First Report of Colombian datura virus in Brugmansia in Canada

Colombian datura virus (CDV) was first described in 1968 (3) and has since been reported in Europe (4), Japan (see 4 for additional references), and the United States (1,2). CDV is a member of the family Potyviridae with flexuous, filamentous nucleocapsids that can be transmitted by mechanical inoculation and grafting and is known to be vectored by the common aphid Myzus persicae. In the fall of 2007, five Brugmansia plants of unknown species from a Parks Board Collection in a Lower Mainland nursery, British Columbia, Canada, were found to be displaying symptoms typical of a viral infection: chlorotic flecking and mottling on leaves, leaf shrivel, and vein banding. Symptomatic leaves from these five plants were tested by ELISA (Immuno Strip Test, Agdia, Elkhart, IN) for several common viruses including Impatiens necrotic spot, Tobacco mosaic, Cucumber mosaic, and Tomato spotted wilt viruses and found to be negative for all. However, rub inoculations onto the herbaceous indicators Nicotiana occidentalis and N. benthamiana resulted in severe symptom formation including necrosis, wilting, shriveling, stunted growth, petiole and stem tip collapse, as well as collapse from the base of the plants, and plant death within 2 weeks after inoculation. A leaf dip assay of the original infected Brugmansia sample and infected N. benthamiana tissue revealed flexuous, potyvirus-like particles with the electron microscope (EM). On the basis of the Brugmansia leaf symptoms and the EM results, a possible infection with CDV was suspected. Primers CDV-3 and CDV-NIb5, specific to CDV (4), were used in a reverse transcription (RT)-PCR assay that amplified an approximate 1,600-bp fragment from the original Brugmansia sample and inoculated N. bentamiana and N. occidentalis plants. The amplified portion of the genome is the extreme 3′ terminus and includes the 3′ noncoding sequence, the viral coat protein gene, and part of the viral replicase gene. Fragments were cloned into pCR2.1-TOPO (Invitrogen, San Diego, CA) and two clones from each plant (total of six clones) were sequenced in both directions. Sequences of all clones were essentially identical, with only three nucleotide differences among the clones (GenBank Accession No. EU571230). BLASTn analysis revealed the highest match to several CDV isolates ranging from 98.7 to 99.5% nucleotide sequence identity. BLASTp analysis of the 451 amino acid viral polyprotein translation product gave a similarly high match with CDV isolates, with the highest match to a Hungarian isolate of CDV (GenBank Accession No. CAD26690) of 99.8% identity, or only one mismatch out of 451 amino acids. An additional group of 15 large symptomless Brugmansia plants, located approximately 6 m from the five symptomatic plants, were also tested by RT-PCR and found to be positive. These 15 plants were of a different but also unknown species of Brugmansia. In conclusion, analysis of symptomatic Brugmansia from a Canadian collection by transfer of disease to herbaceous indicators, EM, RT-PCR, and genomic sequence comparisons, are consistent with the detection and identification of the potyvirus Colombian datura virus. To our knowledge, this is the first report of this viral pathogen in Canada. References: (1) S. Adkins et al. Phytopathology (Abstr.) 95(suppl.):S2, 2005. (2) C. R. Fry et al. J. Phytopathol. 152:200, 2004. (3) R. P. Kahn and R. Bartels. Phytopathology 58:58, 1968. (4) J. Schubert et al. J. Phytopathol. 154:343, 2006.

Download Full-text

First Report of Streptocarpus flower break virus in Streptocarpus in the United States

Plant Disease ◽

10.1094/pdis-91-10-1361a ◽

2007 ◽

Vol 91 (10) ◽

pp. 1361-1361 ◽

Cited By ~ 1

Author(s):

H. R. Pappu ◽

K. B. Druffel

Keyword(s):

