First Report of Streptocarpus flower break virus in Streptocarpus in the United States

Streptocarpus flower break virus (SFBV) belongs to the genus Tobamovirus and was described from naturally infected streptocarpus plants in 1995 (2). The complete genomic sequence was recently reported (1). Prominent symptoms include flower breaking while foliar symptoms are often lacking. In March 2007, four streptocarpus plants (cv. Indigo Dream) from San Diego County, CA were tested for the presence of SFBV by ELISA and reverse transcription (RT)-PCR. Symptoms suggestive of a virus infection were not present on these mother plants at the time of sampling. ELISA with SFBV-specific antiserum showed that all samples were infected with SFBV. The ELISA results were verified by RT-PCR followed by cloning and sequencing. Two sets of primer pairs were used in separate RT-PCR tests. One was a degenerate tobamovirus group-specific primer pair and the second primer pair was specific to SFBV (1). The tobamovirus group-specific primer pair consisted of Tob Uni1, 5′-ATT TAA GTG GAG GGA AAA CCA CT-3′ and Tob Uni2, 5′-GTY GTT GAT GAG TTC GTG GA-3′. The SFBV-specific primers were SFBVcpF: 5′-AAA ATG TCG TAC GTG GTG GT and SFBVcpR: 5′-ACC CAC AGA ACT TCC TTC AA-3′ (1). PCR amplicons of the expected size (686 bp for the tobamovirus group-specific primer pair and 562 bp for the SFBV-specific primer pair) were obtained for each primer pair. The positive PCR test using the SFBV-specific primer pair confirmed the presence of SFBV. To further verify the identity of the virus, the amplicons obtained with each primer pair were separately cloned and sequenced. At least two clones for each amplicon were sequenced in both directions. Sequence comparisons with those available in GenBank showed 98% sequence identity with the corresponding genomic region (GenBank Accession No. NC_008365) of SFBV (1). To our knowledge, this is the first report of SFBV in the United States and it highlights the need for testing for this virus to ensure propagation and distribution of virus-free material. References: (1) C. Heinze et al. Arch. Virol. 151:763, 2006. (2) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 101:311, 1995.

Download Full-text

First Report of Colombian datura virus in Brugmansia in Canada

Plant Disease ◽

10.1094/pdis-93-2-0196b ◽

2009 ◽

Vol 93 (2) ◽

pp. 196-196 ◽

Cited By ~ 2

Author(s):

M. Rott ◽

A.-M. Schmidt ◽

V. Joshi ◽

C. Masters ◽

S. Godkin ◽

...

Keyword(s):

