scholarly journals First Report of Blackberry chlorotic ringspot virus in Rubus sp. in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (4) ◽  
pp. 463-463 ◽  
Author(s):  
I. E. Tzanetakis ◽  
J. D. Postman ◽  
R. R. Martin
Keyword(s):  
United States ◽  
The United States ◽  
Ringspot Virus ◽  
Tobacco Streak Virus ◽  
Rapid Decline ◽  
Streak Virus ◽  
Black Raspberry ◽  
Rt Pcr ◽  
Indicator Plants ◽  
First Report

Blackberry chlorotic ringspot virus (BCRV), genus Ilarvirus, has been found in Rubus sp. in Scotland (2) and rose in the United States (4). The possibility that BCRV infects other hosts in the United States was explored. We tested 18 accessions of Fragaria sp. and 30 of Rubus sp. maintained at the National Clonal Germplasm Repository in Corvallis, OR. Ilarviruses had been detected in these plants by reverse transcription (RT)-PCR, ELISA, or had caused symptoms typical of ilarviruses on indicator plants. The accessions were tested by RT-PCR with primers F (5′-GTTTCCTGTGCTCCTCA-3′) and R (5′-GTCACACCGAGGTACT-3′) (4) that amplify a 519 to 522 nt (depending on the isolate) region of the RNA 3 of BCRV. The virus was detected in two accessions of black raspberry (Rubus occidentalis L.): RUB433, cv. Lowden and RUB 9012, cv. New Logan. The sequences of the fragments amplified from these accessions (GenBank Accession Nos. EF041817 and EF041818, respectively) had 97% nt sequence identity to each other and 95 and 88% nt identity to the rose and Scottish isolates (GenBank Accession Nos. DQ329378 and DQ091195, respectively). Chenopodium quinoa indicator plants inoculated with isolate RUB 433 developed mild chlorotic spots on the inoculated leaves 4 days after inoculation. RT-PCR and sequencing of the amplicons verified BCRV infection of C. quinoa. RUB 9012 was used for the characterization of Black raspberry latent virus (BRLV), later thought to be an isolate of Tobacco streak virus (TSV). This accession was recently found to be infected with Strawberry necrotic shock virus (SNSV) but not TSV (3). It is possible that BRLV may be a mixture of SNSV and BCRV. SNSV is one of the most abundant viruses of Rubus sp. in the Pacific Northwest (1), and the finding of another ilarvirus, BCRV, may account in part for the rapid decline of Rubus sp. observed in several fields in Oregon and Washington. To our knowledge, this is the first report of BCRV infecting Rubus sp. outside the United Kingdom. References: (1) A. B. Halgren. Ph.D. Diss. Oregon State University, Corvallis, OR, 2006. (2) A. T. Jones et al. Ann. Appl. Biol. 149:125, 2006. (3) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (4) I. E. Tzanetakis et al. Plant Pathol. 55:568, 2006.

scholarly journals Identification of Tobacco streak virus Associated With a Virus-like Mottle Symptom on Hosta

2013 ◽  
Vol 14 (1) ◽  
pp. 60 ◽  
Author(s):  
John R. Fisher
Keyword(s):  
United States ◽  
Capsid Protein ◽  
Movement Protein ◽  
The United States ◽  
Tobacco Streak Virus ◽  
Streak Virus ◽  
First Report ◽  
Leaf Symptom

In this brief, the authors describe the identification of Tobacco streak virus associated with a virus-like leaf symptom on Hosta spp. The identity of the virus was confirmed by ELISA and PCR using cDNAs synthesized from dsRNA template and immuncaptured virions and primers to amplify the movement protein and capsid protein genes. This is the first report of TSV infecting Hosta in Ohio, and to our knowledge in the United States. Accepted for publication 17 December 2012. Published 22 January 2013.

scholarly journals First Report of Strawberry latent ringspot virus in a Mentha sp. from North America

Plant Disease ◽  
2004 ◽  
Vol 88 (8) ◽  
pp. 907-907 ◽  
Author(s):  
J. D. Postman ◽  
I. E. Tzanetakis ◽  
R. R. Martin
Keyword(s):  
United States ◽  
North America ◽  
Consensus Sequence ◽  
The United States ◽  
Ringspot Virus ◽  
Yellow Vein ◽  
Cdna Clones ◽  
Meristem Culture ◽  
Rt Pcr ◽  
First Report

