scholarly journals Newly Discovered Natural Hosts of Tomato chlorosis virus in Costa Rica

Plant Disease ◽  
2011 ◽  
Vol 95 (4) ◽  
pp. 497-497 ◽  
Author(s):  
A. Solórzano-Morales ◽  
N. Barboza ◽  
E. Hernández ◽  
F. Mora-Umaña ◽  
P. Ramírez ◽  
...  
Keyword(s):  
Costa Rica ◽  
Nucleotide Sequence ◽  
Costa Rican ◽  
Nucleotide Sequence Analysis ◽  
Dna Fragments ◽  
Rt Pcr ◽  
Sequence Identity ◽  
Two Samples ◽  
Natural Hosts ◽  
Tomato Chlorosis Virus

Tomato chlorosis virus (ToCV) is an emerging whitefly-transmitted crinivirus (2). In Costa Rica in 2007, ToCV was detected in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants causing symptoms of severe yellowing and foliar chlorosis (1). To identify alternative hosts that may serve as virus reservoirs, 78 samples were collected from multiple species of common weeds growing adjacent to tomato nurseries in the Cartago Province, where ToCV was previously identified, during the autumn of 2008 and summer of 2009. The weeds were collected on the basis of the presence of whiteflies and/or symptoms of interveinal chlorosis, but not all samples were symptomatic for infection by ToCV. Total RNA was extracted from leaf tissue with TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed with the Qtaq One-Step qRT-PCR SYBR Kit (Clontech Laboratories, Mountain View, CA) and primers specific for the ToCV HSP70h gene (3). A 123-bp DNA fragment was amplified in five weeds, which were identified taxonomically as Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolacaceae), Plantago major (Plantaginaceae), a Brassica sp. (Brassicaceae) (two samples), and a single plant of Cucurbita moschata (Cucurbitaceae) growing next to those weeds. The amplified DNA fragments were sequenced and BLAST analysis showed 100% nucleotide sequence identity with the HSP70h gene of the Florida ToCV isolate (GenBank Accession No. AY903448). To confirm the presence of ToCV in these six weed samples, conventional RT-PCR reactions were performed using primers specific for the ToCV CPm and p22 genes as described previously (1). Nucleotide sequence analysis of the amplified DNA fragments verified their identity as ToCV, with 100% sequence identity to the CPm of the ToCV isolate of Florida (Accession No. AY903448) and the p22 gene of the Cartago, Costa Rican isolate (Accession No. FJ809714). Although the number of samples analyzed is not sufficient to allow a determination of the role of weed reservoirs in ToCV epidemics in Costa Rican tomato crops, this report on the wider natural host range of ToCV in Costa Rica may lead to a better understanding of the epidemiology of this virus and be useful in the development of disease management strategies. To our knowledge this is the first report of these weeds as natural hosts of ToCV. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) M. I. Font et al. Plant Dis. 88:82, 2004. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008.

scholarly journals First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 970-970 ◽  
Author(s):  
R. M. Castro ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez ◽  
R. W. Hammond
Keyword(s):  
Costa Rica ◽  
Sequence Analysis ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
Specific Primers ◽  
First Report ◽  
Sequence Identity ◽  
Pcr Products ◽  
Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

scholarly journals First Report of Tomato chlorosis virus and Tomato infectious chlorosis virus in Tomato Crops in France

Plant Disease ◽  
2005 ◽  
Vol 89 (11) ◽  
pp. 1243-1243 ◽  
Author(s):  
A. Dalmon ◽  
S. Bouyer ◽  
M. Cailly ◽  
M. Girard ◽  
H. Lecoq ◽  
...  
Keyword(s):  
Protein Gene ◽  
The United States ◽  
Rt Pcr ◽  
Specific Primers ◽  
Southern France ◽  
Sequence Identity ◽  
Two Samples ◽  
Dna Fragment ◽  
Tomato Chlorosis Virus ◽  
Tomato Infectious Chlorosis Virus