United States ◽

Genomic Sequence ◽

The United States ◽

Genomic Region ◽

Rt Pcr ◽

Specific Primer ◽

Sequence Comparisons ◽

First Report ◽

Group Specific Primer ◽

Free Material

Streptocarpus flower break virus (SFBV) belongs to the genus Tobamovirus and was described from naturally infected streptocarpus plants in 1995 (2). The complete genomic sequence was recently reported (1). Prominent symptoms include flower breaking while foliar symptoms are often lacking. In March 2007, four streptocarpus plants (cv. Indigo Dream) from San Diego County, CA were tested for the presence of SFBV by ELISA and reverse transcription (RT)-PCR. Symptoms suggestive of a virus infection were not present on these mother plants at the time of sampling. ELISA with SFBV-specific antiserum showed that all samples were infected with SFBV. The ELISA results were verified by RT-PCR followed by cloning and sequencing. Two sets of primer pairs were used in separate RT-PCR tests. One was a degenerate tobamovirus group-specific primer pair and the second primer pair was specific to SFBV (1). The tobamovirus group-specific primer pair consisted of Tob Uni1, 5′-ATT TAA GTG GAG GGA AAA CCA CT-3′ and Tob Uni2, 5′-GTY GTT GAT GAG TTC GTG GA-3′. The SFBV-specific primers were SFBVcpF: 5′-AAA ATG TCG TAC GTG GTG GT and SFBVcpR: 5′-ACC CAC AGA ACT TCC TTC AA-3′ (1). PCR amplicons of the expected size (686 bp for the tobamovirus group-specific primer pair and 562 bp for the SFBV-specific primer pair) were obtained for each primer pair. The positive PCR test using the SFBV-specific primer pair confirmed the presence of SFBV. To further verify the identity of the virus, the amplicons obtained with each primer pair were separately cloned and sequenced. At least two clones for each amplicon were sequenced in both directions. Sequence comparisons with those available in GenBank showed 98% sequence identity with the corresponding genomic region (GenBank Accession No. NC_008365) of SFBV (1). To our knowledge, this is the first report of SFBV in the United States and it highlights the need for testing for this virus to ensure propagation and distribution of virus-free material. References: (1) C. Heinze et al. Arch. Virol. 151:763, 2006. (2) J. Th. J. Verhoeven et al. Eur. J. Plant Pathol. 101:311, 1995.

Download Full-text

Expansion of Groundnut ringspot virus Host and Geographic Ranges in Solanaceous Vegetables in Peninsular Florida

Plant Health Progress ◽

10.1094/php-2011-0725-01-br ◽

2011 ◽

Vol 12 (1) ◽

pp. 34 ◽

Cited By ~ 6

Author(s):

Craig G. Webster ◽

William W. Turechek ◽

H. Charles Mellinger ◽

Galen Frantz ◽

Nancy Roe ◽

...

Keyword(s):

United States ◽

The United States ◽

Vegetable Production ◽

Viral Pathogen ◽

Geographic Ranges ◽

First Report ◽

Geographic Spread ◽

Wide Range ◽

Production Areas ◽

Solanaceous Plants

To the best of our knowledge, this is the first report of GRSV infecting tomatillo and eggplant, and it is the first report of GRSV infecting pepper in the United States. This first identification of GRSV-infected crop plants in commercial fields in Palm Beach and Manatee Counties demonstrates the continuing geographic spread of the virus into additional vegetable production areas of Florida. This information indicates that a wide range of solanaceous plants is likely to be infected by this emerging viral pathogen in Florida and beyond. Accepted for publication 27 June 2011. Published 25 July 2011.

Download Full-text

First Report of Cherry virus A in Sweet Cherry Trees in China

Plant Disease ◽

10.1094/pdis-93-4-0425b ◽

2009 ◽

Vol 93 (4) ◽

pp. 425-425 ◽

Cited By ~ 4

Author(s):

W.-L. Rao ◽

Z.-K. Zhang ◽

R. Li

Keyword(s):

