First Report of Tomato chlorosis virus in Tomato in Costa Rica

In early 2007, severe yellowing and chlorosis symptoms were observed in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies, including the greenhouse whitefly Trialeurodes vaporariorum (Westwood), were observed in the fields and on symptomatic plants. Total RNA was extracted from silica gel-dried tomato leaf tissue of 47 representative samples (all were from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed separately with each of the four primer sets with the Titan One-Tube RT-PCR Kit (Roche Diagnostics Corp., Chicago IL). Specific primers used for the detection of the criniviruses, Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), were primer pair ToCV-p22-F (5′-ATGGATCTCACTGGTTGCTTGC-3′) and ToCV-p22-R (5′-TTATATATCACTCCCAAAGAAA-3′) specific for the p22 gene of ToCV RNA1 (1), primer pair ToCVCPmF (5′-TCTGGCAGTACCCGTTCGTGA-3′) and ToCVCPmR (5′-TACCGGCAGTCGTCCCATACC-3′) designed to be specific for the ToCV CPm gene of ToCV RNA2 (GenBank Accession No. AY903448) (2), primer pair ToCVHSP70F (5′-GGCGGTACTTTCGACACTTCTT-3′) and ToCVHSP70R (5′-ATTAACGCGCAAAACCATCTG-3′) designed to be specific for the Hsp70 gene of RNA2 of ToCV (GenBank Accession No. EU284744) (1), and primer pair TICV-CP-F and TICV-CP-R specific for the coat protein gene of TICV (1). Amplified DNA fragments (582 bp) were obtained from nine samples, four from the greenhouse and five from the open field, with the ToCV-p22 specific primers and were cloned into the pCRII TOPO cloning vector (Invitrogen, Carlsbad, CA). Nucleotide sequence analysis of all purified RT-PCR products verified their identity as ToCV, sharing 99.5 to 100% sequence identity among themselves and 96% to 98% sequence identity with previously reported ToCV p22 sequences from Florida (Accession No. AY903447), Spain (Accession No. DQ983480), and Greece (Accession No. EU284745). The presence of ToCV in the samples was confirmed by additional amplification and sequence analysis of the CPm (449-bp fragment) and Hsp70 (420-bp fragment) genes of ToCV RNA2 and sharing 98 to 99% sequence homology to Accession Nos. AY903448 and EU284774, respectively. One representative sequence of the p22 gene of the Costa Rican isolate was deposited at GenBank (Accession No. FJ809714). No PCR products were obtained using either the TICV-specific primers nor from healthy tomato tissue. The ToCV-positive samples were collected from a region in the Central Valley around Cartago, Costa Rica. To our knowledge, this is the first report of ToCV in Costa Rica. The economic impact on tomato has not yet been determined. Studies are underway to determine the incidence of ToCV in Costa Rica field-grown and greenhouse tomatoes. References: (1) A. R. A. Kataya et al. Plant Pathol. 57:819, 2008. (2) W. M. Wintermantel et al. Arch. Virol. 150:2287, 2005.

Download Full-text

First Report of Natural Infection of Zucchini by Tomato Chlorosis Virus and Cucurbit Chlorotic Yellows Virus in China

Plant Disease ◽

10.1094/pdis-05-20-0932-pdn ◽

2021 ◽

Author(s):

Xiaohui Sun ◽

Ning Qiao ◽

Xianping Zhang ◽

Lianyi Zang ◽

Dan Zhao ◽

...

Keyword(s):