Genomic Sequence ◽

The United States ◽

Replicase Gene ◽

Rt Pcr ◽

Sequence Comparisons ◽

Viral Pathogen ◽

First Report ◽

Detection And Identification ◽

Unknown Species ◽

Strip Test

Colombian datura virus (CDV) was first described in 1968 (3) and has since been reported in Europe (4), Japan (see 4 for additional references), and the United States (1,2). CDV is a member of the family Potyviridae with flexuous, filamentous nucleocapsids that can be transmitted by mechanical inoculation and grafting and is known to be vectored by the common aphid Myzus persicae. In the fall of 2007, five Brugmansia plants of unknown species from a Parks Board Collection in a Lower Mainland nursery, British Columbia, Canada, were found to be displaying symptoms typical of a viral infection: chlorotic flecking and mottling on leaves, leaf shrivel, and vein banding. Symptomatic leaves from these five plants were tested by ELISA (Immuno Strip Test, Agdia, Elkhart, IN) for several common viruses including Impatiens necrotic spot, Tobacco mosaic, Cucumber mosaic, and Tomato spotted wilt viruses and found to be negative for all. However, rub inoculations onto the herbaceous indicators Nicotiana occidentalis and N. benthamiana resulted in severe symptom formation including necrosis, wilting, shriveling, stunted growth, petiole and stem tip collapse, as well as collapse from the base of the plants, and plant death within 2 weeks after inoculation. A leaf dip assay of the original infected Brugmansia sample and infected N. benthamiana tissue revealed flexuous, potyvirus-like particles with the electron microscope (EM). On the basis of the Brugmansia leaf symptoms and the EM results, a possible infection with CDV was suspected. Primers CDV-3 and CDV-NIb5, specific to CDV (4), were used in a reverse transcription (RT)-PCR assay that amplified an approximate 1,600-bp fragment from the original Brugmansia sample and inoculated N. bentamiana and N. occidentalis plants. The amplified portion of the genome is the extreme 3′ terminus and includes the 3′ noncoding sequence, the viral coat protein gene, and part of the viral replicase gene. Fragments were cloned into pCR2.1-TOPO (Invitrogen, San Diego, CA) and two clones from each plant (total of six clones) were sequenced in both directions. Sequences of all clones were essentially identical, with only three nucleotide differences among the clones (GenBank Accession No. EU571230). BLASTn analysis revealed the highest match to several CDV isolates ranging from 98.7 to 99.5% nucleotide sequence identity. BLASTp analysis of the 451 amino acid viral polyprotein translation product gave a similarly high match with CDV isolates, with the highest match to a Hungarian isolate of CDV (GenBank Accession No. CAD26690) of 99.8% identity, or only one mismatch out of 451 amino acids. An additional group of 15 large symptomless Brugmansia plants, located approximately 6 m from the five symptomatic plants, were also tested by RT-PCR and found to be positive. These 15 plants were of a different but also unknown species of Brugmansia. In conclusion, analysis of symptomatic Brugmansia from a Canadian collection by transfer of disease to herbaceous indicators, EM, RT-PCR, and genomic sequence comparisons, are consistent with the detection and identification of the potyvirus Colombian datura virus. To our knowledge, this is the first report of this viral pathogen in Canada. References: (1) S. Adkins et al. Phytopathology (Abstr.) 95(suppl.):S2, 2005. (2) C. R. Fry et al. J. Phytopathol. 152:200, 2004. (3) R. P. Kahn and R. Bartels. Phytopathology 58:58, 1968. (4) J. Schubert et al. J. Phytopathol. 154:343, 2006.

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-15-0562-re ◽

2016 ◽

Vol 100 (2) ◽

pp. 292-297 ◽

Cited By ~ 14

Author(s):

Mohamad Chikh-Ali ◽

Hayam Alruwaili ◽

Dalton Vander Pol ◽

Alexander V. Karasev

Keyword(s):

United States ◽

Saudi Arabia ◽

Seed Potato ◽

Potato Virus ◽

Potato Virus Y ◽

The United States ◽

Tuber Quality ◽

Rt Pcr ◽

First Report ◽

Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

Download Full-text

First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽

10.1094/pdis-91-4-0463c ◽

2007 ◽

Vol 91 (4) ◽

pp. 463-463 ◽

Cited By ~ 6

Author(s):

I. E. Tzanetakis ◽

J. D. Postman ◽

R. R. Martin

Keyword(s):

United States ◽

The United States ◽

Ringspot Virus ◽

Tobacco Streak Virus ◽

Rapid Decline ◽

Streak Virus ◽

Black Raspberry ◽

Rt Pcr ◽

Indicator Plants ◽

First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

Download Full-text

First Report of Alternanthera mosaic virus Infection in Angelonia in the United States

Plant Disease ◽

10.1094/pdis-92-10-1473b ◽

2008 ◽

Vol 92 (10) ◽

pp. 1473-1473 ◽

Cited By ~ 7

Author(s):