Sweet Cherry ◽

Community Gardens ◽

Mottle Virus ◽

Replicase Gene ◽

Rt Pcr ◽

First Report ◽

Type Isolate ◽

The Family ◽

Flowering Cherry ◽

Cherry Trees

Plants in the genus Prunus of the family Rosaceae are important fruit and ornamental trees in China. In June of 2007, sweet cherry (Prunus avium) trees with mottling and mosaic symptoms were observed in a private garden near Kunming, Yunnan Province. Twenty-four samples, six each from sweet cherry, sour cherry (P. cerasus), flowering cherry (P. serrulata), and peach (P. persica) were collected from trees in private and community gardens in the area. The peach and sour and flowering cherry trees did not show any symptoms. Total nucleic acids were extracted using a cetyltrimethylammoniumbromide (CTAB) extraction method, and the extracts were tested for the following eight viruses by reverse transcription (RT)-PCR: American plum line pattern virus, Apple chlorotic leaf spot virus, Cherry green ring mottle virus, Cherry necrotic rusty mottle virus, Cherry virus A (CVA), Little cherry virus 1, Prune dwarf virus, and Prunus necrotic ringspot virus. Only CVA was detected in two symptomatic sweet cherry trees by RT-PCR with forward (5′-GTGGCATTCAACTAGCACCTAT-3′) and reverse (5′-TCAGCTGCCTCAGCTTGGC-3′) primers specific to an 873-bp fragment of the CVA replicase gene (2). The CVA infection of the two trees was confirmed by RT-PCR using primers CVA-7097U and CVA-7383L that amplified a 287-bp fragment from the 3′-untranslated region (UTR) of the virus (1). Amplicons from both amplifications were cloned and sequenced. Analysis of the predicted amino acid sequences of the 873-bp fragments (GenBank Accession Nos. EU862278 and EU862279) showed that they were 98% identical with each other and 97 to 98% with the type isolate of CVA from Germany (GenBank Accession No. NC_003689). The 286-bp sequences of the 3′-UTR (GenBank Accession Nos. FJ608982 and FJ608983) were 93% identical with each other and 93 to 98% with the type isolate. The sequence indicated that the three isolates were very similar and should be considered to be the same strain. CVA is a member of the genus Capillovirus in the family Flexiviridae and has been previously reported in Europe, North America, and Japan. The contribution of CVA to the symptoms observed and its distribution in China remain to be evaluated. To our knowledge, this is the first report of CVA in sweet cherry in China. References: (1) M. Isogai et al. J. Gen. Plant Pathol. 70:288. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995.

Download Full-text

First Report of Natural Infection of Penstemon acuminatus with Cucumber mosaic virus in the Treasure Valley Region of Idaho and Oregon

Plant Disease ◽

10.1094/pdis-93-7-0762a ◽

2009 ◽

Vol 93 (7) ◽

pp. 762-762 ◽

Cited By ~ 1

Author(s):

R. K. Sampangi ◽

C. Almeyda ◽

K. L. Druffel ◽

S. Krishna Mohan ◽

C. C. Shock ◽

...

Keyword(s):

Cucumber Mosaic Virus ◽

Mosaic Virus ◽

Great Basin ◽

Natural Infection ◽

The United States ◽

Native Plant ◽

Rt Pcr ◽

Cmv Infection ◽

Spot Virus ◽

First Report

Penstemons are perennials that are grown for their attractive flowers in the United States. Penstemon species (P. acuminatus, P. deustus, and P. speciosus) are among the native forbs considered as a high priority for restoration of great basin rangelands. During the summer of 2008, symptoms of red spots and rings were observed on leaves of P. acuminatus (family Scrophulariaceae) in an experimental trial in Malheur County, Oregon where the seeds from several native forbs were multiplied for restoration of range plants in intermountain areas. These plants were cultivated as part of the Great Basin Native Plant Selection and Increase Project. Several native wildflower species are grown for seed production in these experimental plots. Plants showed red foliar ringspots and streaks late in the season. Fungal or bacterial infection was ruled out. Two tospoviruses, Impatiens necrotic spot virus and Tomato spotted wilt virus, and one nepovirus, Tomato ring spot virus, are known to infect penstemon (2,3). Recently, a strain of Turnip vein-clearing virus, referred to as Penstemon ringspot virus, was reported in penstemon from Minnesota (1). Symptomatic leaves from the penstemon plants were negative for these viruses when tested by ELISA or reverse transcription (RT)-PCR. However, samples were found to be positive for Cucumber mosaic virus (CMV) when tested by a commercially available kit (Agdia Inc., Elkhart, IN). To verify CMV infection, total nucleic acid extracts from the symptomatic areas of the leaves were prepared and used in RT-PCR. Primers specific to the RNA-3 of CMV were designed on the basis of CMV sequences available in GenBank. The primer pair consisted of CMV V166: 5′ CCA ACC TTT GTA GGG AGT GA 3′ and CMV C563: 5′ TAC ACG AGG ACG GCG TAC TT 3′. An amplicon of the expected size (400 bp) was obtained and cloned and sequenced. BLAST search of the GenBank for related sequences showed that the sequence obtained from penstemon was highly identical to several CMV sequences, with the highest identity (98%) with that of a sequence from Taiwan (GenBank No. D49496). CMV from infected penstemon was successfully transmitted by mechanical inoculation to cucumber seedlings. Infection of cucumber plants was confirmed by ELISA and RT-PCR. To our knowledge, this is the first report of CMV infection of P. acuminatus. With the ongoing efforts to revegetate the intermountain west with native forbs, there is a need for a comprehensive survey of pests and diseases affecting these plants. References: (1) B. E. Lockhart et al. Plant Dis. 92:725, 2008. (2) D. Louro. Acta Hortic. 431:99, 1996. (3) M. Navalinskiene et al. Trans. Estonian Agric. Univ. 209:140, 2000.