Natural Infection ◽

Pcr Analysis ◽

Control Group ◽

Rt Pcr ◽

Degenerate Primers ◽

Specific Primers ◽

First Report ◽

Sequence Identity ◽

Tomato Chlorosis Virus ◽

Cucurbit Chlorotic Yellows Virus

Zucchini (Cucurbita pepo) is an extensively cultivated and important economic cucurbit crop in China. In September 2018 and 2019, interveinal chlorosis and yellowing symptoms, suspected to be caused by either tomato chlorosis virus (ToCV; genus Crinivirus) or cucurbit chlorotic yellows virus (CCYV; genus Crinivirus) or by their co-infection, were observed on zucchini plants in a greenhouse in Shandong Province, China. The incidence of the disease in the greenhouse was 20–30%. To identify the causal agent(s) of the disease, leaf samples from 66 zucchini plants were collected in 14 greenhouses in the cities of Shouguang (n = 12), Dezhou (n = 36), Qingzhou (n = 12), and Zibo (n = 6) in Shandong. Four whitefly (Bemisia tabaci) samples and four symptomatic tomato samples were also collected from these sampling sites (one each for each site) because numerous whiteflies were observed in the sampling greenhouses and ToCV was previously reported in greenhouse tomato plants from these regions (Zhao et al. 2014). To determine whether the symptoms were associated with Crinivirus infection, reverse transcription polymerase chain reaction (RT-PCR) using Crinivirus-specific degenerate primers (CriniRdRp251F/CriniRdRp995R) (Wintermantel and Hladky 2010) was performed first on total RNA extracted using the TRIzol protocol (Jordon-Thaden et al. 2015). Thereafter, the RNA samples were subjected to RT-PCR with ToCV- or CCYV-specific primers (Sun et al. 2016; Gan et al. 2019). Of the 66 zucchini samples, 54 tested positive by the degenerate crinivirus primer pair; and among them, 10 tested positive for ToCV only, 40 positive for CCYV only, and 4 positive for both viruses. Interestingly, while both viruses were detected in all B. tabaci samples, only ToCV was detected in the tomato samples (n = 4). To confirm the identity of the viruses, the amplicons of ToCV (four samples each of tomato, B. tabaci and zucchini) and CCYV (four samples each of B. tabaci and zucchini) were Sanger sequenced (Tsingke Biotechnology Co., Ltd., Beijing, China) after cloning into pMD18-T vectors (Takara, Shiga, Japan). BLASTn analysis demonstrated that all sequences were identical to their respective amplicons. The ToCV sequences (GenBank accession numbers: tomato, MN944406; B. tabaci, MN944404; zucchini, MN944405) shared 100% sequence identity with isolates from Beijing (KT751008, KC887999, KR184675, and KP335046), Hebei (KP217196), and Shandong (KX900412). The CCYV sequence (GenBank accession number MT396249) shared 99.9% sequence identity with isolates China (JN126046, JQ904629, KP896506, KX118632, KY400633, and MK568545), Greece (LT716000, LT716001, LT716002, LT716005, and LT716006), and Cyprus (LT992909, LT992910, and LT992911). To assess the transmissibility of ToCV and CCYV, virus-free B. tabaci (n = 30) were placed in ToCV or CCYV-infected zucchini plants for one day for virus acquisition. Thereafter, the whiteflies were transferred into virus-free zucchini seedlings (cv. ‘Zaoqingyidai’, 4-leaf-stage, n = 6 for each of the control, ToCV and CCYV treatment) for one day. Three weeks after inoculation, all plants that were inoculated with either ToCV or CCYV displayed same symptoms as those observed in the greenhouses, whereas plants in the control group remained symptom free. RT-PCR analysis using ToCV- and CCYV-specific primers confirmed the infection of the plants with the respective virus, whereas control plants were free from the viruses. CCYV has been previously reported on zucchini in Algeria (Kheireddine et al. 2020), Iran (LR585225), and Cyprus (LT992910). To our knowledge, this is the first report of CCYV infection in zucchini in China, and moreover the first report of ToCV infection in zucchini in the world. Clearly, stringent management is needed to minimize the losses caused by these viruses in greenhouse operations in the region.

Download Full-text

First Report of Beet pseudo-yellows virus on Cucurbita moschata and C. pepo in Costa Rica

Plant Disease ◽

10.1094/pd-89-1130b ◽

2005 ◽

Vol 89 (10) ◽

pp. 1130-1130 ◽

Cited By ~ 3

Author(s):

R. W. Hammond ◽

E. Hernandez ◽

F. Mora ◽

P. Ramirez

Keyword(s):

Costa Rica ◽

Coat Protein ◽

Coat Protein Gene ◽

Protein Gene ◽

Nucleotide Sequence Analysis ◽

Cucurbita Moschata ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

First Report ◽

Two Samples

In early 2004, severe yellowing and chlorosis were observed in field-grown cucurbits in Costa Rica. Symptoms resembled those of the genus Crinivirus (family Closteroviridae), and large populations of whiteflies were observed in the fields and on symptomatic plants. Although the identity of the whiteflies on the curcurbits was not determined, the greenhouse whitefly, Trialeurodes vaporariorum (Westwood) is known to be present in the region from where the samples were obtained. To identify the causal agent of the disease, leaf samples of symptomatic plants were collected from several farms. The leaf samples were dried with silica gel. Total RNA was extracted from leaf tissue of eight representative samples (two from healthy plants and six from symptomatic plants) using TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription-polymerase chain reactions (RT-PCR) containing one primer set at a time were performed using the Titan One-Tube RT-PCR kit (Roche Diagnostics Corp., Chicago IL) and primers specific for genes of cucurbit-infecting criniviruses, including the coat protein gene of Cucurbit yellow stunting disorder virus (3) and the minor coat protein gene (CPm) of Beet pseudoyellows virus (BPYV) (4). Primers specific for the heat shock protein (HSP) gene (CYHSPF 5′ GAGCGCCGCACAAGTCATC 3′ and CYHSPR 5′ TACCGCCACCAAAGTCATACATTA 3′) of Cucumber yellows virus (CYV, a strain of BPYV) (1) were designed based on published sequence data. In addition, primers specific for Cucurbit aphid-borne yellows virus (2) and melon yellowing-associated flexivirus (MYVF 5′ GGCTGGCAACATGGAAACTGA 3′ and MYVR 5′ CTGAAAAGGCGATGAACTA TTGTG 3′) were used in RT-PCR reactions. Amplified DNA fragments of 333 and 452 bp were obtained in each of two samples obtained from symptomatic plants and only in separate reactions containing BPYV and CYV primer sets, respectively. Nucleotide sequence analysis of all purified PCR products verified their identity as variants of BPYV, with 97 and 99% sequence identity with reported CPm and HSP sequences, respectively. The two samples from Cucurbita moschata Duch. (ayote or squash) and Cucurbita pepo L.(escalopini or sunburst squash) were taken from a region around Paraiso, Cartago, Costa Rica. To our knowledge, this is the first report of BPYV in Costa Rica. The economic impact on cucurbit production has not yet been determined. Studies are underway to determine the prevalence and genetic variability of BPYV isolates in Costa Rica. References: (1) S. Hartono et al. J. Gen. Virol. 84:1007, 2003. (2) M. Juarez et al. Plant Dis. 88:907, 2004. (3) L. Rubio et al. J. Gen. Virol. 82:929, 2001. (4) I. E. Tzanetakis et al. Plant Dis. 87:1398, 2003.

