scholarly journals First Report of Little cherry virus 1 Infecting Sweet Cherry in Ontario, Canada

Plant Disease ◽  
2021 ◽  
Author(s):  
Aaron Simkovich ◽  
Susanne Kohalmi ◽  
Aiming Wang
Keyword(s):  
San Diego ◽  
Sweet Cherry ◽  
The United States ◽  
Eastern Region ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Blastn Search ◽  
Cherry Trees

The Niagara fruit belt is one of the richest fruit-producing areas in Canada, contributing to 90% of Ontario's tender fruits such as peach, plum and sweet cherry. Little cherry virus 1 (LCV1) of the genus Velarivirus is a causal agent of little cherry disease which has devastated cherry crops in many regions (Eastwell and Bernardy 1998, Jelkmann and Eastwell, 2011). From 2013 to 2018, foliar symptoms indicative of viral infection such as leaf deformation, ringspot, mottling, vein clearing, and reddening were found on sweet cherry trees grown in the Niagara region. To determine if these trees were infected by a virus, small RNAs (sRNAs) were isolated from separately pooled asymptomatic and symptomatic leaves using the mirPremier microRNA isolation kit (Sigma Aldrich Canada, Oakville, ON). The sRNAs were used to create two libraries (four leaves per library) with the TruSeq Small RNA Sample Prep Kit (Illumina, San Diego, CA). The sRNA libraries were separately sequenced with the MiSeq Desktop Sequencer (Illumina, San Diego, CA). In total, 5,380,196 reads were obtained and Trimmomatic (Bolger et al. 2014) was used to remove adaptors. The remaining 4,733,804 clean reads were assembled into contigs using Velvet 0.7.31 (Zerbino and Birney, 2008) and Oases 0.2.09 (Schulz et al. 2012) with minimum length of 75 nt (Supplementary Table 1). A BLASTn search (Altschul et al. 1997) of the contigs identified the presence of Cherry virus A (genus: Capillovirus), two members of the Ilarvirus genus (Prunus necrotic ringspot virus and Prune dwarf virus) in both libraries. LCV1 was only found in contigs derived from the symptomatic library. Of the clean reads, 22,016 were assembled into six contigs (with lengths ranging from 86 to 116 nt, Supplementary Table 1) mapping to LCV1, covering 7.07% of the viral genome. To confirm LCV1 infection, primers were designed from the assembled contigs and used for reverse transcription polymerase chain reaction (RT-PCR). Amplicons were sequenced and the terminal sequences were determined using 5’ and 3’ RACE Systems (Invitrogen, Burlington, ON). Degenerate primers were designed from multiple sequence alignments of published LCV1 genomes for amplification and primer walking to obtain the sequence of LCV1 (Table S2). The complete genome sequence of LCV1 has a length of 16,934 nt and was deposited in GenBank (accession no. MN508820). A BLASTn search showed that this isolate is nearly identical (99.6% sequence identity) to an isolate from California (accession no. MN131067). To determine the incidence of infection, a field survey was performed at the same location during spring months of 2014 to 2018 using RT-PCR with primers specific to the viral coat protein gene (Supplementary Tale 2). Among 46 cherry trees sampled, two (4.3%) trees were infected with LCV1 and showed negative results with CVA, PNRSV and PDV. Both trees displayed mild suturing of primary and secondary veins (Supplementary Figure 1). LCV1 has been identified in Western stone fruit producing regions (British Columbia in Canada, and Washington, California, and Oregon in the United States of America). To the best of our knowledge, this is the first report of LCV1 in any eastern region of Canada. The low incidence of LCV1 suggests that this virus is not widespread in this region. Routine monitoring and detection of LCV1 is required to prevent this devastating cherry disease from spreading in this region.

scholarly journals First Report of Cherry virus A in Sweet Cherry Trees in China

Plant Disease ◽  
2009 ◽  
Vol 93 (4) ◽  
pp. 425-425 ◽  
Author(s):  
W.-L. Rao ◽  
Z.-K. Zhang ◽  
R. Li
Keyword(s):  
Sweet Cherry ◽  
Community Gardens ◽  
Mottle Virus ◽  
Replicase Gene ◽  
Rt Pcr ◽  
First Report ◽  
Type Isolate ◽  
The Family ◽  
Flowering Cherry ◽  
Cherry Trees

