First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

Download Full-text

First Report of Tomato chlorosis virus in Tomato in Costa Rica

Plant Disease ◽

10.1094/pdis-93-9-0970a ◽

2009 ◽

Vol 93 (9) ◽

pp. 970-970 ◽

Cited By ~ 4

Author(s):

R. M. Castro ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez ◽

R. W. Hammond

Keyword(s):

Costa Rica ◽

Sequence Analysis ◽

Nucleotide Sequence Analysis ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Tomato Chlorosis Virus

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First Report of Cherry virus A and Little cherry virus-1 in Poland

Plant Disease ◽

10.1094/pdis.2004.88.8.909c ◽

2004 ◽

Vol 88 (8) ◽

pp. 909-909 ◽

Cited By ~ 12

Author(s):

B. Komorowska ◽

M. Cieślińska

Keyword(s):

Nucleotide Sequence ◽

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Germplasm Collection ◽

Mottle Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Primer Sets

Cherry virus A (CVA), a member of the genus Capillovirus, has been reported in sweet cherry in Germany, Canada, and Great Britain. No data are available on the effects of CVA on fruit quality and yield of infected trees. Little cherry disease (LChD) occurs in most cherry growing areas of the world. Symptoms on sensitive cultivars include discolored fruit that remain small, pointed in shape, and tasteless. Three Closterovirus spp. associated with LChD have been described (Little cherry virus-1 [LChV-1], LChV-2, and LChV-3). Diseased local and commercial cultivars of sour cherry trees were found in a Prunus sp. germplasm collection and orchards in Poland during the 2003 growing season. The foliar symptoms included irregular, chlorotic mottling, distortion, and premature falling of leaves. Some of the diseased trees developed rosette as a result of decreased growth and shortened internodes. Severely infected branches exhibited dieback symptoms. Because the symptoms were suggestive of a possible virus infection, leaf samples were collected from 38 trees and assayed for Prune dwarf virus and Prunus necrotic ringspot virus using double antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA). RNA extracted from leaves was used in a reverse transcription-polymerase chain reaction (RT-PCR) with the One-Step RT-PCR with Platinum Taq (Invitrogen Life Technologies) and primer sets specific for CVA (1), LChV-1 (3), and LChV-2 (3). The RNA samples were also tested using RT-PCR for detection of Cherry mottle leaf virus (CMLV), Cherry necrotic rusty mottle virus (CNRMV), and Cherry green ring mottle virus (CGRMV) with specific primer sets (2). Amplification of a 397-bp coat protein gene product confirmed infection of 15 trees with CVA. A 419-bp fragment corresponding to the coat protein gene of LChV-1 was amplified from cv. Gisela rootstock and local cv. WVIII/1. To confirm RT-PCR results, CVA amplification products from local cv. WX/5 and LChV-1 from cvs. Gisela and WVIII/1 were cloned in bacterial vector pCR 2.1-TOPO and then sequenced. The sequences were analyzed with the Lasergene (DNASTAR, Madison, WI) computer program. The alignment indicated that the nucleotide sequence of cv. WX/5 was closely related to the published sequences of CVA (Genbank Accession No. NC_003689) and had an 89% homology to the corresponding region. The nucleotide sequence similarity between the 419-bp fragment obtained from cvs. Gisela and WVIII/1 was 87% and 91%, respectively, compared with the reference isolate of LChV-1 (Genbank Accession No. NC_001836). The sampled trees tested negative for LChV-2, CGRMV, CMLV, and CNRMV using RT-PCR. Some trees tested positive for PNRSV and PDV. To our knowledge, this is the first report of CVA and LChV-1 in Poland. References: (1) D. James and W. Jelkmann. Acta Hortic. 472:299, 1998. (2) M. E. Rott and W. Jelkmann. Eur. J. Plant Pathol. 107:411,2001. (3) M. E. Rott and W. Jelkmann. Phytopathology. 91:61, 2001.