Download Full-text

Newly Discovered Natural Hosts of Tomato chlorosis virus in Costa Rica

Plant Disease ◽

10.1094/pdis-11-10-0836 ◽

2011 ◽

Vol 95 (4) ◽

pp. 497-497 ◽

Cited By ~ 14

Author(s):

A. Solórzano-Morales ◽

N. Barboza ◽

E. Hernández ◽

F. Mora-Umaña ◽

P. Ramírez ◽

...

Keyword(s):

Costa Rica ◽

Nucleotide Sequence ◽

Costa Rican ◽

Nucleotide Sequence Analysis ◽

Dna Fragments ◽

Rt Pcr ◽

Sequence Identity ◽

Two Samples ◽

Natural Hosts ◽

Tomato Chlorosis Virus

Tomato chlorosis virus (ToCV) is an emerging whitefly-transmitted crinivirus (2). In Costa Rica in 2007, ToCV was detected in field-grown and greenhouse tomato (Solanum lycopersicum L.) plants causing symptoms of severe yellowing and foliar chlorosis (1). To identify alternative hosts that may serve as virus reservoirs, 78 samples were collected from multiple species of common weeds growing adjacent to tomato nurseries in the Cartago Province, where ToCV was previously identified, during the autumn of 2008 and summer of 2009. The weeds were collected on the basis of the presence of whiteflies and/or symptoms of interveinal chlorosis, but not all samples were symptomatic for infection by ToCV. Total RNA was extracted from leaf tissue with TRI Reagent (Molecular Research Inc., Cincinnati, OH). Reverse transcription (RT)-PCR reactions were performed with the Qtaq One-Step qRT-PCR SYBR Kit (Clontech Laboratories, Mountain View, CA) and primers specific for the ToCV HSP70h gene (3). A 123-bp DNA fragment was amplified in five weeds, which were identified taxonomically as Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolacaceae), Plantago major (Plantaginaceae), a Brassica sp. (Brassicaceae) (two samples), and a single plant of Cucurbita moschata (Cucurbitaceae) growing next to those weeds. The amplified DNA fragments were sequenced and BLAST analysis showed 100% nucleotide sequence identity with the HSP70h gene of the Florida ToCV isolate (GenBank Accession No. AY903448). To confirm the presence of ToCV in these six weed samples, conventional RT-PCR reactions were performed using primers specific for the ToCV CPm and p22 genes as described previously (1). Nucleotide sequence analysis of the amplified DNA fragments verified their identity as ToCV, with 100% sequence identity to the CPm of the ToCV isolate of Florida (Accession No. AY903448) and the p22 gene of the Cartago, Costa Rican isolate (Accession No. FJ809714). Although the number of samples analyzed is not sufficient to allow a determination of the role of weed reservoirs in ToCV epidemics in Costa Rican tomato crops, this report on the wider natural host range of ToCV in Costa Rica may lead to a better understanding of the epidemiology of this virus and be useful in the development of disease management strategies. To our knowledge this is the first report of these weeds as natural hosts of ToCV. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) M. I. Font et al. Plant Dis. 88:82, 2004. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008.

Download Full-text

First Report of Tomato chlorosis virus Infecting Sweet Pepper in Costa Rica

Plant Disease ◽

10.1094/pdis-03-11-0192 ◽

2011 ◽

Vol 95 (11) ◽

pp. 1482-1482 ◽

Cited By ~ 10

Author(s):

J. A. Vargas ◽

E. Hernández ◽

N. Barboza ◽

F. Mora ◽

P. Ramírez

Keyword(s):