Yellow veinbanding symptoms have been observed in several mint clones at the U.S. Department of Agriculture, Agricultural Research Service, National Clonal Germplasm Repository (NCGR) mint collection in Corvallis, Oregon. The most dramatic symptoms are in a “variegated” clone of Mentha × gracilis Sole (NCGR Accession No. MEN-454), which is marketed widely in the nursery industry under cultivar names such as Golden Ginger Mint and Green and Gold. Tucker and Fairbrothers (2) proposed the name Mentha gentilis (= M. × gracilis) L. ‘Variegata’ for forms of this species with a graft transmissible variegation. Doublestranded RNA (dsRNA) was extracted from three mint clones with veinbanding symptoms of varying intensity. The dsRNA from MEN-454 was cloned, and sequences from several clones corresponded to RNA 2 of Strawberry latent ringspot virus (SLRSV), a tentative member of the family Sequiviridae. Sequences of additional cDNA clones suggested that two previously unknown viruses and the satellite RNA of SLRSV were also present in MEN-454. On the basis of the sequences of the SLRSV clones, primers F (5′ CCTCTCCAACCTGCTAGACT 3′) and R (5′ AAGCGCATGAAGGTGTAACT 3′) were developed and used in reverse transcription-polymerase chain reaction (RT-PCR) to amplify a 497-bp fragment of RNA 2 of SLRSV from MEN-454. No amplicons in RT-PCR tests or dsRNA was obtained from a clone of MEN-454 that was freed of the yellow vein symptom by heat therapy and apical meristem culture. The consensus sequence of cloned dsRNA and sequenced PCR products for SLRSV from MEN-454 has been deposited in GenBank (Accession No. AY 438666). Chenopodium quinoa, inoculated mechanically with leaf extracts from MEN-454, developed chlorosis and apical necrosis that were similar to symptoms reported for SLRSV infection (1). The presence of SLRSV in C. quinoa was confirmed using RT-PCR. Variegated M. × gracilis clones were obtained from wholesale and mail-order nurseries in Maryland, Ohio, and Nebraska. Samples were assayed using RT-PCR utilizing the F and R primers for presence of SLRSV. All samples tested positive for the virus using RT-PCR. Because of the presence of additional viruses, we cannot attribute yellow vein symptoms solely to SLRSV, however the presence of this virus in clones of M. × gracilis ‘Variegata’ from different regions throughout the United States demonstrates that SLRSV is distributed widely in the United States. To our knowledge, this is the first report of SLRSV in mint in North America. References: (1) K. Schmelzer. Phytopathol. Z. 66:1, 1969. (2) A. O. Tucker and D. E. Fairbrothers. Taxon 21:209, 1972.

scholarly journals First Report of Potato spindle tuber viroid Naturally Infecting Field Tomatoes in the Dominican Republic

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 701-701
Author(s):  
K.-S. Ling ◽  
R. Li ◽  
D. Groth-Helms ◽  
F. M. Assis-Filho
Keyword(s):  
United States ◽  
Dominican Republic ◽  
Mosaic Virus ◽  
Potato Spindle Tuber Viroid ◽  
The United States ◽  
Disease Outbreak ◽  
Ringspot Virus ◽  
Rt Pcr ◽  
Spot Virus ◽  
Three Samples