Plants in the genus Prunus of the family Rosaceae are important fruit and ornamental trees in China. In June of 2007, sweet cherry (Prunus avium) trees with mottling and mosaic symptoms were observed in a private garden near Kunming, Yunnan Province. Twenty-four samples, six each from sweet cherry, sour cherry (P. cerasus), flowering cherry (P. serrulata), and peach (P. persica) were collected from trees in private and community gardens in the area. The peach and sour and flowering cherry trees did not show any symptoms. Total nucleic acids were extracted using a cetyltrimethylammoniumbromide (CTAB) extraction method, and the extracts were tested for the following eight viruses by reverse transcription (RT)-PCR: American plum line pattern virus, Apple chlorotic leaf spot virus, Cherry green ring mottle virus, Cherry necrotic rusty mottle virus, Cherry virus A (CVA), Little cherry virus 1, Prune dwarf virus, and Prunus necrotic ringspot virus. Only CVA was detected in two symptomatic sweet cherry trees by RT-PCR with forward (5′-GTGGCATTCAACTAGCACCTAT-3′) and reverse (5′-TCAGCTGCCTCAGCTTGGC-3′) primers specific to an 873-bp fragment of the CVA replicase gene (2). The CVA infection of the two trees was confirmed by RT-PCR using primers CVA-7097U and CVA-7383L that amplified a 287-bp fragment from the 3′-untranslated region (UTR) of the virus (1). Amplicons from both amplifications were cloned and sequenced. Analysis of the predicted amino acid sequences of the 873-bp fragments (GenBank Accession Nos. EU862278 and EU862279) showed that they were 98% identical with each other and 97 to 98% with the type isolate of CVA from Germany (GenBank Accession No. NC_003689). The 286-bp sequences of the 3′-UTR (GenBank Accession Nos. FJ608982 and FJ608983) were 93% identical with each other and 93 to 98% with the type isolate. The sequence indicated that the three isolates were very similar and should be considered to be the same strain. CVA is a member of the genus Capillovirus in the family Flexiviridae and has been previously reported in Europe, North America, and Japan. The contribution of CVA to the symptoms observed and its distribution in China remain to be evaluated. To our knowledge, this is the first report of CVA in sweet cherry in China. References: (1) M. Isogai et al. J. Gen. Plant Pathol. 70:288. (2) W. Jelkmann. J. Gen. Virol. 76:2015, 1995.

scholarly journals First Report of Little cherry virus 2 in Flowering and Sweet Cherry Trees in China

Plant Disease ◽  
2011 ◽  
Vol 95 (11) ◽  
pp. 1484-1484 ◽  
Author(s):  
W.-L. Rao ◽  
F. Li ◽  
R.-J. Zuo ◽  
R. Li
Keyword(s):  
Sweet Cherry ◽  
Sequence Data ◽  
Community Gardens ◽  
Economic Losses ◽  
Helicase Domain ◽  
Rt Pcr ◽  
Viral Origin ◽  
First Report ◽  
Flowering Cherry ◽  
Cherry Trees