Download Full-text

First Report of Cucurbit yellow stunting disorder virus on Melon in China

Plant Disease ◽

10.1094/pdis-94-4-0485a ◽

2010 ◽

Vol 94 (4) ◽

pp. 485-485 ◽

Cited By ~ 6

Author(s):

L. Z. Liu ◽

Y. Y. Chen ◽

W. M. Zhu

Keyword(s):

Coat Protein ◽

Coat Protein Gene ◽

Fragment Length ◽

Protein Gene ◽

Disease Incidence ◽

Rt Pcr ◽

First Report ◽

Genes Encoding ◽

Pcr Products ◽

Symptomatic Leaf

Melon (Cucumis melo L.) plants in commercial fields in Shanghai, Jiangsu, and Zhejiang exhibited stunting, deformation, interveinal chlorosis, and leaf mottling in the spring of 2008. In addition, adult and immature whiteflies (Bemisia tabaci biotype B) were present in these melon fields. Thirty-two symptomatic leaf samples were collected from these fields for further analysis (9 from Nanhui County in Shanghai, 11 from Fengxian County in Shanghai, 6 from Kunshan County of Jiangsu, and 6 from Jiashan County of Zhejiang). Total RNA was extracted from these samples along with asymptomatic control plants and screened for the presence of Cucurbit yellow stunting disorder virus (CYSDV) by using primers specific to genes encoding coat protein (2) and HSP70h (1) of CYSDV through reverse transcription (RT)-PCR methods. RNA was successfully extracted from 31 of 32 symptomatic samples. All 31 symptomatic leaf samples tested with coat protein primers were positive for CYSDV and yielded the expected fragment length of 394 bp. The RT-PCR products of the coat protein gene from all 31 isolates were cloned and found to be identical in sequence. Thus, only one was deposited in GenBank (No. GU189240). The submitted sequence of the amplified part of the coat protein gene was 99% identical to the sequence of coat protein gene of CYSDV from Jordan, France, and Florida (GenBank Accession Nos. DQ903107, AY204220, and EU596528, respectively) and 98% identical to that of an isolate from Spain (GenBank Accession No. AJ243000). Similarly, all 31 samples were also positive for CYSDV with the primers specific to HSP70h and yielded the expected fragment length of 175 bp. The RT-PCR products of the HSP70h gene from these isolates were also cloned and found to be identical in sequence. The sequence of the amplified portion of the HSP70h gene was found to be identical to the sequence of HSP70h of CYSDV deposited in GenBank (No. AJ439690.2). CYSDV was noticed in all three surveyed regions and the percentage of disease incidence was approximately 68% in all these regions. The occurrence of CYSDV has been previously reported in Europe (Spain and France), southern Asia (Iran and Jordan), North America (United States and Mexico), and other countries (1). To our knowledge, this is first report of CYSDV in China. References: (1) Y.-W. Kuo et al. Plant Dis. 91:330, 2007. (2) J. E. Polston et al. Plant Dis. 92:1251, 2008.

Download Full-text

First Report of Sinaloa Tomato Leaf Curl Geminivirus in Costa Rica

Plant Disease ◽

10.1094/pdis.1999.83.3.303c ◽

1999 ◽

Vol 83 (3) ◽

pp. 303-303 ◽

Cited By ~ 9

Author(s):

A. M. Idris ◽

G. Rivas-Platero ◽

I. Torres-Jerez ◽

J. K. Brown

Keyword(s):