Since 2002, yellowing symptoms associated with high levels of white-fly populations have been observed in plants of protected tomato crops in France. Symptomatic plants exhibited interveinal yellowing areas in older leaves, followed by generalized yellowing. Symptoms were not observed in young plants or fruits. Trialeurodes vaporariorum populations were generally abundant in spring, and Bemisia tabaci (established in France for approximately 10 years) became predominant in summer and fall. To check for the presence of Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), two whitefly-transmitted criniviruses known to induce yellowing symptoms, 696 samples were collected in the major tomato-growing areas; 573 samples from southern France and 123 samples from northern France. Total RNA was extracted from each sample and analyzed using reverse transcription-polymerase chain reaction (RT-PCR). Primers specific to ToCV (2) and TICV (1,3) were used to amplify either part of the heat-shock-like protein gene HSP70h (both viruses) or part of the diverged coat protein gene (CPd), (TICV only). A 439-bp DNA fragment was obtained with ToCV primers in 178 samples from southern France collected mainly from mid-spring to early fall from 2002 to 2004. Three RT-PCR products amplified from samples collected from diverse growing areas were sequenced and showed 99 to 100% sequence identity with published ToCV sequences from Spain (GenBank Accession Nos. AF215818, AF233435, and AF215817), Portugal (GenBank Accession No. AF234029), Sicily (GenBank Accession No. AY048854), and the United States (GenBank Accession No. AF024630). Considering the high frequency of ToCV-infected samples (41 positive samples of 112 samples collected in 2002, 71 of 295 collected in 2003, and 66 of 166 collected in 2004), this virus appears to be well established in southern France but remains absent in the northern regions. The presence of TICV was tested in 485 samples using the CPd-specific primers or the HSP70h-specific primers. The virus was detected in only two samples from Nice (southeastern France) in 2003 with both primer pairs. The CPd DNA fragment (700 bp) from one of these samples was sequenced, showing 98.9% sequence identity with a TICV Japanese isolate (AB085603). Results of these assays suggest that in contrast to ToCV, TICV is not yet broadly established in France. This difference could be associated with the specificity of the vectors, since ToCV is transmitted by B. tabaci and T. vaporariorum, while TICV is transmitted only by T. vaporariorum (4). References: (1) R. H. Li et al. Plant Dis. 82:84, 1998. (2) D. Louro et al. Eur. J. Plant Pathol. 1065:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002. (4) G. C. Wisler et al. Plant Dis. 82:271, 1998.

scholarly journals First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

Plant Disease ◽  
2005 ◽  
Vol 89 (10) ◽  
pp. 1130-1130 ◽  
Author(s):  
R. W. Hammond ◽  
E. Hernandez ◽  
F. Mora ◽  
P. Ramirez
Keyword(s):  
Costa Rica ◽  
Coat Protein ◽  
Coat Protein Gene ◽  
Protein Gene ◽  
Nucleotide Sequence Analysis ◽  
Cucurbita Moschata ◽  
Rt Pcr ◽  
Greenhouse Whitefly ◽  
First Report ◽  
Two Samples

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

scholarly journals Detection of Bovine Torovirus in Fecal Specimens of Calves with Diarrhea from Ontario Farms

1998 ◽  
Vol 36 (5) ◽  
pp. 1266-1270 ◽  
Author(s):  
Lynn Duckmanton ◽  
Susy Carman ◽  
Éva Nagy ◽  
Martin Petric
Keyword(s):  
Electron Microscopy ◽  
Nucleotide Sequence ◽  
Nucleotide Sequence Analysis ◽  
Rt Pcr ◽  
Southern Ontario ◽  
Sequence Identity ◽  
Reverse Transcription Pcr ◽  
Neonatal Calves ◽  
Asymptomatic Control

Breda virus (BRV), a member of the genus Torovirus, is an established etiological agent of disease in cattle. BRV isolates have been detected in the stools of neonatal calves with diarrhea in both Iowa and Ohio and in several areas of Europe. However, this virus has been reported only once in Canada. Therefore, a study was performed to determine the extent to which bovine torovirus is present in calves with diarrhea from farms in southern Ontario. A total of 118 fecal samples from symptomatic calves and 43 control specimens from asymptomatic calves were examined by electron microscopy (EM) and reverse transcription-PCR (RT-PCR) for the presence of torovirus. Torovirus RNA was detected in 43 of the 118 diarrheic samples (36.4%) by RT-PCR with primers designed in the conserved 3′ end of the torovirus genome. By EM, torovirus particles were observed in 37 of the 118 specimens (31.4%). All but one of these samples were also positive by RT-PCR. The incidence of torovirus in the asymptomatic control specimens by RT-PCR was only 11.6%. To establish the identity of the particles observed in the diarrheic specimens, five of the amplicons from samples positive by both RT-PCR and EM were cloned and sequenced. Nucleotide sequence analysis revealed that the bovine torovirus found in southern Ontario manifests between 96 and 97% sequence identity to the BRV type 1 strain found in Iowa. This study shows that bovine torovirus is a common virus in the fecal specimens of calves with diarrhea from farms in southern Ontario and thus may be an important pathogen of cattle.