Many viruses infect Prunus spp. and cause diseases on them. During a survey of stone fruit trees in 2008 and 2009, flowering cherry (Prunus serrulata) and sweet cherry (P. avium) trees with foliar chlorosis and reddening, stem deformity, and tree stunting were observed in private orchards in Anning and Fumin counties of Yunnan Province. Some sweet cherry trees with severe symptoms yielded small and few fruits and had to be removed. Leaf samples were collected from 68 flowering cherry and 30 sweet cherry trees, either symptomatic or asymptomatic, from private orchards and community gardens in Kunming and counties Anning, Chenggong, Fumin, Jinning, Ludian and Yiliang. Total nucleic acids were extracted with a CTAB extraction method and tested by reverse transcription (RT)-PCR assay using virus-specific primers. Little cherry virus 2 (LChV-2), Cherry virus A (CVA), Prunus necrotic ringspot virus (PNRSV), and Prune dwarf virus (PDV) were detected and infection rates were 68.4, 16.3, 9.2, and 7.1%, respectively. Infection of LChV-2 was common in all counties except Ludian where the orchards were healthy. Of 68 infected trees, 29 were found to be infected with LChV-2 and CVA, PDV or PNRSV. LChV-2 was detected in this study by RT-PCR using a pair of novel primers, LCV2-1 (5′-TTCAATATGAGCAGTGTTCCTAAC-3′) and LCV2-4 (5′-ACTCGTCTTGTGACATACCAGTC-3′), in 59 flowering cherry (87%) and 8 sweet cherry (27%) trees, respectively. The primer pair was designed according to alignment of three available LChV-2 sequences (GenBank Nos. NC_005065, AF416335, and AF333237) to amplify the partial RNA-dependent RNA polymerase gene (ORF1b) of 781 bp. The amplicons of selected samples (Anning26 and Yiliang60) were sequenced directly and sequences of 651 bp (GenBank No. HQ412772) were obtained from both samples. Pairwise comparisons and phylogenetic analysis of the sequences show that the two isolates are identical to one another and share 92 to 96% at the amino acid (aa) sequence level to those of other isolates available in the GenBank database. The sequence data confirm that these isolates are a strain of LChV-2 and genetic variation among different strains is relatively high (2). Biological and serological assays are not available for the LChV-2 detection; therefore, the LChV-2 infections of these trees were further confirmed by RT-PCR using primer pair LCV2-5 (5′-TGTTTGTGTCATGTTGTCGGAGAAG-3′) and LCV2-6 (5′-TGAATACCCGAGAACAAGGACTC-3′), which amplified the helicase domain (ORF1a) of ~451 bp. The amplicons from samples Anning26 and Yiliang60 were cloned and sequenced. The 408-bp sequences (excluding primer sequences) were 92 to 98% identical at the aa sequence level to those of other isolates, confirming again their viral origin. LChV-2 (genus Ampelovirus, family Closteroviridae) (4) has been associated with little cherry disease (LChD), a widespread viral disease of sweet and sour cherries (1,3). The virus is transferred between geographic areas mainly by propagated materials. Ornamental and sweet cherries are important crops in China and LChD has the potential to cause significant economic losses. Thus, certified clean stock should be used to establish new orchards. To our knowledge, this is the first report of LChV-2 in cherries in China. References: (1) N. B. Bajet et al. Plant Dis. 92:234, 2008. (2) W. Jelkmann et al. Acta Hortic. 781:321, 2008. (3) B. Komorowska and M. Cieslińska, Plant Dis. 92:1366, 2008. (4) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005.

scholarly journals First Report of Little cherry virus 2 from Sweet Cherry in Poland

Plant Disease ◽  
2008 ◽  
Vol 92 (9) ◽  
pp. 1366-1366 ◽  
Author(s):  
B. Komorowska ◽  
M. Cieślińska
Keyword(s):  
Coat Protein ◽  
Sweet Cherry ◽  
Prunus Avium ◽  
Late Summer ◽  
Rt Pcr ◽  
Cherry Tree ◽  
First Report ◽  
Nontranslated Region ◽  
Methyltransferase Gene ◽  
Cherry Trees