B. E. Lockhart ◽

M. L. Daughtrey

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Mosaic Virus ◽

Genomic Sequence ◽

Nutrient Deficiency ◽

Leaf Tissue ◽

The United States ◽

Nucleotide Sequence Analysis ◽

Degenerate Primers ◽

First Report

Stunting, chlorosis, and light yellow mottling resembling symptoms of nutrient deficiency were observed in angelonia (Angelonia angustifolia) in commercial production in New York. Numerous, filamentous particles 520 to 540 nm long and spherical virus particles 30 nm in diameter were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts of symptomatic Angelonia leaf tissue. Two viruses, the filamentous potexvirus Alternanthera mosaic virus (AltMV) and the spherical carmovirus Angelonia flower break virus (AnFBV) were subsequently identified on the basis of nucleotide sequence analysis of amplicons generated by reverse transcription (RT)-PCR using total RNA isolated from infected leaf tissue. A 584-bp portion of the replicase-encoding region of the AltMV genome was obtained with the degenerate primers Potex 2RC (5′-AGC ATR GNN SCR TCY TG-3′) and Potex 5 (5′-CAY CAR CAR GCM AAR GAT GA-3′) (3). Forward (AnFBV CP 1F-5′-AGC CTG GCA ATC TGC GTA CTG ATA-3′) and reverse (AnFBV CP 1R-5′-AAT ACC GCC CTC CTG TTT GGA AGT-3′) primers based on the published AnFBV genomic sequence (GenBank Accession No. NC_007733) were used to amplify a portion of the viral coat protein (CP) gene. The nucleotide sequence of the amplicon generated using the potexvirus-specific primers (GenBank Accession No. EU679362) was 99% identical to the published AltMV (GenBank Accession No. NC_007731) sequence and the nucleotide sequence of the amplicon obtained using the AnFBV CP primers was 99% identical to the published AnFBV genomic sequence (GenBank Accession No. EU679363). AnFBV occurs widely in angelonia (1) and AltMV has been identified in phlox (2). These data confirm the presence of AltMV and AnFBV in diseased angelonia plants showing stunting and nutrient deficiency-like symptoms and substantiates, to our knowledge, this first report of AltMV in angelonia in the United States. References: (1) S. Adkins et al. Phytopathology 96:460, 2006. (2) J. Hammond et al. Arch. Virol. 151:477, 2006. (3) R. A. A. van der Vlugt and M. Berendeson. Eur. J. Plant Pathol. 108:367, 2002.

Download Full-text

First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽

10.1094/pd-91-0113b ◽

2007 ◽

Vol 91 (1) ◽

pp. 113-113 ◽

Cited By ~ 5

Author(s):

H. F. Schwartz ◽

K. Otto ◽

H. R. Pappu

Keyword(s):

United States ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Allium Porrum ◽

Rt Pcr ◽

Spot Virus ◽

Disease Symptoms ◽

First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

Download Full-text

First Report of Pelargonium zonate spot virus from Tomato in the United States

Plant Disease ◽

10.1094/pdis-91-5-0633b ◽

2007 ◽

Vol 91 (5) ◽

pp. 633-633 ◽

Cited By ~ 8

Author(s):

H.-Y. Liu ◽

J. L. Sears

Keyword(s):