Costa Rica ◽

The United States ◽

Sweet Pepper ◽

Nutritional Deficiencies ◽

Total Rna ◽

First Report ◽

Leaf Curling ◽

Pcr Products ◽

Tomato Chlorosis Virus ◽

Pepper Plants

In September 2008, a survey of whiteflies and whitefly-borne viruses was performed in 11 pepper-growing greenhouses in the province of Cartago, Costa Rica. During this survey, the vast majority of sweet pepper (Capsicum annuum cv. Nataly) plants showed interveinal chlorosis, enations, necrosis, and mild upward leaf curling. Large populations of whiteflies were present and they were found to be composed only of Trialeurodes vaporariorum. Total RNA from frozen plant samples was extracted with TRI Reagent (Molecular Research Inc., Cincinnati, OH). RevertAid H Minus Reverse Transcriptase Kit (Fermentas, Hanover, MD) was used for reverse transcription of the total RNA extract, with cDNA synthesis directed using random primers. A real-time PCR assay was performed to detect Tomato chlorosis virus (ToCV) (genus Crinivirus, family Closteroviridae) using the SYBR Green PCR Master Mix (Applied Biosystems, Carlsbad, CA). Three sets of primers were used to confirm the presence of ToCV in the samples: TocQ875F/TocQ998R primer set directed to a fragment of 123 bp of the HSP gene (3); ToCVp22RQF (5′-TGGATCTCACTGGTTGCTTG-3′)-ToCVp22RQR (5′-TAGTGTTTCAGCGCCAACAG-3′) primer pair that amplifies a 198-bp segment of the ToCV p22 gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora, and P. Ramirez, unpublished) and the ToCVCPmRQF (5′-CATTGGTTGGGGATTACGTC-3′)-ToCVCPmRQR (5′-TCTCAGCCTTGACTTGAGCA-3′) primer pair designed to amplify a 170-bp portion of the ToCV CPm gene (R. Hammond, E. Hernandez, J. Guevara, J. A. Vargas, A. Solorzano, R. Castro, N. Barboza, F. Mora and P. Ramirez, unpublished). Fifteen symptomatic samples per greenhouse were tested for a total of 165 sweet pepper plants. From this total, seven samples from four different greenhouses produced amplification of PCR products with all three sets of primers. One of the seven samples showed mild chlorosis, but others were highly chlorotic with different levels of upward leaf curling. None of the other samples showed amplification with any of the primer sets; the symptoms on these plants could have been due to nutritional deficiencies or infection by viruses. Sequence analysis of the 460-bp HSP PCR products, produced using previously reported primers (3), and 150-bp fragment of the P22 revealed 100% sequence identity with a tomato isolate of ToCV from the United States (GenBank Accession No. AY903448). Because of the low number of samples infected with ToCV and the high incidence of symptoms, DNA extraction and a begomovirus PCR detection assay was performed using primer pair AV494/AC1048 (4). Negative results were obtained for all samples. To our knowledge, this is the first report of ToCV infecting sweet pepper plants in Costa Rica and the third one worldwide. ToCV has also been found to be infecting tomato in open field and greenhouses (1) and other weeds in greenhouses including Ruta chalepensis (Rutaceae), Phytolacca icosandra (Phytolaccaceae), Plantago major (Plantaginaceae), and Brassica sp. (Brassicaceae) (2) in the same region of Costa Rica, suggesting that it has adapted to the conditions of the area and poses an important threat to the vegetable production. References: (1) R. M. Castro et al. Plant Dis. 93:970, 2009. (2) A. Solorzano-Morales et al. Plant Dis. 95:497, 2011. (3) W. M. Wintermantel et al. Phytopathology 98:1340, 2008. (4) S. Wyatt and J. Brown. Phytopathology 86:1288, 1996.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato in Georgia

Plant Disease ◽

10.1094/pdis-02-11-0122 ◽

2011 ◽

Vol 95 (7) ◽

pp. 881-881 ◽

Cited By ~ 1

Author(s):

S. Sundaraj ◽

R. Srinivasan ◽

C. G. Webster ◽

S. Adkins ◽

K. Perry ◽

...

Keyword(s):