scholarly journals First Report of Cucurbit aphid-borne yellows virus in Spain

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
M. Juarez ◽  
V. Truniger ◽  
M. A. Aranda
Keyword(s):  
Nucleotide Sequence ◽  
Nucleotide Sequence Identity ◽  
Rt Pcr ◽  
Sequence Comparisons ◽  
E Coli ◽  
Sequence Identity ◽  
Tissue Print ◽  
Sigma Chemical ◽  
Beet Pseudo Yellows Virus ◽  
Cucumis Melo L

In late spring 2003, field-grown melon plants (Cucumis melo L.) showing bright yellowing of older leaves were observed near Valladolises in Campo de Cartagena, Murcia, Spain. Symptoms resembled those caused by viruses of the genus Crinivirus (family Closteroviridae), but absence or very low populations of whiteflies were observed. However, diseased foci showed clear indications of heavy aphid infestations. Later, during the fall of 2003, squash plants (Cucurbita pepo L.) grown in open fields in the same area showed similar symptoms. Tissue print hybridizations to detect Cucurbit yellow stunting disorder virus (CYSDV) and Beet pseudo yellows virus (BPYV) in symptomatic samples were negative. CYSDV and BPYV are two yellowing-inducing criniviruses previously described in Spain. In contrast, standard double-antibody sandwich enzyme-linked immunosorbent assays (DAS-ELISA) with antiserum against Cucurbit aphid-borne yellows virus (CABYV; genus Polerovirus, family Luteoviridae) that was kindly provided by H. Lecoq (INRA-Montfavet Cedex, France) were consistently positive. Definitive confirmation of CABYV associated with symptomatic samples was obtained by performing reverse-transcription polymerase chain reaction (RT-PCR) analyses for the CABYV coat protein gene. Total RNA extracts (TRI reagent; Sigma Chemical, St. Louis, MO) were obtained from symptomatic and asymptomatic leaf samples and RT-PCR reactions were carried out using the primers 5′-GAATACGGTCGCGGCTAGAAATC-3′ (CE9) and 5′-CTATTTCGGGTTCTGGACCTGGC-3′ (CE10) based on the CABYV sequence published by Guilley et al. (2). A single DNA product of approximately 600 bp was obtained only from symptomatic samples. Amplified DNA fragments from two independent samples (samples 36-2 and 37-5) were cloned in E. coli and sequenced (GenBank Accession Nos. AY529653 and AY529654). Sequence comparisons showed a 95% nucleotide sequence identity between the two sequences. A 97% and 94% nucleotide sequence identity was found among 36-2 and 37-5, respectively and the CABYV sequence published by Guilley et al. (2). CABYV seems to be widespread throughout the Mediterranean Basin (1,3) but to our knowledge, it has not previously been described in Spain. Additionally, our data suggest that significant genetic variability might be present in the Spanish CABYV populations. References: (1) Y. Abou-Jawdah et al. Crop Prot. 19:217, 2000. (2) H. Guilley et al. Virology 202:1012, 1994. (3) H. Lecoq et al. Plant Pathol. 41:749, 1992.

scholarly journals A Novel Genetic Variant of Grapevine leafroll-associated virus-3 (GLRaV-3) from Idaho Grapevines

Plant Disease ◽  
2019 ◽  
Vol 103 (3) ◽  
pp. 509-518 ◽  
Author(s):  
Brandon D. Thompson ◽  
Jennifer Dahan ◽  
Jungmin Lee ◽  
Robert R. Martin ◽  
Alexander V. Karasev
Keyword(s):  
Nucleotide Sequence ◽  
Genetic Variant ◽  
Scale Insects ◽  
Cabernet Sauvignon ◽  
Rt Pcr ◽  
Wine Grapes ◽  
Phylogenetic Groups ◽  
Sequence Identity ◽  
Foliar Symptoms ◽  
Major Constraint

Grapevine leafroll-associated virus-3 (GLRaV-3) is a major constraint on profitable grapevine cultivation. The virus is transmitted efficiently by mealybugs and soft scale insects, or through vegetative propagation by cuttings, and is present worldwide, wherever grapevines are grown. GLRaV-3 exists as a complex of genetic variants currently classified in several phylogenetic groups that can differ from each other by as much as 30% in nucleotide sequence of the whole genome. In the course of the GLRaV-3 testing of wine grapes in southern Idaho, plants of two grapevine cultivars were found to harbor a novel genetic variant of GLRaV-3, named ID45, which exhibited ≤80% nucleotide sequence identity level to the known GLRaV-3 isolates in its most conserved HSP70h gene. The ID45 variant caused no foliar symptoms in ‘Cabernet Sauvignon’ in the fall, and was demonstrated to have poor reactivity to commercial virus-specific antibodies. The entire 18,478-nt genome sequence of the GLRaV-3-ID45 was determined using a combination of high-throughput and conventional Sanger sequencing, and demonstrated to have typical organization for the genus Ampelovirus (family Closteroviridae), with only 70 to 77% identity level to the GLRaV-3 genomes from other established phylogroups. We concluded that ID45 represented a new phylogenetic group IX of GLRaV-3. Database search using ID45 nucleotide sequence as a query suggested that this novel ID45 variant is present in at least one other grape-growing state in the U.S., California, and in Brazil. An RT-PCR based test was developed to distinguish ID45 from the predominant GLRaV-3 phylogroup I found in Idaho in single and mixed infections.