Download Full-text

First Report of Grapevine leafroll associated virus-3 in American Vitis spp. Grapevines in Washington State

Plant Disease ◽

10.1094/pd-90-1461a ◽

2006 ◽

Vol 90 (11) ◽

pp. 1461-1461 ◽

Cited By ~ 8

Author(s):

M. J. Soule ◽

K. C. Eastwell ◽

R. A. Naidu

Keyword(s):

New York ◽

Economic Impact ◽

Virus Disease ◽

The United States ◽

Washington State ◽

The State ◽

Enzyme Linked Immunosorbent Assay ◽

Rt Pcr ◽

First Report ◽

Table Grapes

Washington State is the largest producer of juice grapes (Vitis labruscana ‘Concord’ and Vitis labrusca ‘Niagara’) and ranks second in wine grape production in the United States. Grapevine leafroll disease (GLD) is the most wide spread and economically significant virus disease in wine grapes in the state. Previous studies (2) have shown that Grapevine leafroll associated virus-3 (GLRaV-3) is the predominant virus associated with GLD. However, little is known about the incidence and economic impact of GLD on juice and table grapes. Because typical GLD symptoms may not be obvious among these cultivars, the prevalence and economic impact of GLD in Concord and Niagara, the most widely planted cultivars in Washington State, has received little attention from the grape and nursery industries. During the 2005 growing season, 32 samples from three vineyards and one nursery of ‘Concord’ and three samples from one nursery of ‘Niagara’ were collected randomly. Petiole extracts were tested by single-tube reverse transcription-polymerase chain reaction (RT-PCR; 3) with primers LC 1 (5′-CGC TAG GGC TGT GGA AGT ATT-3′) and LC 2 (5′-GTT GTC CCG GGT ACC AGA TAT-3′), specific for the heat shock protein 70 homologue (Hsp70h gene) of GLRaV-3 (GenBank Accession No. AF037268). One ‘Niagara’ nursery sample and eleven ‘Concord’ samples from the three vineyards tested positive for GLRaV-3, producing a single band of the expected size of 546 bp. The ‘Niagara’ and six of the ‘Concord’ RT-PCR products were cloned in pCR2.1 (Invitrogen Corp, Carlsbad, CA) and the sequences (GenBank Accession Nos. DQ780885, DQ780886, DQ780887, DQ780888, DQ780889, DQ780890, and DQ780891) compared with the respective sequence of a New York isolate of GLRaV-3 (GenBank Accession No. AF037268). The analysis revealed that GLRaV-3 isolates from ‘Concord’ and ‘Niagara’ share nucleotide identities of 94 to 98% and amino acid identities and similarities of 97 to 98% with the Hsp70h gene homologue of the New York isolate of GLRaV-3. Additional testing by double-antibody sandwich enzyme-linked immunosorbent assay (DAS-ELISA) using antibodies specific to GLRaV-3 (BIOREBA AG, Reinach, Switzerland) further confirmed these results in the ‘Niagara’ and two of the ‘Concord’ isolates. GLRaV-3 has previously been reported in labrusca cvs. Concord and Niagara in western New York (4) and Canada (1), but to our knowledge, this is the first report of GLRaV-3 in American grapevine species in the Pacific Northwest. Because wine and juice grapes are widely grown in proximity to each other in Washington State and grape mealybug (Pseudococcus maritimus), the putative vector of GLRaV-3, is present in the state vineyards, further studies will focus on the role of American grapevine species in the epidemiology of GLD. References: (1) D. J. MacKenzie et al. Plant Dis. 80:955, 1996. (2) R. R. Martin et al. Plant Dis. 89:763, 2005. (3) A. Rowhani et al. ICGV, Extended Abstracts, 13:148, 2000. (4) W. F. Wilcox et al. Plant Dis. 82:1062, 1998.