In recent years, viroid disease outbreaks have resulted in serious economic losses to a number of tomato growers in North America (1,2,3). At least three pospiviroids have been identified as the causal agents of tomato disease, including Potato spindle tuber viroid (PSTVd), Tomato chlorotic dwarf viroid (TCDVd), and Mexican papita viroid (MPVd). In the spring of 2013, a severe disease outbreak with virus-like symptoms (chlorosis and plant stunting) was observed in a tomato field located in the Dominican Republic, whose tomato production is generally exported to the United States in the winter months. The transplants were produced in house. The disease has reached an epidemic level with many diseased plants pulled and disposed of accordingly. Three samples collected in May of 2013 were screened by ELISA against 16 common tomato viruses (Alfalfa mosaic virus, Cucumber mosaic virus, Impatiens necrotic spot virus, Pepino mosaic virus, Potato virus X, Potato virus Y, Tobacco etch virus, Tobacco mosaic virus, Tobacco ringspot virus, Tomato aspermy virus, Tomato bushy stunt virus, Tomato mosaic virus, Tomato ringspot virus, Tomato spotted wilt virus, Groundnut ringspot virus, and Tomato chlorotic spot virus), a virus group (Potyvirus group), three bacteria (Clavibacter michiganensis subsp. michiganensis, Pectobacterium atrosepticum, and Xanthomonas spp.), and Phytophthora spp. No positive result was observed, despite the presence of symptoms typical of a viral-like disease. Further analysis by RT-PCR using Agdia's proprietary pospiviroid group-specific primer resulted in positive reactions in all three samples. To determine which species of pospiviroid was present in these tomato samples, full-genomic products of the expected size (~360 bp) were amplified by RT-PCR using specific primers for PSTVd (4) and cloned using TOPO-TA cloning kit (Invitrogen, CA). A total of 8 to 10 clones from each isolate were selected for sequencing. Sequences from each clone were nearly identical and the predominant sequence DR13-01 was deposited in GenBank (Accession No. KF683200). BLASTn searches into the NCBI database demonstrated that isolate DR13-01 shared 97% sequence identity to PSTVd isolates identified in wild Solanum (U51895), cape gooseberry (EU862231), or pepper (AY532803), and 96% identity to the tomato-infecting PSTVd isolate from the United States (JX280944). The relatively lower genome sequence identity (96%) to the tomato-infecting PSTVd isolate in the United States (JX280944) suggests that PSTVd from the Dominican Republic was likely introduced from a different source, although the exact source that resulted in the current disease outbreak remains unknown. It may be the result of an inadvertent introduction of contaminated tomato seed lots or simply from local wild plants. Further investigation is necessary to determine the likely source and route of introduction of PSTVd identified in the current epidemic. Thus, proper control measures could be recommended for disease management. The detection of this viroid disease outbreak in the Dominican Republic represents further geographic expansion of the viroid disease in tomatoes beyond North America. References: (1). K.-S. Ling and M. Bledsoe. Plant Dis. 93:839, 2009. (2) K.-S. Ling and W. Zhang. Plant Dis. 93:1216, 2009. (3) K.-S. Ling et al. Plant Dis. 93:1075, 2009. (4) A. M. Shamloul et al. Can. J. Plant Pathol. 19:89, 1997.

scholarly journals First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽  
2021 ◽  
Author(s):  
Gardenia Orellana ◽  
Alexander V Karasev
Keyword(s):  
United States ◽  
Leaf Tissue ◽  
The United States ◽  
Universal Primers ◽  
Rt Pcr ◽  
Universal Primer ◽  
Tissue Samples ◽  
First Report ◽  
Specific Pcr ◽  
Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

scholarly journals Alternanthera mosaic virus Found in Scutellaria, Crossandra, and Portulaca spp. in Florida

Plant Disease ◽  
2006 ◽  
Vol 90 (6) ◽  
pp. 833-833 ◽  
Author(s):  
C. A. Baker ◽  
L. Breman ◽  
L. Jones
Keyword(s):  
Electron Microscopy ◽  
United States ◽  
Mosaic Virus ◽  
Plant Species ◽  
The United States ◽  
Enzyme Linked Immunosorbent Assay ◽  
Rt Pcr ◽  
Indicator Plants ◽  
Partial Identity ◽  
Pcr Products