Costa Rica ◽

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Costa Rican ◽

Tomato Leaf ◽

First Report ◽

The Core ◽

Sequence Identity ◽

Tomato Leaf Curl

In October 1998, geminivirus-like symptoms were widespread in tomato plantings near Turrialba, Costa Rica. Isolates from several fields were experimentally transmitted to tomato seedlings with whiteflies from a Bemisia tabaci (Genn.) colony maintained at CATIE, which resulted in interveinal chlorosis and leaf curling symptoms indistinguishable from those observed in the field. Total DNA was extracted from leaves of 16 of these experimentally inoculated plants and assayed by polymerase chain reaction (PCR) for the presence of begomovirus DNA with the degenerate primers AV324 and AC889 (2) to amplify the core region of the coat protein gene (core Cp). PCR yielded the expected size core Cp fragment (576 bp) from 16 of 16 samples. The core Cp fragments of six samples were cloned and sequenced. A comparison of the core Cp sequences with reference begomovirus sequences indicated all Costa Rican isolates were >95% identical to Sinaloa tomato leaf curl geminivirus reported in 1994 from Sinaloa, Mexico (STLCV-SINALOA). Virus identity was confirmed by multiple sequence alignments of the viral coat protein gene (Cp) and the common region (CR) sequences of A and B components (CR-A and CR-B), respectively, with analogous reference begomovirus sequences. Cp and CRs were obtained by PCR, and amplicons were cloned and sequenced as described (1). The Cp open reading frame (ORF; 756 nucleotides) (AF110515) identified within the A component amplicon shared 92.9% sequence identity with STLCV-SINALOA Cp (AF040635). The CR sequences of the A (AF1150516) and B (AF110517) components (163 nucleotides) shared 98.2% sequence identity with each other, suggesting that they were amplified from the cognate A and B components of the same virus. Further, the CR-A and CR-B components contained the same putative Rep binding site, TGGGGT-AA-TGGGGT, which was also identical to that of STLCV-SINALOA. The mean percent divergences between viral Cp and CR amplicons (n = 6+) ranged from 98 to 100%. Collectively, STLCV-like symptoms in tomato, >92% identity between viral Cp sequences, and identical CR iterons indicate that the Costa Rican tomato virus is STLCV, or a closely related strain. This is the first report of an STLCV-like begomovirus in tomato in Costa Rica (STLCV-CR). References: (1) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Citrus tristeza virus in Citrus Orchards in Bosnia and Herzegovina

Plant Disease ◽

10.1094/pdis-05-13-0548-pdn ◽

2013 ◽

Vol 97 (12) ◽

pp. 1665-1665

Author(s):

D. Delić ◽

M. Afechtal ◽

K. Djelouah ◽

B. Lolić ◽

A. Karačić

Keyword(s):

Coat Protein ◽

Bosnia And Herzegovina ◽

Coat Protein Gene ◽

Citrus Tristeza Virus ◽

Protein Gene ◽

Rt Pcr ◽

First Report ◽

Citrus Orchards ◽

Tristeza Virus ◽

Das Elisa

The citrus growing area in Bosnia and Herzegovina (B&H) is limited to the confluence of the river Neretva, which is close to the Adriatic coastal region. Approximately 6 ha are grown in the country. Mandarins (Citrus reticulata Blanco) and lemons (Citrus limon L.) grafted on trifoliate orange (Poncirus trifoliata (L.) Raf.) are the most cultivated species. In June 2012, 25 samples were collected from individual trees from three locations in Herzegovina district of B&H (Mostar, Čapljina, and Ljubuški). Samples of different Citrus spp. (C. reticulata Blanco, C. aurantium L., C. limon L., C. sinensis (L.) Osbeck, P. trifoliata (L.) Raf., and Fortunella margarita Lour) and varieties were collected from infield plants, commercial citrus orchards, and a nursery. Out of 25, 10 citrus trees exhibited leaves chlorosis, whereas as all others were apparently symptomless. Double antibody sandwich (DAS)-ELISA test, using commercial kit from the DSMZ, Germany (product code AS-0988), was carried out to confirm the presence of Citrus tristeza virus (CTV). In addition, further analyses were performed using reverse transcription (RT)-PCR targeting the coat protein gene (2). CTV was detected in 8 out of the 25 tested samples with DAS-ELISA, whereas CTV was detected in 14 samples by RT-PCR. Being grafted on P. trifoliata rootstock, no typical CTV symptoms in the field were observed on the CTV-infected trees; interestingly, the lab analyses evidenced the CTV presence in all inspected locations of the Herzegovina district. To our knowledge, this is the first report of CTV in Bosnia and Herzegovina; nevertheless, the virus presence is also reported from neighboring countries Croatia (1) and Montenegro (3). The PCR products of four samples were additionally analyzed by sequencing. The preliminary results by sequencing of the coat protein gene of four selected CTV isolates (Accessions HF947341, HF947342, HF947343, and HF947347) showed 99% nucleotide identity with the CTV resistance breaking isolates from Montenegro (FR871866) and Croatia (EU579422). Although a very small number of samples were tested in this study, CTV appears to be widely distributed in the citrus orchards of the country. This could be related to the traditional use of tolerant P. trifoliata rootstock that prevents the development of the tristeza decline as well as to the virus isolates present in the region, which appear not to cause another economically devastating CTV disease such as stem pitting. Further research will be dedicated to the biological properties of the genetic variability of these identified CTV isolates and the assessment of potential aphid vectors. References: (1) S. Černi et al. Plant Dis. 89:342, 2005. (2) M. E. Hilf et al. Options Méditerranéennes B 65:89, 2009. (3) T. Papic et al. Plant Dis. 89:434, 2005.