United States ◽

The United States ◽

Rt Pcr ◽

Spot Virus ◽

Chenopodium Amaranticolor ◽

Tomato Plants ◽

First Report ◽

Chenopodium Murale ◽

Tomato Field ◽

Infected Tomato

Pelargonium zonate spot virus (PZSV) was first isolated from tomato in southern Italy in 1982 (1) and later was also reported from Spain (3) and France (2). Infected tomato plants showed stunting, malformation, yellow rings and line patterns on the leaves, and concentric chlorotic ringspots on the stems. In June of 2006, more than 100 tomato (Lycopersicon esculentum Mill.) plants exhibiting symptoms similar to PZSV were observed in seven acres of tomato fields in Yolo County, California. The causal agent was mechanically transmitted to several indicator species. Symptoms on infected plants included local lesions on Beta macrocarpa, Chenopodium amaranticolor, C. capitatum, C. quinoa, Cucumis melo, Cucurbita pepo, and Tetragonia expansa, and systemic infection on Capsicum annuum, Chenopodium murale, L. esculentum, Nicotiana benthamiana, N. clevelandii, N. glutinosa, N. tabacum, Physalis floridana, and P. wrightii. Two field-infected tomato plants and one each of the mechanically inoculated host plant were positive with double-antibody sandwich (DAS)-ELISA using a commercial PZSV IdentiKit (Neogen Europe Ltd., Ayr, Scotland, UK). Partially purified virions stained with 2% uranyl acetate contained spherical to ovate particles. The particle diameters ranged between 25 and 35 nm. Published sequences of PZSV (GenBank Accession Nos. NC_003649 for RNA1, NC_003650 for RNA2, and NC_003651 for RNA3) were used to design three sets of primer pairs specific for PZSV RNA1 (R1-F: 5′ TGGCTGGCTTTTTCCGAACG 3′ and R1-R: 5′ CCTAATCTGTTGGTCCGAACTGTC 3′), RNA2 (R2-F: 5′ GCGTGCGTATCATCAGAAATGG 3′ and R2-R: 5′ ATCGGGAGCAG AGAAACACCTTCC 3′), and RNA3 (R3-F: 5′ CTCACCAACTGAAT GCTCTGGAC 3′ and R3-R: 5′ TGGATGCGTCTTTCCGAACC 3′) for reverse transcription (RT)-PCR tests. Total nucleic acids were extracted from field-infected tomato plants and partially purified virions for RT-PCR. RT-PCR gave DNA amplicons of the expected sizes. The DNA amplicons were gel purified and sequenced. The sequenced amplicons had 92, 94, and 96% nt sequence identity to PZSV RNA1, RNA2, and RNA3, respectively. The symptomatology, serology, particle morphology, and nucleotide sequences confirm the presence of PZSV in a tomato field in California. To our knowledge, this is the first report of the occurrence of PZSV in the United States. References: (1) D. Gallitelli. Ann. Appl. Biol. 100:457, 1982. (2) K. Gebre-Selassie et al. Plant Dis. 86:1052, 2002. (3) M. Luis-Arteaga et al. Plant Dis. 84:807, 2000.

Download Full-text

First Report of Barley virus G in the United States and California

Plant Disease ◽

10.1094/pdis-03-21-0478-pdn ◽

2021 ◽

Author(s):

Anna Christine Erickson ◽

Bryce Falk

Keyword(s):

United States ◽

Viral Genome ◽

The United States ◽

Full Length ◽

Yellow Dwarf ◽

Rt Pcr ◽

First Report ◽

Query Coverage ◽

Full Length Sequence ◽

The U.S

Barley (Hordeum vulgare) is a valuable annual cereal crop grown widely throughout the United States and the world. The majority of barley grown commercially in California and throughout the U.S. is used for livestock feed, with the remainder being used by the malting industry and, to a lesser extent, direct food consumption; it is also often employed as a cover crop (Lazicki et al. 2016). Yellow dwarf viruses (YDVs), in the family Luteoviridae, that infect barley and other cereal crops are common and widely distributed throughout California and the U.S. (Griesbach et al. 1989; Seabloom et al. 2009). In April 2018, five barley samples exhibiting typical symptoms of YDV infection (primarily yellowing of leaf margins and tips) collected from fields in Yolo county planted with cultivar Butta 12 , were tested for viruses. Total RNA was extracted from leaf tissue using Trizol reagent, according to the manufacturer’s protocol. RNA was used as template in a multiplexed RT-PCR assay designed for the generic detection of barley and cereal infecting YDVs, using the protocol established by Malmstrom and Shu (2004). A 372 basepair amplicon indicative of Polerovirus infection was amplified from two of the samples and sequenced (Quintara Biosciences), and the resulting data analyzed via a BLASTn search. No further testing or work was done with the three samples that tested negative. Not unexpectedly, the top result returned for one of the positive samples was Cereal yellow dwarf virus-RPV (CYDV-RPV; 98% identity), a virus common to cereals in California and the U.S.. Unexpectedly, however, the top result returned for the other sample was Barley virus G (BVG), sharing 98.43% identity with the Uiseong BVG isolate (GenBank accession LC259081). To further confirm the presence of BVG in the sample, the full-length viral genome was amplified using two-step RT-PCR with primers targeting the extreme 5’ and 3’ ends of the viral genome, using the PrimeScript RT and PrimeSTAR GXL DNA Polymerase kits (Takara Bio), cloned into the binary vector pJL89 and a BLAST search of the resulting 5621 nucleotide full-length sequence (100% query coverage) once again returned results showing the YDV to be BVG. The full-length sequence was deposited into GenBank (MW853785). Nucleotide sequence comparisons showed that the CA BVG isolate shares 96.62%, 96.57%, and 96.02% identity with the sequences of the BVG-Gimje (KT962089), BVG-Uiseong (LC259081), and BVG-Aus8 (LC500836) isolates, respectively. To our knowledge, this is the first report of barley virus G in California and in the United states. Currently the prevalence, host range and mode and timing of introduction of BVG in California and the U.S. are unknown; its impact on cereal production and yield in any location in which it has been identified thus far is also unknown and may warrant further investigation.