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

First Report of Plum pox virus (Sharka Disease) in Prunus persica in the United States

Plant Disease ◽

10.1094/pdis.2000.84.2.202b ◽

2000 ◽

Vol 84 (2) ◽

pp. 202-202 ◽

Cited By ~ 65

Author(s):

L. Levy ◽

V. Damsteegt ◽

R. Welliver

Keyword(s):

Prunus Persica ◽

Virus Disease ◽

Sandwich Elisa ◽

Pcr Amplification ◽

The United States ◽

Enzyme Linked Immunosorbent Assay ◽

Plum Pox Virus ◽

Rt Pcr ◽

Peach Fruit ◽

First Report

Plum pox (Sharka) is the most important virus disease of Prunus in Europe and the Mediterranean region and is caused by Plum pox potyvirus (PPV). In September 1999, PPV-like symptoms were observed in peach fruit culls in a packinghouse in Pennsylvania. All symptomatic fruit originated from a single block of peach (P. persica cv. Encore) in Adams County. Trees in the block exhibited ring pattern symptoms on their leaves. A potyvirus was detected in symptomatic fruit using the Poty-Group enzyme-linked immunosorbent assay (ELISA) test from Agdia (Elkhart, IN). Reactions for symptomatic peach fruit and leaves also were positive using triple-antibody sandwich ELISA with the PPV polyclonal antibody from Bioreba (Carrboro, NC) for coating, the Poty-Group monoclonal antibody (MAb; Agdia) as the intermediate antibody, and double-antibody sandwich ELISA with PPV detection kits from Sanofi (Sanofi Diagnostics Pasteur, Marnes-La-Coquette, France) and Agdia and the REAL PPV kit (Durviz, Valencia, Spain) containing universal (5B) and strain typing (4DG5 and AL) PPV MAbs (1). PPV also was identified by immunocapture-reverse transcription-polymerase chain reaction (IC-RT-PCR) amplification and subsequent sequencing of the 220-bp 3′ noncoding region (2) (>99% sequence homology to PPV) and by IC-RT-PCR amplification of a 243-bp product in the coat protein (CP) gene (1). The virus was identified as PPV strain D based on serological typing with strainspecific MAbs and on PCR-restriction fragment length polymorphism of the CP IC-RT-PCR product with Rsa1 and Alu1 (1). This is the first report of PPV in North America. References: (1) T. Candresse et al. Phytopathology 88:198, 1998. (2) L. Levy and A. Hadidi. EPPO Bull. 24:595, 1994.

Download Full-text

First Report of Fragaria chiloensis cryptic virus, Fragaria chiloensis latent virus, Strawberry mild yellow edge virus, Strawberry necrotic shock virus, and Strawberry pallidosis associated virus in Single and Mixed Infections in Strawberry in Central Mexico

Plant Disease ◽

10.1094/pdis-11-12-1103-pdn ◽

2013 ◽

Vol 97 (7) ◽

pp. 1002-1002 ◽

Cited By ~ 6

Author(s):

L. Silva-Rosales ◽

M. N. Vázquez-Sánchez ◽

V. Gallegos ◽

M. L. Ortiz-Castellanos ◽

R. Rivera-Bustamante ◽

...

Keyword(s):