Little cherry disease (LChD) is a serious viral disease of sweet (Prunus avium) and sour (P. cerasus) cherry trees. Infection of sensitive cultivars results in small, angular, and pointed fruits with reduced sweetness. In late summer, leaves show a characteristic red coloration or bronzing of the surfaces. One Ampelovirus species, Little cherry virus 2 (LChV-2) (2), and one unassigned species in the Closteroviridae, Little cherry virus 1 (LChV-1) (3), have been associated with LChD. Twenty-seven sour and sweet cherry trees of six varieties from orchards located in several regions of Poland were tested for LChV-1 and LChV-2. Leaf samples were taken either from trees showing fruit symptoms or from asymptomatic trees during the summer of the 2006 growing season. RNA was isolated from the leaves with an RNeasy Kit (Qiagen, Hilden, CA), and reverse transcription (RT)-PCR was performed using primer pairs LCV1U/LCV1L and LCV2UP2/LCV2LO2, which are specific for a 419-bp fragment of the LChV-1 3′ nontranslated region and a 438-bp fragment of the LChV-2 methyltransferase gene, respectively (1). The primer pair L2CPF (5′-GTTCGAAAGTGTTTCTTGAT-3′) and L2CPR (5′-GCAACAGAAAAACATATGACTCA-3′) was designed from existing LChV-2 sequences (GenBank Accession Nos. AF416335 and NC_005065) to amplify the entire LChV-2 coat protein (CP) gene (nucleotides 13,007 to 14,134). The amplified cDNA fragments of LChV-2 genome were ligated to the bacterial vector pCR2.1-TOPO (Invitrogen, Carlsbad, CA), which was used to transform Escherichia coli TOP10 competent cells following the manufacturer's protocol. Both strands of three clones for each amplified LChV-2 genome fragment were sequenced with an automated nucleotide sequencer at the Institute of Biochemistry and Biophysics in Warsaw. RT-PCR results showed that 6 of 27 trees were infected, with LChV-1 detected in five sweet cherry trees and LChV-2 singly infecting one sweet cherry tree cv Elton (isolate C4/14). The nucleotide sequence of the 438-bp methyltransferase gene fragment of isolate C4/14 showed 86, 85, and 84% identity to GenBank Accession Nos. AF333237, AF531505, and AJ430056, respectively, all previously reported LChV-2 sequences from cherry trees. Sequence analysis of the 1,088-bp coat protein gene showed 89 to 91% and 92 to 93% nucleotide and amino acid identity, respectively, with the aforementioned three LChV-2 isolates. The tree infected with LChV-2 was indexed by graft transmission to the woody indicator, Prunus avium cv. Canindex, which showed reddening of the leaves characteristic of LChD 3 months after inoculation. Since cherry production in Poland is 230,000 t per year, the disease may have a significant economic impact because the affected fruits are unsuitable either for consumption or sale. To our knowledge, this is the first report of LChV-2 in Poland. References: (1) M. E. Rott and W. Jelkmann. Phytopathology 91:261, 2001. (2) M. E. Rott and W. Jelkmann. Arch. Virol. 150:107, 2005. (3) M. Vitushkina et al. Eur. J. Plant Pathol. 103:803, 1997.

scholarly journals Characterization of Cherry leafroll virus in Sweet Cherry in Washington State

Plant Disease ◽  
2010 ◽  
Vol 94 (8) ◽  
pp. 1067-1067 ◽  
Author(s):  
K. C. Eastwell ◽  
W. E. Howell
Keyword(s):  
Mosaic Virus ◽  
Sweet Cherry ◽  
The United States ◽  
Ringspot Virus ◽  
Natural Occurrence ◽  
Rt Pcr ◽  
Fresh Market ◽  
Arabis Mosaic Virus ◽  
Leafroll Virus ◽  
Cherry Trees