Download Full-text

First Report of Natural Infection of Garlic with Iris yellow spot virus in the United States

Plant Disease ◽

10.1094/pdis-93-8-0839a ◽

2009 ◽

Vol 93 (8) ◽

pp. 839-839 ◽

Cited By ~ 5

Author(s):

S. Bag ◽

P. Rogers ◽

R. Watson ◽

H. R. Pappu

Keyword(s):

United States ◽

Natural Infection ◽

Sandwich Elisa ◽

The United States ◽

Iris Yellow Spot Virus ◽

Yellow Spot ◽

N Gene ◽

Spot Virus ◽

Sequence Comparisons ◽

First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) is an important constraint to onion bulb and seed production in several onion-growing regions of the United States (1,3). While garlic (Allium sativum) was reported to be infected with IYSV in Réunion Island (4), there have been no confirmed reports of natural infection of garlic in the United States. Garlic plants showing near-diamond-shaped lesions were found in August of 2008 in Marion County, Oregon. The 0.4046-ha (1-acre) field plot consisted of various true-seeded garlic varieties and was adjacent to three onion fields that showed IYSV symptoms. Symptoms were observed on 5% of the garlic plants with most of the symptomatic plants displaying small and diffuse straw-colored spots. Seven of these symptomatic plants were selected for testing. Of these, two showed characteristic diamond-shaped, elongated, straw-colored lesions on garlic scapes. However, the lesions were more diffuse with less-defined edges compared with the characteristic diamond-shaped lesions that are often associated with IYSV infection (1). All symptomatic plants were positive for IYSV by double-antibody sandwich-ELISA with a commercially available kit (Agdia Inc., Elkhart, IN). To verify IYSV infection, total nucleic acid extracts from the symptomatic parts of the leaves were prepared and tested for the presence of IYSV by reverse transcription (RT)-PCR with primers 5′-TAAAACAAACATTCAAACAA-3′ and 5′-CTCTTAAACACATTTAACAAGCAC-3′, which flank the nucleocapsid (N) gene coded by the small RNA of IYSV (2). An approximate 1.1-kb amplicon was obtained from all symptomatic plants and cloned and sequenced. Nucleotide sequence comparisons using BLAST showed that a consensus of three clones derived from the amplicon from garlic (No. FJ514257) was 85 to 99% identical with IYSV sequences available in GenBank (Nos. AF001387, AB180918, and AB286063), confirming the identity of IYSV. To our knowledge, this is the first report of natural infection of IYSV infection of garlic in the United States. Additional surveys and testing are needed to obtain a better understanding of IYSV incidence in garlic to evaluate its impact on garlic production. References: (1) D. Gent et al. Plant Dis. 90:1468, 2006. (2) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (3) H. R. Pappu et al. Virus Res. 141:219, 2009. (4) I. Robène-Soustrade et al. Plant Pathol. 55:288, 2006.