In the fall of 1998, the Division of Plant Industry (DPI) received vegetative propagations of Scutellaria longifolia (skullcap) with symptoms of foliar mosaic, chlorotic/necrotic ringspots, and wavy line patterns from a nursery in Manatee County. Flexuous particles approximately 500 nm long were found with electron microscopy. The plants tested positive for Papaya mosaic virus (PaMV) in an enzyme-linked immunosorbent assay (ELISA) test with antiserum to PaMV (Agdia, Elkhart, IN). However, in immunodiffusion tests (antiserum from D. Purcifull, University of Florida), this virus gave a reaction of partial identity indicating it was related but not identical to PaMV (1). The original infected plants were kept in a greenhouse. In January 2005, a specimen of Crossandra infundibuliformis (firecracker plant) with mosaic symptoms was submitted to the DPI from a nursery in Alachua County. Inclusions found with light microscopy and particles found with electron microscopy indicated that this plant was infected with a potexvirus. This was confirmed by reverse transcription-polymerase chain reaction (RT-PCR) with primers designed to detect members of the virus family Potexviridae (3). These plants reacted positive to PaMV antiserum in ELISA and gave a reaction of partial identity to PaMV in immunodiffusion. A specimen of Portulaca grandiflora (moss rose) with distorted leaves found at a local retail store was also tested and gave the same results. Leaves from each of the three plant species were rubbed onto a set of indicator plants using Carborundum and potassium phosphate buffer. Total RNA was extracted from symptomatic indicator plants of Nicotiana benthamiana. RT-PCR (3) was performed, and PCR products were sequenced directly. Sequences of approximately 700 bp were obtained for all three plant species and showed 98% identity with each other. BLAST search results showed that these sequences were 93% identical to an Alternanthera mosaic virus (AltMV) sequence at the nucleotide level but only 76% identical to PaMV. The amino acid sequences were 98 and 82% identical to AltMV and PaMV, respectively. The PCR products of the virus from Scutellaria sp. were cloned, resequenced, and the sequence was entered into the GenBank (Accession No. DQ393785). The bioassay results matched those found for AltMV in Australia (2) and the northeastern United States (4), except that the Florida viruses infected Datura stramonium and Digitalis purpurea (foxglove). The virus associated with the symptoms of these three plants appears to be AltMV and not PaMV. AltMV has been found in ornamental plants in Australia, Italy, and the United States (Pennsylvania, Maryland, and now Florida). Since this virus is known to infect several plants asymptomatically and can be easily confused with PaMV serologically, it is likely that the distribution of this virus is much wider than is known at this time. References: (1) L. L. Breman. Plant Pathology Circular No. 396. Fla. Dept. Agric. Consum. Serv. DPI, 1999. (2) A. D. W. Geering and J. E. Thomas. Arch Virol 144:577, 1999. (3) A. Gibbs et al. J Virol Methods 74:67, 1998. (4) J. Hammond et al. Arch Virol. 151:477, 2006.

scholarly journals Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽  
2016 ◽  
Vol 100 (2) ◽  
pp. 292-297 ◽  
Author(s):  
Mohamad Chikh-Ali ◽  
Hayam Alruwaili ◽  
Dalton Vander Pol ◽  
Alexander V. Karasev
Keyword(s):  
United States ◽  
Saudi Arabia ◽  
Seed Potato ◽  
Potato Virus ◽  
Potato Virus Y ◽  
The United States ◽  
Tuber Quality ◽  
Rt Pcr ◽  
First Report ◽  
Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

scholarly journals First Report of Tobacco ringspot virus in Blackberry (Rubus sp.) in Alabama

Plant Disease ◽  
2008 ◽  
Vol 92 (12) ◽  
pp. 1708-1708 ◽  
Author(s):  
E. Coneva ◽  
J. F. Murphy ◽  
R. Boozer ◽  
N. Velásquez
Keyword(s):  
United States ◽  
North Carolina ◽  
South Carolina ◽  
Virus Infection ◽  
The United States ◽  
Negative Control ◽  
Ringspot Virus ◽  
First Report ◽  
Tobacco Ringspot Virus ◽  
Control Samples