Download Full-text

First Report of Melon necrotic spot virus in Panama

Plant Disease ◽

10.1094/pd-90-1261a ◽

2006 ◽

Vol 90 (9) ◽

pp. 1261-1261 ◽

Cited By ~ 4

Author(s):

J. A. Herrera ◽

M. C. Cebrián ◽

C. Jordá

Keyword(s):

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Plant Viruses ◽

Japanese Isolate ◽

Necrotic Spot ◽

Rt Pcr ◽

Spot Virus ◽

First Report ◽

Melon Necrotic Spot Virus

Melon (Cucumis melo L.) represents an important crop in Panama where 1,449 ha were cultivated in 2005 with 920.4 ha of this crop planted in Los Santos Province (southeast region of Panama). During April 2005 and January 2006, several melon plants in commercial fields in that area showed stem necrosis at the crown level, and less frequently, small necrotic spots on leaves. In some cases, wilting and plant death were observed. Symptoms were similar to those caused by the carmovirus Melon necrotic spot virus (MNSV). Cysts of Olpidium bornovanus also were observed in the roots of all affected melon plants. Roots from eight symptomatic plants collected in seven fields were positive using doubleantibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) with an antiserum specific for MNSV (BIO-RAD, Life Sciences, Barcelona, Spain). To confirm these results, total RNA was extracted from symptomatic plants and used in one-step reverse transcription-polymerase chain reaction (RT-PCR) with Platinum Taq (Invitrogen Life Technologies, Barcelona, Spain). MNSV specific primers designed to amplify a region of the coat protein gene were used in the assays. Amplicons of the expected size (651 bp) were generated from symptomatic plant tissue, but were not produced from healthy plants or the water used as negative controls. To establish the authenticity of this virus, RT-PCR products were purified with the High Pure PCR Product Purification Kit (Roche Diagnostics, Mannheim, Germany) and directly sequenced. Nucleotide sequences were analyzed by using the basic local alignment search tool (BLAST) (1). The primers produced two amplicons with different but similar sequences. One sequence (GenBank Accession No. DQ443546) showed 92% identity to the coat protein gene of the MNSV Spanish isolate (GenBank Accession No. AY330700) and the MNSV Dutch isolate (GenBank Accession No. M29671) and 88% identity to the Japanese isolate (GenBank Accession No. AB189944). The second sequence (GenBank Accession No. DQ443547) was 93% identical with the Spanish and Dutch MNSV isolates, 88% identical with the Japanese isolate, and 100% identical with sequences from commercial melon seed previously isolated in our laboratory (GenBank Accession No. DQ443545). Infected seed may be a concern with regard to long distance spread of the virus independent of the vector (3) and should be considered in disease management strategies. MNSV has been previously reported in Japan, the Netherlands, the United Kingdom, the United States (2), Guatemala (4), Mexico, Honduras, and Uruguay (C. Jordá, unpublished). To our knowledge, this is the first report of MNSV in Panama. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) A. A. Brunt et al. Plant Viruses Online: Descriptions and Lists from the VIDE Database. Online Publication, 1996. (3) R. N. Campbell et al. Phytopathology 86:1294, 1996. (4) C. Jordá et al. Plant Dis. 89:338, 2005.

Download Full-text

First Report of Grapevine leafroll-associated virus 4 and 5 in Grapevines in China

Plant Disease ◽

10.1094/pdis-94-1-0130a ◽

2010 ◽

Vol 94 (1) ◽

pp. 130-130 ◽

Cited By ~ 8

Author(s):

G.-Q. Pei ◽

Y.-F. Dong ◽

Z.-P. Zhang ◽

X.-D. Fan

Keyword(s):

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Germplasm Collection ◽

The United States ◽

Nucleotide Identity ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Single Clone