Nucleic Acid Hybridization ◽

N Gene ◽

Natural Occurrence ◽

Rt Pcr ◽

Specific Primers ◽

Tomato Production ◽

First Report ◽

Interveinal Chlorosis ◽

Cp Gene ◽

Tomato Chlorosis Virus

Tomato yellow leaf curl virus (TYLCV) and Tomato spotted wilt virus (TSWV) are prevalent in field-grown tomato (Solanum lycopersicum) production in Georgia. Typical TYLCV symptoms were observed during varietal trials in fall 2009 and 2010 to screen genotypes against TYLCV at the Coastal Plain Experiment Station, Tifton, GA. However, foliar symptoms atypical of TYLCV including interveinal chlorosis, purpling, brittleness, and mottling on upper and middle leaves and bronzing and intense interveinal chlorosis on lower leaves were also observed. Heavy whitefly (Bemisia tabaci (Gennadius), B biotype) infestation was also observed on all tomato genotypes. Preliminary tests (PCR and nucleic acid hybridization) in fall 2009 indicated the presence of TYLCV, TSWV, Cucumber mosaic virus, and Tomato chlorosis virus (ToCV); all with the exception of ToCV have been reported in Georgia. Sixteen additional symptomatic leaf samples were randomly collected in fall 2010 and the preliminary results from 2009 were used to guide testing. DNA and RNA were individually extracted using commercially available kits and used for PCR testing for ToCV, TYLCV, and TSWV. Reverse transcription (RT)-PCR with ToCV CP gene specific primers (4) produced approximately 750-bp amplicons from nine of the 16 leaf samples. Four of the nine CP gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 100.0% identical with each other (GenBank Accession Nos. HQ879840 to HQ879843). They were 99.3 to 99.5%, 97.2 to 97.5%, and 98.6 to 98.9% identical to ToCV CP sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. The presence of ToCV was confirmed by amplifying a portion of the HSP70h gene using the primers HSP-1F and HSP-1R (1). RT-PCR produced approximately 900-bp amplicons in the same nine samples. Four HSP70h gene amplicons were purified and directly sequenced in both directions. The sequences were 99.4 to 99.7% identical to each other (Accession Nos. HQ879844 to HQ879847). They were 99.2 to 99.5%, 98.0 to 98.4%, and 98.9 to 99.3% identical to HSP70h sequences from Florida (Accession No. AY903448), Spain (Accession No. DQ136146), and Greece (Accession No. EU284744), respectively. TYLCV was also detected in all 16 samples by PCR using degenerate begomovirus primers PAL1v 1978 and PARIc 496 (3) followed by sequencing. TSWV was also detected in two of the ToCVinfected samples by RT-PCR with TSWV N gene specific primers (2) followed by sequencing. To our knowledge, this is the first report of the natural occurrence of ToCV in Georgia. Further studies are required to quantify the yield losses from ToCV alone and synergistic interactions between ToCV in combination with TSWV and/or TYLCV in tomato production in Georgia. References: (1) T. Hirota et al. J. Gen. Plant Pathol. 76:168, 2010. (2) R. K. Jain et al. Plant Dis. 82:900, 1998. (3) M. R. Rojas et al. Plant Dis. 77:340, 1993. (4) L. Segev et al. Plant Dis. 88:1160, 2004.

Download Full-text

First Report of Tomato chlorosis virus in Potato in Brazil

Plant Disease ◽

10.1094/pdis-12-11-1068-pdn ◽

2012 ◽

Vol 96 (4) ◽

pp. 593-593 ◽

Cited By ~ 18

Author(s):

D. M. S. Freitas ◽

I. Nardin ◽

N. Shimoyama ◽

J. A. C. Souza-Dias ◽

J. A. M. Rezende

Keyword(s):

Leaf Roll ◽

Rt Pcr ◽

Specific Primers ◽

Total Rna ◽

First Report ◽

Interveinal Chlorosis ◽

Potato Plants ◽

The World ◽

Tomato Chlorosis Virus ◽

Biotype B

Potato plants (Solanum tuberosum cv. Ágata) exhibiting symptoms of leaf roll and interveinal chlorosis, especially on older leaves, were found in a commercial crop in the County of Cristalina, State of Goiás, Brazil in June 2011. The crop was severely infested by whitefly Bemisia tabaci biotype B. Four potato tubers from symptomatic plants were indexed for the presence of the following viruses: Tomato chlorosis virus (ToCV), Potato leaf roll virus (PLRV), Tomato severe rugose virus (ToSRV), and Potato virus Y (PVY). Total RNA was extracted separately from each tuber and used for reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for ToCV. The RT-PCR product was subsequently tested by nested-PCR for detection of ToCV with specific primers ToC-5/ToC-6 (2). Amplicons of 463 bp, amplified from total RNA separately extracted from three tubers, were purified and directly sequenced. Comparisons among the three consensus sequences of 448 bp (GenBank Accession Nos. JQ288896, JQ288897, and JQ288898) revealed respectively, 98, 100, and 100% identity with the reported sequence of a tomato isolate of ToCV from Brazil (GenBank Accession No. EU868927) (1). For ToSRV detection, total DNA was extracted from two tubers and a fragment of approximately 820 bp was amplified by PCR with specific primers (3). PLRV and PVY were indexed in two and three tubers, respectively, by double-antibody sandwich-ELISA (SASA, Edinburg, Scotland). Virus-free B. tabaci biotype B were separately transferred to potato and tomato leaves infected with ToCV for an acquisition access period of 24 h. Groups of 30 viruliferous whitefly were transferred to four, young, sprout-grown potato plants cv. Ágata (two plants per virus isolate) for 24-h inoculation access period. After 37 days of inoculation, one plant inoculated with the potato and tomato isolates of ToCV, respectively exhibited symptoms of leaf roll and interveinal chlorosis on order leaves, which were similar to that induced by PLRV. Experimental infection of potato plants with ToCV, which induced leaf roll symptoms resembling PLRV infection, was reported in the United States by Wisler et al. (4). The potato isolate of ToCV was also transmitted by B. tabaci to one of two inoculated tomato plants. The presence of ToCV in all inoculated plants was detected by nested-RT-PCR as described above. To our knowledge, this is the first report on detection of ToCV in field potato plants in the world. Considering that ToCV occurs in innumerous countries around the world, it is transmitted by a cosmopolitan insect, and it induces symptoms similar to PLRV, this finding triggers an alert to field dependent seed-potato multiplication, virus inspector, and certification system. References: (1) J. C. Barbosa et al. Plant Dis. 92:1709, 2008. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002. (3) F. R. Fernandes et al. Trop. Plant Pathol. 35:43, 2010. (4) G. C. Wisler et al. Plant Dis. 82:270, 1998.