In 2006, primocane stunted growth and crumbly berry development were observed on 4-year-old Kiowa and Apache blackberry cultivars grown at the Chilton Research and Extension Center, Clanton, AL. Samples from affected plants were tested for virus infection by ELISA kits (Agdia, Inc., Elkhart, IN) specific to each of 14 different viruses. Most samples tested positive for Tobacco ringspot virus (TRSV). TRSV was detected in blackberry samples from North Carolina and South Carolina (2). Bray et al. (1) studied the incidence of viruses in blackberry nursery stock in the United States and reported that 9% of the tested samples contained TRSV. Thus, a survey was conducted for TRSV incidence among commercial blackberry stands in eight counties in Alabama during July 2007. Blackberry plants were observed to express virus-like symptoms including chlorotic spots on leaves, leaf veinal chlorosis, stunting, and combinations thereof. Fruit-bearing plants sometimes had crumbly fruit symptoms characteristic of virus infection. Leaf samples that were collected from symptomatic and nonsymptomatic plants representing 14 cultivars were tested by TRSV ELISA (Agdia, Inc.). Of 180 blackberry samples, 68 tested positive for TRSV. Positive ELISA reactions for TRSV were on average 28 times greater than the reactions of known negative control samples considered negative for TRSV. Blackberry plants shown to be infected with TRSV during the 2007 survey were tested in July 2008 in an effort to confirm the presence of TRSV. Fifty-four percent of the samples tested positive by ELISA with the average positive ELISA value being 21 times higher than the average negative ELISA value for known negative control samples. To further confirm the occurrence of TRSV in Alabama-grown blackberry plants, leaf samples were tested by reverse transcription (RT)-PCR to amplify a 329-bp fragment of the viral coat protein gene (TRSV RNA 2 sequence accession no. NC_005096; primers TRSCP-F (5′-TCTGGCACTATAAGCGGAAG-3′) and TRSCP-R (5′-GAAAACATGGGAGGATGCAC-3′). A single band of the anticipated size was amplified (analyzed by agarose gel electorphoresis and visualized by ethidium bromide staining) from RNA samples extracted with a RNeasy Mini kit (Qiagen, Valencia, CA) from blackberry samples that tested positive for TRSV by ELISA and a known positive control. No amplified product resulted from a blackberry sample that tested negative for TRSV by ELISA. These results illustrate and confirm the presence of TRSV in blackberry leaf tissues grown in Alabama. To our knowledge, this is the first report of TRSV infection of blackberry plants in Alabama. References: (1) M. M. Bray et al. HortScience 40:874, 2005. (2) T. L. Guzmán-Baeny. Incidence, distribution, and symptom description of viruses in cultivated blackberry (Rubus subgenus Eubatus) in the southeastern United States. M.S. thesis, North Carolina State University, Raleigh, 2003.

scholarly journals First Report of Strawberry necrotic shock virus in China

Plant Disease ◽  
2011 ◽  
Vol 95 (9) ◽  
pp. 1198-1198 ◽  
Author(s):  
L. Li ◽  
H. Yang
Keyword(s):  
Nucleic Acid ◽  
Home Garden ◽  
Tobacco Streak Virus ◽  
Chinese Isolate ◽  
Streak Virus ◽  
Total Nucleic Acid ◽  
Rt Pcr ◽  
Viral Pathogen ◽  
First Report ◽  
Strawberry Vein Banding Virus

Strawberry necrotic shock virus (SNSV) is an economically important viral pathogen that infects Fragaria and Rubus spp. SNSV was first identified in the 1950s and early studies indicated that SNSV was a strain of Tobacco streak virus (TSV). Recently, it was shown that SNSV was a distinct virus based on molecular characterization (2). Currently, SNSV is a tentative member of the Ilarvirus genus in the Bromoviridae family. In 2008, a small sampling survey for SNSV was done in Heilongjiang Province of China, and 15 strawberry samples were collected from symptomless strawberries in a home garden that had more than 5 years of strawberry cultivation history. Total nucleic acid was extracted from strawberry leaflets by modified cetyltrimethylammoniumbromide methods (3). Reverse transcription (RT)-PCR was operated with the published primer pair CPbeg F/CPend R (2). Amplified DNA fragments with the predicted size were obtained only in one strawberry sample, which was further cloned and sequenced. The sequence (GenBank Accession No. HQ830017) was closely related and highly homologous (89.7 to 98.5% identity) to that of viral isolates (GenBank Accession Nos. AY363228-AY363242) from Fragaria and Rubus spp. Phylogenetic analysis based on nucleotide sequence of the coat protein gene was done with the neighbor-joining method of MEGA 4.0 software. The result showed that all the isolates of SNSV fell into two distinct clades. The Chinese isolate formed one small clade with Japanese isolate 1291. The isolate was also transmitted to Chenopodium quinoa by mechanical inoculation in the greenhouse, and the symptom of chlorotic mottling could be found in C. quinoa and detected by RT-PCR. To determine whether the sample was infected by other strawberry viruses, RT-PCR assays with the published primer pairs SVBVdeta/SVBVdetb, SMoVdeta/SMoVdetb, and SMYEVdeta/SMYEVdetb were also performed for detection of Strawberry vein banding virus, Strawberry mottle virus, and Strawberry mild yellow edge virus using total nucleic acid extracted from the SNSV-positive sample as a template (1). The result indicated that it had been also infected by Strawberry mild yellow edge virus, although no visible symptoms were observed. To our knowledge, this is the first report of SNSV in strawberry in China. Additional work is needed to elucidate the biological characterization and significance of the finding. References: (1) J. R. Thompson et al. J. Virol. Methods 111:85, 2003. (2) I. E. Tzanetakis et al. Arch. Virol. 149:2001, 2004. (3) H. Y. Yang et al. Acta Hortic. 764:127, 2007.