Viral Infections ◽

The United States ◽

Latent Virus ◽

Nucleotide Sequencing ◽

Mixed Infections ◽

Cryptic Virus ◽

First Report ◽

Detection And Identification ◽

Two Samples ◽

Fragaria Chiloensis

For phytosanitary purposes, the prevalence and incidence of viruses found in strawberry production within a centralized breeding program was investigated in Abasolo and Irapuato Counties, Guanajuato State, Mexico. Single and mixed infections of Strawberry mottle virus (SMoV) and Strawberry crinkle virus (SCV) were originally reported in the area (3), and subsequently, Strawberry latent ringspot virus (SLRSV) was also found (4). Samples of strawberry plants showing viral symptoms: stunting, mild chlorosis and reddening, occasional wrinkled, curled, and deformed leaves that may exhibit mottling, and chlorotic spots, forming a putative virus complex were collected in April and December 2007 and July and December 2008. The detection and identification of viruses reported in the United States, the country of origin of most of the imported plantlets, was carried out with sets of primers for 11 viruses, through reverse transcription (RT)-PCR (developed by Robert Martin and Ioannis Tzanetakis in Corvallis, OR). The endogenous NADH 2 subunit was employed to test the quality of the RNA extracted. Amplification conditions were: 40 cycles of 1 min at each temperature, denaturation at 95°C, annealing at 50°C for Strawberry necrotic shock virus (SNSV); 52°C for Strawberry mild yellow edge virus (SMYEV); 55°C for Fragaria chiloensis latent virus (FClLV), Strawberry pallidosis associated virus (SPaV), Fragaria chiloensis cryptic virus (FClCV), and SMoV; and 58°C for SCV and NADH dehydrogenase, followed by a final extension at 72°C of 5 min after completion of the 40 cycles. The cloning and nucleotide sequencing of amplified fragments revealed the presence of seven viral species in 40 samples collected. These were FClLV, SCV, SMoV, SNSV, SPaV, and SMYEV, which were allocated GenBank accession numbers of JQ629412, JQ629413, JQ629414, JQ629415, JQ629416, and JQ629417, respectively. Strawberry UC-4 and UC-10 (1,2) were planted as indicators of viral infections on an experimental plot. All seven viruses were detected in single or mixed infections. SMoV was the most commonly found in combination with other viruses. Out of 40 samples, 35 were positive for the presence of viruses and six had single infections, of which five had SMoV and one had SPaV. The remaining 29 samples had mixed infections with two or more viruses in a total of 22 combinations. The combination of FCICV + SMoV was present in five samples, whereas the combination of SMoV + SMYEV was in two samples. All other samples had two and up to six different viruses per plant. SMoV was detected in 26 out of the 40 samples tested. SNSV and FClCV were detected in 14 samples. SMYEV was present in 13 samples. SCV was present in nine samples, whereas SPaV and FClLV were found in eight samples each. To the best of our knowledge, this is the first report of FClLV, FClCV, SNSV, SMYEV, and SPaV in Mexico. References: (1) N. W. Frazier. Plant Dis. Rep. 58:28, 1974. (2) N. W. Frazier. Plant Dis. Rep. 58:203, 1974. (3) D. Teliz-Ortiz and A. Trejo-Reyes. Rev. Mex. Fitopatol. 7:38, 1989. (4) L. Pérez-Moreno et al. Rev. Mex. Fitopatol. 22:187, 2004.

Download Full-text

First Report of Tobacco ringspot virus Infecting Kudzu (Pueraria montana) in Louisiana

Plant Disease ◽

10.1094/pdis-10-12-0933-pdn ◽

2013 ◽

Vol 97 (4) ◽

pp. 561-561 ◽

Cited By ~ 2

Author(s):

S. Khankhum ◽

P. Bollich ◽

R. A. Valverde

Keyword(s):