Download Full-text

First Report of Tomato chlorosis virus and Tomato infectious chlorosis virus in Tomato Crops in France

Plant Disease ◽

10.1094/pd-89-1243c ◽

2005 ◽

Vol 89 (11) ◽

pp. 1243-1243 ◽

Cited By ~ 24

Author(s):

A. Dalmon ◽

S. Bouyer ◽

M. Cailly ◽

M. Girard ◽

H. Lecoq ◽

...

Keyword(s):

Protein Gene ◽

The United States ◽

Rt Pcr ◽

Specific Primers ◽

Southern France ◽

Sequence Identity ◽

Two Samples ◽

Dna Fragment ◽

Tomato Chlorosis Virus ◽

Tomato Infectious Chlorosis Virus

Since 2002, yellowing symptoms associated with high levels of white-fly populations have been observed in plants of protected tomato crops in France. Symptomatic plants exhibited interveinal yellowing areas in older leaves, followed by generalized yellowing. Symptoms were not observed in young plants or fruits. Trialeurodes vaporariorum populations were generally abundant in spring, and Bemisia tabaci (established in France for approximately 10 years) became predominant in summer and fall. To check for the presence of Tomato chlorosis virus (ToCV) and Tomato infectious chlorosis virus (TICV), two whitefly-transmitted criniviruses known to induce yellowing symptoms, 696 samples were collected in the major tomato-growing areas; 573 samples from southern France and 123 samples from northern France. Total RNA was extracted from each sample and analyzed using reverse transcription-polymerase chain reaction (RT-PCR). Primers specific to ToCV (2) and TICV (1,3) were used to amplify either part of the heat-shock-like protein gene HSP70h (both viruses) or part of the diverged coat protein gene (CPd), (TICV only). A 439-bp DNA fragment was obtained with ToCV primers in 178 samples from southern France collected mainly from mid-spring to early fall from 2002 to 2004. Three RT-PCR products amplified from samples collected from diverse growing areas were sequenced and showed 99 to 100% sequence identity with published ToCV sequences from Spain (GenBank Accession Nos. AF215818, AF233435, and AF215817), Portugal (GenBank Accession No. AF234029), Sicily (GenBank Accession No. AY048854), and the United States (GenBank Accession No. AF024630). Considering the high frequency of ToCV-infected samples (41 positive samples of 112 samples collected in 2002, 71 of 295 collected in 2003, and 66 of 166 collected in 2004), this virus appears to be well established in southern France but remains absent in the northern regions. The presence of TICV was tested in 485 samples using the CPd-specific primers or the HSP70h-specific primers. The virus was detected in only two samples from Nice (southeastern France) in 2003 with both primer pairs. The CPd DNA fragment (700 bp) from one of these samples was sequenced, showing 98.9% sequence identity with a TICV Japanese isolate (AB085603). Results of these assays suggest that in contrast to ToCV, TICV is not yet broadly established in France. This difference could be associated with the specificity of the vectors, since ToCV is transmitted by B. tabaci and T. vaporariorum, while TICV is transmitted only by T. vaporariorum (4). References: (1) R. H. Li et al. Plant Dis. 82:84, 1998. (2) D. Louro et al. Eur. J. Plant Pathol. 1065:589, 2000. (3) A. M. Vaira et al. Phytoparasitica 30:290, 2002. (4) G. C. Wisler et al. Plant Dis. 82:271, 1998.

Download Full-text

First Report of Tomato chlorosis virus Infecting Tomato Crops in Brazil

Plant Disease ◽

10.1094/pdis-92-12-1709c ◽

2008 ◽

Vol 92 (12) ◽

pp. 1709-1709 ◽

Cited By ~ 25

Author(s):

J. C. Barbosa ◽

A. P. M. Teixeira ◽

A. G. Moreira ◽

L. E. A. Camargo ◽

A. Bergamin Filho ◽

...

Keyword(s):