scholarly journals First Report of Sweet potato chlorotic stunt virus and Sweet potato feathery mottle virus Infecting Sweet Potato in Spain

Plant Disease ◽  
2004 ◽  
Vol 88 (4) ◽  
pp. 428-428 ◽  
Author(s):  
R. A. Valverde ◽  
G. Lozano ◽  
J. Navas-Castillo ◽  
A. Ramos ◽  
F. Valdés
Keyword(s):  
Nucleotide Sequence ◽  
Sweet Potato ◽  
Morning Glory ◽  
Mottle Virus ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Potato Plants ◽  
Elisa Testing ◽  
Two Samples

Sweet potato chlorotic stunt virus (SPCSV), family Closteroviridae and Sweet potato feathery mottle virus (SPFMV), family Potyviridae are whitefly and aphid transmitted, respectively, which in double infections cause sweet potato virus disease (SPVD) that is a serious sweet potato (Ipomoea batatas Lam.) disease in Africa (2). During the past decade, sweet potato plants showing symptoms similar to SPVD have been observed in most areas of Spain. Nevertheless, not much information is available about the identity of the viruses infecting this crop in Spain. During the summer of 2002, sweet potato plants with foliar mosaic, stunting, leaf malformation, chlorosis, and ringspot symptoms were observed in several farms in Málaga (southern Spain) and Tenerife and Lanzarote (Canary Islands, Spain). Vine cuttings were collected from 21 symptomatic plants in Málaga and from eight plants on Lanzarote and six on Tenerife. Scions were grafted to the indicator hosts, Brazilian morning glory (I. setosa) and I. nil cv. Scarlett O'Hara. Three weeks after graft inoculations, all plants showed various degrees of mosaic, chlorosis, leaf malformation, and stunting. Four field collections (two from Málaga, one from Tenerife, and one from Lanzarote) with severe symptoms on I. setosa were selected for whitefly (Bemisia tabaci biotype Q) transmission experiments. Acquisition and transmission periods were 48 h. I. setosa was the acquisition host, and I. nil was the transmission host. For each isolate, groups of 10 whiteflies per I. nil plant were used. All I. nil plants used as transmission hosts with the four, field collections showed chlorosis and leaf malformation. Reverse-transcription polymerase chain reaction (RT-PCR) was performed on I. setosa (grafted with the four selected field collections) and I. nil plants (from the whitefly transmission experiments) with primers for the HSP70h gene of SPCSV. A 450-bp DNA fragment was obtained with all I. setosa and I. nil samples. Sequencing of the 450-bp DNA from two samples from Málaga yielded a nucleotide sequence with 98 to 99% similarity to the HSP70h gene of West African SPCSV isolates. Foliar samples from I. setosa, originally grafted with the 21 vine cuttings, were used for nitrocellulose membrane enzyme-linked immunosorbent assay (NCM-ELISA) testing with antiserum specific to SPFMV-RC (provided by J. Moyer, North Carolina State University, Raleigh). Positive control was sap extract from I. setosa that was infected with the common strain of SPFMV. Procedures for NCM-ELISA were as described (4). NCM-ELISA testing suggested that SPFMV was present in all samples. RT-PCR was conducted with degenerate primers POT1/POT2 (1). The nucleotide sequence that was amplified by these two primers spans part of the NIb protein and part of the coat protein gene of potyviruses. All samples yielded the expected 1.3-kb DNA. Sequencing of the RT-PCR products of two isolates from Malaga and sequence comparisons yielded nucleotide sequences with 97% similarity to two East African isolates (Nam 1 and Nam 3) of SPFMV (3). These results confirm the presence of SPCSV and SPFMV in sweet potato in Spain. References: (1) D. Colinet and J. Kummert. J. Virol. Methods 45:149, 1993. (2) R. W. Gibson et al. Plant Pathol. 47:95, 1998. (3) J. F. Kreuze et al. Arch. Virol. 145:567, 2000. (4) E. R. Souto et al. Plant Dis. 87:1226, 2003.

Sign in / Sign up

Export Citation Format

Share Document