Download Full-text

First Report of Cucumber green mottle mosaic virus on Melon in the United States

Plant Disease ◽

10.1094/pdis-02-14-0176-pdn ◽

2014 ◽

Vol 98 (8) ◽

pp. 1163-1163 ◽

Cited By ~ 35

Author(s):

T. Tian ◽

K. Posis ◽

C. J. Maroon-Lango ◽

V. Mavrodieva ◽

S. Haymes ◽

...

Keyword(s):

United States ◽

Mosaic Virus ◽

Seed Production ◽

Citrullus Lanatus ◽

The United States ◽

Rt Pcr ◽

First Report ◽

Rigid Rod ◽

Yolo County ◽

Das Elisa

In July 2013, a melon (Cucumis melo var. Saski) field in Yolo County, California, was inspected as part of a phytosanitary inspection for seed production. The leaves of the plants showed mosaic, green mottle, and blotches. When plant sap was examined using a transmission electron microscope, rigid rod-shaped particles were observed. Melon plant samples were analyzed by both CDFA and USDA APHIS PPQ laboratories and tested positive using DAS-ELISA against Cucumber green mottle mosaic virus (CGMMV) (Agdia, Elkhart, IN). To confirm the presence of CGMMV, total RNA was analyzed by RT-PCR using primers CGMMV-F5370 5′-CTAATTATTCTGTCGTGGCTGCGGATGC-3′ and CGMMV-R6390 5′-CTTGCAGAATTACTGCCCATA-3′ designed by PPQ based on 21 genomic sequences of CGMMV found worldwide. The 976-bp amplicon was sequenced (GenBank Accession No. KJ453559) and BLAST analysis showed the sequence was 95% identical to MP and CP region of CGMMV isolates reported from Russia (GQ495274, FJ848666), Spain (GQ411361), and Israel (KF155231), and 92% to the isolates from China (KC852074), Korea (AF417243), India (DQ767631), and Japan (D12505). These analyses confirm the virus was CGMMV. To our knowledge, this is the first report of CGMMV in the United States. Based on our sequence data, a second set of primers (CGMMV-F5796 5′-TTGCGTTTAGTGCTTCTTATGT-3′ and CGMMV-R6237 5′-GAGGTGGTAGCCTCTGACCAGA-3′), which amplified a 440-bp amplicon from CGMMV CP region, was designed and used for testing all the subsequent field and seed samples. Thirty-seven out of 40 randomly collected Saski melon samples tested positive for CGMMV, suggesting the virus was widespread in the field. All the melon samples also tested positive for Squash mosaic virus (SqMV) using DAS-ELISA (Agdia). Therefore, the symptoms observed likely resulted from a mixed infection. The melon field affected by CGMMV was immediately adjacent to fields of cucumber (Cucumis sativus var. Marketmore 76) and watermelon (Citrullus lanatus var. Sugar Baby) crops, both for seed production with no barrier between the crops. CGMMV was also detected from symptomatic plants from both fields. Seed lots used for planting all three crops were tested and only the melon seed was positive for CGMMV, suggesting the seed as the source of infection. The sequenced 440-bp RT-PCR amplicons from CGMMV-infected cucumber and watermelon plants and melon seeds were 99% identical to the CGMMV from the field melon. A cucumber plant infected with CGMMV but not SqMV was used for mechanical inoculation at the Contained Research Facility at University of California, Davis. Inoculated cucumber, melon, and watermelon plants showed green mottle and mosaic similar to that observed in the field. CGMMV is a highly contagious virus and damage by this virus on cucurbit crops has been reported in regions where CGMMV is present (2). CGMMV was detected on cucumber grown in greenhouses in Canada with 10 to 15% yield losses reported due to this virus (1). The three cucurbit crops in Yolo County were planted in an isolated area with no other cucurbits nearby. Measures, including destroying all the cucurbit plant material, have been taken to eradicate the virus. Use of CGMMV free cucurbit seed is necessary for prevention of this disease. References: (1) K.-S. Ling et al. Plant Dis. 98:701, 2014. (2) J. Y. Yoon et al. J. Phytopathol. 156:408, 2008.

Download Full-text