Consensus Sequence ◽

The United States ◽

Sao Paulo ◽

São Paulo ◽

Rt Pcr ◽

Greenhouse Whitefly ◽

Thin Sections ◽

First Report ◽

Tomato Chlorosis Virus ◽

Biotype B

During 2006 and 2007 in the region of Sumaré, state of São Paulo, Brazil, surveys were done on tomato (Solanum lycopersicum L.) virus diseases in three open field-grown crops. The data revealed low incidence (0.25 to 3.42%) of randomly distributed plants exhibiting interveinal chlorosis and some necrosis on the basal leaves. Symptoms were only observed on old fruit-bearing plants. Preliminary analysis of thin sections of symptomatic leaves from one plant by transmission electron microscopy revealed the presence of aggregates of thin, flexible, and elongated particles in some phloem vessels, suggesting infection with a member of the genus Crinivirus, family Closteroviridae. Total RNA was extracted separately from leaves of 10 symptomatic plants and used for one-step reverse transcription (RT)-PCR using the HS-11/HS-12 primer pair, which amplifies a fragment of 587 bp from the highly conserved region of the heat shock protein (HSP-70) homolog gene reported for Tomato infectious chlorosis virus (TICV) and Tomato chlorosis virus (ToCV) (1). The RT-PCR product was subsequently tested by nested-PCR for single detection of TICV and ToCV using primer pairs TIC-3/TIC-4 and ToC-5/ToC-6, respectively (1). Only one fragment of approximately 463 bp was amplified from 7 of the 10 plants with the primer pair specific for ToCV. No amplification was obtained with the primers specific for TICV. Two amplicons of 463 bp were purified and directly sequenced in both directions. Sequence comparisons of the 463-bp consensus sequence (GenBank Accession No. EU868927) revealed 99% identity with the reported sequence of ToCV from the United States (GenBank Accession No. AY903448) (3). Virus-free adults of Bemisia tabaci biotype B confined on symptomatic tomato leaves for a 24-h acquisition access period were able to transmit the virus to healthy tomato plants, which reproduced the original symptoms on the bottom leaves 65 days after inoculation under greenhouse conditions. Infection from transmission was confirmed by RT-PCR using the HS-11/HS-12 primer pair. In addition to B. tabaci biotype B, the greenhouse whitefly, Trialeurodes vaporariorum, has also been reported as a vector of ToCV, although it is less efficient than the B. tabaci biotype B in transmission of this virus (4). T. vaporariorum, which was previously considered limited to greenhouses, was recently reported in tomato and green bean (Phaseolus vulgaris L.) crops under field conditions in São Paulo State (2). Therefore, it might also contribute to the spread of ToCV in tomato crops in São Paulo. To our knowledge, this is the first report of ToCV in Brazil and South America. References: (1) C. I. Dovas et al. Plant Dis.86:1345, 2002. (2) A. L. Lourenção et al. Neotrop. Entomol. 37:89, 2008. (3) W. M. Wintermantel et al. Arch. Virol. 15:2287, 2005. (4) W. M. Wintermantel and G. C. Wisler. Plant Dis. 90:814, 2006.

Download Full-text

First report of cucurbit chlorotic yellows virus (CCYV) infecting pumpkin in India

Plant Disease ◽

10.1094/pdis-07-21-1473-pdn ◽

2021 ◽

Author(s):

Ashwini Kumar ◽

Bichhinna Maitri Rout ◽

Shakshi Choudhary ◽

Amish K. Sureja ◽

V. K. Baranwal ◽

...

Keyword(s):

Amino Acid ◽

Amino Acid Sequence ◽

Amino Acid Sequence Identity ◽

Rt Pcr ◽

Specific Primers ◽

First Report ◽

Virus Particles ◽

Sequence Identity ◽

Cp Gene ◽

Cucurbit Chlorotic Yellows Virus

Pumpkin (Cucurbita moschata), a member of the family Cucurbitaceae, is widely cultivated throughout the world including India. During August 2020 to January 2021, stunted pumpkin plants (cv. Pusa Vishwas), showing chlorotic patches, mosaic, and vein banding on leaves (e-Xtra Fig.1), were observed in the experimental fields of the Indian Agricultural Research Institute (IARI), New Delhi, India. Leaf-dip electron microscopy (EM) of the symptomatic plants (12 out of 37 samples) revealed the association of long flexuous virus particles measuring 650-950nm×10-12nm, suggestive of the presence of either crinivirus or potyvirus or both. Subsequently, a reverse transcription-polymerase chain reaction (RT-PCR) was performed on RNA extracted from the samples that had long flexuous virus particles using generic primers for criniviruses i.e. CriniPol-F: GCY CCS AGR GTK AAT GA and CriniPol-R: ACC TTG RGA YTT RTC AAA targeting partial RNA-dependent RNA polymerase coding region (Martin et al. 2003) and specific primers for papaya ringspot virus (PRSV) targeting a part of 3’ NIb and full coat protein (CP) gene (Basavaraj et al., 2019) separately. All tested samples were positive for both crinivirus and PRSV as expected size amplicons were obtained, accounting for about 32% prevalence. As PRSV is a well-studied virus infecting cucurbits, further work was not carried on this virus and only the RT-PCR amplicon indicative of crinivirus (~515 bp) was cloned into the pGEM-T easy cloning vector (Promega, Madison, WI) and sequenced for further confirmation of the virus presence. The obtained sequence (GenBank accession No MZ318672) shared up to 90% nucleotide and 100% amino acid sequence identity with the corresponding genomic region of a cucurbit chlorotic yellows virus (CCYV) isolate from Greece (LT841297). To confirm the identity of the crinivirus species present in the same pumpkin sample, the CP gene (753bp) was amplified and sequenced using CCYV CP gene-specific primers CP-F (5’-ATG GAG AAG ACY GAC AAT AAA CAA AAT GAT GA-3’) and CP-R (5’-TTA TTT ACT ACA ACC TCC CGG TGC CAA C-3’) (modified from Kheireddine et al. 2020). Sequence analysis using the BioEdit tool (version 2.0) revealed that the crinivirus present in pumpkin (KC577202) shared 95 to 100% nucleotide (and 98 to 100% amino acid) sequence identity with the corresponding gene sequences of CCYV isolates originating from cucurbitaceous hosts from diverse locations. The presence of CCYV was further validated by a whitefly transmission-based bioassay followed by RT-PCR confirmation. The bioassay was performed by the whitefly species Bemisia tabaci (biotype Asia II7) using the acquisition access period and inoculation access period of 24 hours each. Six whitefly individuals per plant were used for inoculating ten pumpkin plants (cv. Pusa Vishwas) at the first true leaf stage grown in pots containing soilrite as the medium in insect-proof cages. All ten plants inoculated using whiteflies exhibited chlorosis and stunting symptoms 12-15 days post-inoculation (e-Xtra Fig.2) and were found positive for CCYV in RT-PCR assay performed using CCYV CP gene-specific primers. Though CCYV had been reported worldwide (Tzanetakis et al. 2013), its occurrence had not been reported from India. Results of the present study confirm the infection of pumpkin plants by CCYV and constitute the first report of its presence in India. Further, there is a need to investigate the extent of its spread and impact of this virus on the production of cucurbitaceous crops in the country.