Common Bean ◽

Mosaic Virus ◽

Seed Quality ◽

Soybean Mosaic Virus ◽

Ringspot Virus ◽

Wild Plants ◽

Rt Pcr ◽

Sequence Comparisons ◽

First Report ◽

Tobacco Ringspot Virus

Kudzu is an introduced legume commonly found growing as a perennial throughout the southeastern United States. This fast-growing vine was originally planted as an ornamental for forage and to prevent erosion (2), but is now considered an invasive species. During April 2011, a kudzu plant growing near a soybean field in Amite (Tangipahoa Parish, southeastern LA) was observed with foliar ringspot and mottle symptoms. Leaf samples were collected, and sap extracts (diluted 1:5 w/v in 0.02 M phosphate buffer pH 7.2) were mechanically inoculated onto carborundum-dusted leaves of at least five plants of the following species: kudzu, common bean (Phaseolus vulgaris) cv. Black Turtle Soup, globe amaranth (Gomphrena globosa), Nicotiana benthamiana, and soybean (Glycine max) cv. Asgrow AG 4801. Two plants of each species were also mock-inoculated. Eight to fourteen days after inoculation, all virus-inoculated plants showed virus symptoms that included foliar ringspots, mosaic, and mottle. Common bean and soybean also displayed necroses and were stunted. ELISA using antisera for Bean pod mottle virus, Cucumber mosaic virus, Soybean mosaic virus, and Tobacco ringspot virus (TRSV) (Agdia Inc., Elkhart, IN) were performed on field-collected kudzu and all inoculated plants species. ELISA tests resulted positive for TRSV but were negative for the other three viruses. All virus-inoculated plant species tested positive by ELISA. To confirm that TRSV was present in the samples, total RNA was extracted from infected and healthy plants and used in RT-PCR tests. The set of primers TRS-F (5′TATCCCTATGTGCTTGAGAG3′) and TRS-R (5′CATAGACCACCAGAGTCACA3′), which amplifies a 766-bp fragment of the RdRp of TRSV, were used (3). Expected amplicons were obtained with all of the TRSV-infected plants and were cloned and sequenced. Sequence analysis confirmed that TRSV was present in kudzu. Nucleotide sequence comparisons using BLAST resulted in a 95% similarity with the bud blight strain of TRSV which infects soybeans (GenBank Accession No. U50869) (1). TRSV has been reported to infect many wild plants and crops, including soybean. In soybean, this virus can reduce yield and seed quality (4). During summer 2012, three additional kudzu plants located near soybean fields showing ringspot symptoms were also found in Morehouse, Saint Landry, and West Feliciana Parishes. These three parishes correspond to the north, central, and southeast regions, respectively. These plants also tested positive for TRSV by ELISA and RT-PCR. The results of this investigation documents that TRSV was found naturally infecting kudzu near soybean fields in different geographical locations within Louisiana. Furthermore, a TRSV strain closely related to the bud blight strain that infects soybean was identified in one location (Amite). This finding is significant because infected kudzu potentially could serve as the source of TRSV for soybean and other economically important crops. To the best of our knowledge, this is the first report of TRSV infecting kudzu. References: (1) G. L. Hartman et al. 1999. Compendium of Soybean Diseases. American Phytopathological Society, St. Paul, MN. (2) J. H. Miller and B. Edwards. S. J. Appl. Forestry 7:165, 1983. (3) S. Sabanadzovic et al. Plant Dis. 94:126, 2010. (4) P. A. Zalloua et al. Virology 219:1, 1996.

Download Full-text

Molecular Characterization of Recombinant Strains of Potato virus Y From Saudi Arabia

Plant Disease ◽

10.1094/pdis-05-15-0562-re ◽

2016 ◽

Vol 100 (2) ◽

pp. 292-297 ◽

Cited By ~ 14

Author(s):

Mohamad Chikh-Ali ◽

Hayam Alruwaili ◽

Dalton Vander Pol ◽

Alexander V. Karasev

Keyword(s):

United States ◽

Saudi Arabia ◽

Seed Potato ◽

Potato Virus ◽

Potato Virus Y ◽

The United States ◽

Tuber Quality ◽

Rt Pcr ◽

First Report ◽

Recombinant Strains

Potato virus Y (PVY) exists as a complex of strains, many of which are recombinants. The practical importance of PVY recombinant strains has increased due to their ability to induce potato tuber necrotic ring spot disease (PTNRD) that seriously affects tuber quality. In Saudi Arabia, potato production has increased fivefold during the last three decades, reaching 460,000 tons per year. Although PVY has been reported as one of the main viruses affecting potatoes, no information is available on PVY strains circulating in the country. In August 2014, a survey was conducted in a seed potato field at Al-Jouf, Saudi Arabia. PVY-positive samples selected based on visual symptoms and serological reactivity were subjected to strain typing using multiplex RT-PCR assays and were determined to represent recombinant PVY strains. Whole genome sequences were determined for two representative isolates, S2 and S9, through direct sequencing of a series of overlapping RT-PCR fragments for each isolate, and found to represent strains PVY-NE11 and PVYZ (SYR-III), respectively. One of the recombinant types, SYR-III, was previously found in nearby Syria and Jordan, but the second recombinant, PVY-NE11, was found before only in the United States. Both recombinants, PVY-NE11 and SYR-III, were previously found associated with PTNRD and thought to be rare. The current identification of PVY-NE11 and SYR-III in seed potato in a new geographic region suggests that these recombinants may not be as rare as previously believed. This is the first report on the occurrence of recombinant strains of PVY in potato in Saudi Arabia, and the first report on the PVY-NE11 strain of PVY found in potato outside of the United States.

Download Full-text