3’ termini were determined by rapid amplification of cDNA ends using SMARTer RACE 5’/3’ Kit (Takara, Dalian, China). The complete genome of GKSV isolate CS (MW582898) comprised 7,604 nt (without the polyA tail) and shared 77.8 to 89.2% identities with the other nine reported GKSV isolates, among which it shared the highest nt identity (89.2%) with GKSV-127. In phylogenetic analysis based on complete or nearly complete genome sequences of representative members of Betaflexiviridae, GKSV-CS clustered with the nine known GKSV isolates, forming a subclade with GKSV-127 (Supplementary Fig. 1). To determine the incidence and distribution of GKSV in China, 476 grapevine samples of 75 cultivars were collected from 20 provinces and tested by RT-PCR using primers GKSV-F/R (Al Rwahnih et al. 2019) and Vini-F1/R1 (Marais et al. 2020). The results showed that 0.42% (2 of 476) of the samples tested positive with both primers, including samples GKSV-CS and a ‘Black Monukka’ grape (native to India) also sampled from Xinjiang. Both PCR products of ‘Black Monukka’ were cloned and sequenced (MZ311588 to MZ311602) and they showed 85.1 to 88.9% nt identities to the GKSV-CS sequence. This is the first report of GKSV infecting grapevine in China. Although the pathogenicity of GKSV is yet to be determined, it has been found in several countries such as USA (Al Rwahnih et al. 2019), France (Marais et al. 2020) and China (this study). Both positive samples in this study were collected from Nanjiang region in Xinjiang province, indicating the sporadic occurrence of GKSV in this area.

scholarly journals Transmission of Grapevine leafroll-associated virus-1 (Ampelovirus) and Grapevine virus A (Vitivirus) by the Cottony Grape Scale, Pulvinaria vitis (Hemiptera: Coccidae)

Viruses ◽  
2021 ◽  
Vol 13 (10) ◽  
pp. 2081
Author(s):  
Gérard Hommay ◽  
Antoine Alliaume ◽  
Catherine Reinbold ◽  
Etienne Herrbach
Keyword(s):  
Scale Insect ◽  
Scale Insects ◽  
Grapevine Virus ◽  
First Report ◽  
Grapevine Virus A ◽  
Controlled Conditions

The cottony grape scale Pulvinaria vitis is a scale insect colonizing grapevine; however, its capacity as a vector of grapevine viruses is poorly known in comparison to other scale species that are vectors of viral species in the genera Ampelovirus and Vitivirus. The ability of P. vitis to transmit the ampeloviruses Grapevine leafroll-associated viruses [GLRaV]−1, −3, and −4, and the vitivirus Grapevine virus A (GVA), to healthy vine cuttings was assessed. The scale insects used originated from commercial vine plots located in Alsace, Eastern France. When nymphs sampled from leafroll-infected vineyard plants were transferred onto healthy cuttings, only one event of transmission was obtained. However, when laboratory-reared, non-viruliferous nymphs were allowed to acquire viruses under controlled conditions, both first and second instar nymphs derived from two vineyards were able to transmit GLRaV−1 and GVA. This is the first report of GLRaV−1 and GVA transmission from grapevine to grapevine by this species.

Sign in / Sign up

Export Citation Format

Share Document