Download Full-text

First Report of Cucurbit chlorotic yellows virus Infecting Muskmelon and Cucumber in Sudan

Plant Disease ◽

10.1094/pdis-04-11-0349 ◽

2011 ◽

Vol 95 (10) ◽

pp. 1321-1321 ◽

Cited By ~ 22

Author(s):

K. Hamed ◽

W. Menzel ◽

G. Dafalla ◽

A. M. A. Gadelseed ◽

S. Winter

Keyword(s):

Direct Sequencing ◽

Coat Protein Sequence ◽

Cucumber Plant ◽

Rt Pcr ◽

Cucumis Sativus L ◽

First Report ◽

Sequence Identity ◽

Pcr Products ◽

Cucurbit Chlorotic Yellows Virus ◽

Open Fields

In summer 2009, a survey for virus diseases in cucurbits was conducted in open fields and plastichouses in Khartoum State, the most important growing area for cucurbits in Sudan. Chlorosis and yellowing symptoms on middle and lower leaves were observed on many muskmelon (Cucumis melo L.) plants grown in open fields in the Assilat agricultural scheme and on approximately 80% of the cucumber (Cucumis sativus L.) plants grown in plastichouses in Khartoum North. Large populations of whiteflies (Bemisia tabaci L.) were present in both locations. Leaf symptoms that were observed were similar to those caused by Cucurbit chlorotic yellows virus (CCYV), a recently described new Crinivirus species infecting cucurbits in Japan (4), indicating presence of this virus previously only reported from Japan, Taiwan (2), and China (1). Samples from seven symptomatic muskmelon leaves were collected from individual plants grown in different open fields in Assilat and from a symptomatic cucumber plant grown in a plastichouse. Total RNA was extracted from these samples with the RNeasy Plant Mini Kit (QIAGEN, Hilden, Germany) to amplify putative CCYV sequences with primers (Crini-s2 5′-CATTCCTACCTGTTTAGCCA and Crini-as2 5′-TGCACTTATAATCTGCTGGTAC) designed from CCYV sequences available at GenBank. A 353-bp DNA fragment of the HSP70 gene was amplified by reverse transcription (RT)-PCR for all samples. Further analysis by direct sequencing of two PCR products showed 99 to 100% nt sequence identity to Asian CCYV isolates. Amplification of the coat protein sequence with the primer pair (CCYV-CPs 5′-ATGGAGAAGACTGACAATAAACAA and CCYV-CPas 5′-TTTACTACAACCTCCCGGTG) followed by cloning and sequencing yielded a 760-bp fragment having 99% nucleotide sequence identity to all Asian isolates. For confirmation, dsRNA preparations of symptomatic muskmelon tissue (collected in June 2010) were made, showing dsRNA patterns typical for criniviruses after separation on agarose gels. This dsRNA was used as template for random RT-PCR followed by sequencing of the cloned PCR products (3). Comparison with sequences available at GenBank revealed that cDNA sequences from dsRNA also were 99 to 100% identical to the CCYV genome sequence (AB523788.1). Whitefly transmission of the virus was confirmed by giving a population of B. tabaci an acquisition access period of 24 h and a further 24 h on muskmelon and cucumber seedlings. Symptoms were observed after 5 to 7 days, and the presence of CCYV was confirmed by RT-PCR. In conclusion, symptoms, RT-PCR, and dsRNA sequencing results confirm the presence and establishment of CCYV in cucurbit crops in Sudan. It is remarkable that the sequences obtained from the Sudanese samples show only negligible sequence differences from Asian isolates. Because of the large whitefly vector populations, the spread of CCYV to neighboring countries in Africa and potentially southern Europe, or wherever cucurbits are grown, can be expected. To our knowledge, this is the first report of CCYV in Sudan and outside Eastern Asia. The sequences obtained in this study have been submitted to GenBank under Accession Nos. JF807053 to JF807055. References: (1) Q. S. Gu et al. Plant Dis. 95:73, 2011. (2) L. H. Huang et al. Plant Dis. 94:1168, 2010. (3) W. Menzel et al. Arch. Virol. 154:1343, 2009. (4) M. Okuda et al. Phytopathology 100:560, 2010.

Download Full-text