Grapevine leafroll disease (GLD) is one of the most important diseases of grapevines worldwide. Nine serologically distinct viruses in the Closteroviridae family are associated with GLD. Previous studies reported that Grapevine leafroll-associated virus (GLRaV) -1, -2, -3, and -7 were present in grapevines in China with GLRaV-1 and -3 the predominant viruses associated with GLD (1). To confirm if GLRaV-4 and -5 were also present in China, 36 dormant canes from individual vines of 29 cultivars that showed GLD leaf symptoms during the growing season were collected from the germplasm collection plot of the Research Institute of Pomology, Chinese Academy of Agricultural Sciences. Total RNA extracted by a silica capture protocol (2) from phloem-enriched bark of 36 samples was tested separately for GLRaV-4 and -5 by reverse transcription (RT)-PCR using virus-specific primers. Primers LR4F (5′-ACATTCTCCACCTTGTGCTTTT-3′) and LR4R (5′-CATACAAGCGAGTGCAATTAC-3′) (4) were used to amplify a 321-bp fragment corresponding to a partial region of the HSP70 gene from GLRaV-4. One sample from cv. Autumn Royal was infected by GLRaV-4. The amplicon was cloned and a single clone was sequenced (GenBank Accession No. GQ246624) that showed 99% nucleotide identity with a corresponding region of a GLRaV-4 isolate from the United States (Accession No. AF039553). Since antiserum specific to GLRaV-4 was unavailable, a second pair of primers, LR4CP-F (5′-GGTGTCCAGCGCTTCCAA-3′) and LR4CP-R (5′-GCCAGAGAAGCATCGTAA-3′), was designed on the basis of the sequence of GLRaV-4 from Chile (Accession No. EU746620) that amplified a 300-bp fragment specific to the coat protein gene of GLRaV-4. The amplicon was cloned and a single sequence (Accession No. GQ479041) was compared with a corresponding nucleotide sequence of GLRaV-4 from Chile (Accession No. EU746621) showing 99% identity. A sample from cv. Malaga Rose was positive when tested by ELISA with antibodies specific to GLRaV-5 (Neogen Europe, Ltd. Scotland, UK) and this was confirmed by amplification of a 690-bp fragment corresponding to the GLRaV-5 coat protein gene using virus-specific primers LR5F (5′-CCCGTGATACAAGGTAGGACA-3′) and LR5R (5′-CAGACTTCACCTCCTGTTAC-3′) (3). The amplicon was cloned and a single clone was sequenced (Accession No. GQ246625) that showed 95% nucleotide identity with the CP gene sequence of GLRaV-5 from Argentina (Accession No. EU815935). To our knowledge, this is the first report of GLRaV-4 and -5 in grapevines in China. Confirmation of these viruses in China is very important for producing virus-free plants and this information also will be helpful in developing a multiplex RT-PCR assay to simultaneously detect multiple GLRaVs and helpful with studies on the molecular variability of these viruses. References: (1) Y. Dong et al. China Fruits 6:9, 2005. (2) X. Foissac et al. Acta Hortic. 550, 37, 2001. (3) X. Good and J. Monis. Phytopathology 91:274, 2001. (4) F. Osman et al. J. Virol. Methods 141:22, 2007.

Download Full-text

First Report of Raspberry bushy dwarf virus in Rubus multibracteatus from China

Plant Disease ◽

10.1094/pdis.2003.87.5.603a ◽

2003 ◽

Vol 87 (5) ◽

pp. 603-603 ◽

Cited By ~ 13

Author(s):

C. J. Chamberlain ◽

J. Kraus ◽

P. D. Kohnen ◽

C. E. Finn ◽

R. R. Martin

Keyword(s):