scholarly journals First Report of Iris yellow spot virus in Commercial Leek (Allium porrum) in the United States

Plant Disease ◽  
2007 ◽  
Vol 91 (1) ◽  
pp. 113-113 ◽  
Author(s):  
H. F. Schwartz ◽  
K. Otto ◽  
H. R. Pappu
Keyword(s):  
United States ◽  
The United States ◽  
Iris Yellow Spot Virus ◽  
Yellow Spot ◽  
N Gene ◽  
Allium Porrum ◽  
Rt Pcr ◽  
Spot Virus ◽  
Disease Symptoms ◽  
First Report

Iris yellow spot virus (IYSV; family Bunyaviridae, genus Tospovirus) has a wide host range, with onion (Allium cepa L.) being one of the most economically important hosts. IYSV has been widely reported from this species throughout most onion-production regions of the United States and many areas of the world in recent years. A relative of onion, leek (Allium porrum L.), has been reported to be a host of IYSV in countries such as the Netherlands, Reunion Island, and Australia (1,4). A related tospovirus, Tomato spotted wilt virus (TSWV), was recently reported causing necrotic lesions and extended bleaching of leaf tips of leek in Georgia (2). In September of 2006, disease symptoms suspected to be caused by IYSV were observed on central and outer leaves of plants in a 2.6-ha section of commercial leeks being grown from seed (cvs. Tadorna and King Richard). The leek plants were adjacent to a 3.1-ha section of seeded onion (cv. Exacta) that had been harvested 2 weeks earlier. Twenty-five to thirty percent of unharvested onion plants next to the leek section also exhibited IYSV-type disease symptoms generally on the central leaves. Both Allium spp. were seeded 5 months earlier and grown under certified organic, pivot-irrigated conditions in Larimer County in northern Colorado. Disease symptoms on leek and onion leaves appeared as dry, white-to-straw-colored, spindle- or diamond-shaped lesions that ranged in size from 5 to 10 × 25 to 50 mm or larger depending on lesion age. Lesion centers, especially on leek, often had green centers with concentric rings of alternating green and straw-colored tissue. Green tissue near necrotic lesions of a single symptomatic leaf from 10 plants each of leek and onion was sampled and analyzed using a double-antibody sandwich (DAS)-ELISA (Agdia, Inc., Elkhart, IN). Five of ten leek and nine of ten onion samples were positive for IYSV. Using reverse transcription (RT)-PCR and primers specific to the small RNA of IYSV (5′-TAA AAC AAA CAT TCA AAC AA-3′ and 5′-CTC TTA AAC ACA TTT AAC AAG CAC-3′), the complete nucleocapsid (N) gene was amplified from symptomatic leek plants and then sequenced (3). Comparisons with IYSV N gene sequences available in the GenBank confirmed the identity of the virus as IYSV. Leek samples were negative for TSWV when tested by RT-PCR with TSWV-specific primers. In addition, three specimens of the presumed thrips vector recovered from five IYSV-infected leek plants were identified as Thrips tabaci (L. A. Mahaffey and W. S. Cranshaw, personal communication). Earlier in the season, T. tabaci was observed in the nearby planting of onion that also exhibited IYSV in September. To our knowledge, this is the first report of natural infection of commercial leek with IYSV in the United States. The incidence of plants (25 to 30%) with foliar lesions on multiple leaves and stunting of 5% of infected plants in both leek cultivars suggests that IYSV could seriously reduce leek stem development and marketability. References: (1) I. Cortes et al. Phytopathology 88:1276, 1998. (2) C. Nischwitz et al. Plant Dis. 90:525, 2006. (3) H. R. Pappu et al. Arch. Virol. 151:1015, 2006. (4) T. N. Smith et al. Plant Dis. 90:729, 2006.

Sign in / Sign up

Export Citation Format

Share Document