Amino Acid ◽

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Dwarf Virus ◽

Enzyme Linked Immunosorbent Assay ◽

Black Raspberry ◽

First Report ◽

Raspberry Bushy Dwarf Virus ◽

Plant Pathol

Raspberry bushy dwarf virus (RBDV), genus Idaeovirus, has been reported in commercial Rubus spp. from North and South America, Europe, Australia, New Zealand, and South Africa. Infection can cause reduced vigor and drupelet abortion leading to crumbly fruit and reduced yields (3,4). In recent years, Rubus germplasm in the form of seed, was obtained on several collection trips to The People's Republic of China to increase the diversity of Rubus spp. in the USDA-ARS National Clonal Germplasm Repository, (Corvallis, OR). Before planting in the field, seedlings were tested for the presence of RBDV, Tomato ringspot virus, and Tobacco streak virus using triple-antibody sandwich enzyme-linked immunosorbent assay (TAS-ELISA) (antiserum produced by R. R. Martin). One symptomless plant of R. multibracteatus H. Lev. & Vaniot (PI 618457 in USDA-ARS GRIN database), from Guizhou province in China, tested positive for RBDV (RBDV-China). After mechanical transmission on Chenopodium quinoa Willd., this isolate produced typical symptoms of RBDV (3). To determine if RBDV-China was a contaminant during the handling of the plants, or if the source was a seedborne virus, the coat protein gene was sequenced and compared to published sequences of RBDV. RNA was extracted from leaves of R. multibracteatus and subjected to reverse transcription-polymerase chain reaction (RT-PCR) using primers that flank the coat protein gene. Products from four separate PCR reactions were sequenced directly or were cloned into the plasmid vector pCR 2.1 (Invitrogen, Carlsbad, CA) and then sequenced. The coding sequence of the coat protein gene of RBDV-China was 87.5% (722/825) identical to that isolated from black raspberry (Genbank Accession No. s55890). The predicted amino acid sequences were 91.6% (251/274) identical. Previously, a maximum of five amino acid differences had been observed in the coat proteins of different RBDV strains (1). The 23 differences observed between RBDV-China and the isolate from black raspberry (s55890) confirm that the RBDV in R. multibracteatus is not a greenhouse contaminant but is indeed a unique strain of RBDV. In addition, monoclonal antibodies (MAbs) to RBDV (2) were tested against RBDV-China. In these tests, MAb D1 did not detect RBDV-China, whereas MAb R2 and R5 were able to detect the strain. This is the first strain of RBDV that has been clearly differentiated by MAbs using standard TAS-ELISA tests. Although RBDV is common in commercial Rubus spp. worldwide, to our knowledge, this is the first report of RBDV in R. multibracteatus, and the first report of RBDV from China. The effects of this new strain of RBDV could be more or less severe, or have a different host range than previously studied strains. It is more divergent from the type isolate than any other strain that has been studied to date. Phylogenetic analysis of coat protein genes of RBDV may be useful in understanding the evolution and spread of this virus. References: (1) A. T. Jones et al. Eur. J. Plant Pathol. 106:623, 2000. (2) R. R. Martin. Can. J. Plant. Pathol. 6:264, 1984. (3) A. F. Murant. Raspberry Bushy Dwarf. Page 229 in: Virus Diseases of Small Fruits. R. H. Converse, ed. U.S. Dep. Agric. Agric. Handb. 631, 1987. (4) B. Strik and R. R. Martin. Plant Dis. 87:294, 2003.

Download Full-text

Detection of a Region of the Coat Protein Gene of Grapevine Fanleaf Virus by RT-PCR in the Nematode VectorXiphinema index

Plant Disease ◽

10.1094/pd-78-1087 ◽

1994 ◽

Vol 78 (11) ◽

pp. 1087 ◽

Cited By ~ 10

Author(s):

D. ESMENJAUD

Keyword(s):

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Rt Pcr ◽

Grapevine Fanleaf Virus

Download Full-text

Detection and Confirmation of Potato mop-top virus in Potatoes Produced in the United States and Canada

Plant Disease ◽

10.1094/pdis.2004.88.4.363 ◽

2004 ◽

Vol 88 (4) ◽

pp. 363-367 ◽

Cited By ~ 40

Author(s):

H. Xu ◽

T.-L. DeHaan ◽

S. H. De Boer

Keyword(s):

United States ◽

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

The North ◽

Potato Mop Top Virus ◽

Pcr Targeting

Potato mop-top virus (PMTV) was detected in potatoes grown in the United States and Canada during surveillance testing by a reverse transcription-polymerase chain reaction (RT-PCR) targeting the coat protein gene in RNA3. Out of 3,221 lots of seed and ware potatoes that were tested, 4.3% were positive for PMTV. The reliability of the survey results was confirmed by reextraction of selected samples and additional RT-PCR tests using two primer sets targeting gene segments in RNA2 and RNA3. Amplicons generated from RNA2 and RNA3 were identified by analysis of fragment length polymorphisms after digestion with BamHI and HindIII, respectively. PMTV was further identified by enzyme-linked immunosorbent assay, bioassay on Nicotiana debneyi, and transmission electron microscopy. Sequencing of a portion of the coat protein gene revealed near 100% identity among isolates from the United States and Canada and >97% homology of the North American isolates with European isolates.

Download Full-text