A visual survey in 1998 of a commercial block of 594 sweet cherry trees (Prunus avium) in Yakima County, WA, revealed three trees of cv. Bing growing on Mazzard rootstock that exhibited a progressive decline characterized by a premature drop of yellowed leaves prior to fruit maturity and small, late ripening cherries that were unsuitable for the fresh market. Many young branches of these trees died during the winter, resulting in a sparse, open canopy depleted of fruiting shoots. The budded variety of a fourth tree had died, allowing the F12/1 rootstock to grow leaves that showed intense line patterns. Prunus necrotic ringspot virus or Prune dwarf virus are common ilarviruses of cherry trees but were only detected by ELISA (Agdia, Elkhart, IN) in two of the Bing trees. A virus was readily transmitted mechanically from young leaves of each of the two ilarvirus-negative trees to Chenopodium quinoa and Nicotiana occidentalis strain ‘37B’, which within 5 days, developed systemic mottle and necrotic flecking, respectively. Gel analysis of double-stranded RNA (dsRNA) isolated from C. quinoa revealed two abundant bands of approximately 6.5 and 8.0 kbp. The C. quinoa plants and the four symptomatic orchard trees were free of Arabis mosaic virus, Blueberry leaf mottle virus, Peach rosette mosaic virus, Raspberry ringspot virus, Strawberry latent ringspot virus, Tobacco ringspot virus, Tomato black ring virus, and Tomato ringspot virus when tested by ELISA. However, C. quinoa leaf extracts reacted positively in gel double diffusion assays with antiserum prepared to the cherry isolate of Cherry leafroll virus (CLRV) (2). A CLRV-specific primer (3) was used for first strand synthesis followed by self-primed second strand synthesis to generate cDNAs from the dsRNA. A consensus sequence of 1,094 bp generated from three clones of the 3′-untranslated region (3′-UTR) of CLRV (GenBank Accession No. GU362644) was 98% identical to the 3′-UTR of CLRV isolates from European white birch (GenBank Accession Nos. 87239819 and 87239633) and 96% identical to European CLRV isolates from sweet cherry (GenBank Accession Nos. 87239639 and 8729640) (1). Reverse transcription (RT)-PCR using primers specific for the 3′-UTR (CGACCGTGTAACGGCAACAG, modified from Werner et al. [3] and CACTGCTTGAGTCCGACACT, this study), amplified the expected 344-bp fragment from the original four symptomatic trees and two additional symptomatic trees in the same orchard. Seventy-two nonsymptomatic trees were negative by the RT-PCR for CLRV. In 1999, CLRV was detected by RT-PCR in six of eight samples and seven of eight samples from declining trees in two additional orchards located 2.5 km and 23.3 km from the original site, respectively. Sequences of the 344-bp amplicons from these sites were 99.7% identical to those obtained from the first site. To our knowledge, this is the first report of the natural occurrence of CLRV in sweet cherry in the United States. Unlike other nepoviruses, CLRV appears not to be nematode transmitted; however, since this virus can be seed and pollen borne in some natural and experimental systems, its presence in independent orchards of a major production region raises concern about its long term impact on sweet cherry production. References: (1) K. Rebenstorf et al. J. Virol. 80:2453, 2006. (2) D. G. A. Walkey et al. Phytopathology 63:566, 1973. (3) R. Werner et al. Eur. J. For. Pathol. 27:309, 1997.

scholarly journals First Report of Cherry necrotic rusty mottle virus Infecting Sweet Cherry Trees in Korea

Plant Disease ◽  
2014 ◽  
Vol 98 (1) ◽  
pp. 164-164 ◽  
Author(s):  
I. S. Cho ◽  
G. S. Choi ◽  
S. K. Choi ◽  
E. Y. Seo ◽  
H. S. Lim
Keyword(s):  
Sweet Cherry ◽  
Mottle Virus ◽  
Post Inoculation ◽  
Rt Pcr ◽  
First Report ◽  
Coat Protein Region ◽  
Pcr Products ◽  
Leafroll Virus ◽  
Leaf Virus ◽  
Cherry Trees

Cherry necrotic rusty mottle virus (CNRMV), an unassigned member in the family Betaflexiviridae, has been reported in sweet cherry in North America, Europe, New Zealand, Japan, China, and Chile. The virus causes brown, angular necrotic spots, shot holes on the leaves, gum blisters, and necrosis of the bark in several cultivars (1). During the 2012 growing season, 154 sweet cherry trees were tested for the presence of CNRMV by RT-PCR. Samples were randomly collected from 11 orchards located in Gyeonggi and Gyeongsang provinces in Korea. RNA was extracted from leaves using the NucliSENS easyMAG system (bioMérieux, Boxtel, The Netherlands). The primer pair CGRMV1/2 (2) was used to amplify the coat protein region of CNRMV. Although none of the collected samples showed any notable symptoms, CNRMV PCR products of the expected size (949 bp) were obtained from three sweet cherry samples from one orchard in Gyeonggi province. The PCR products were cloned into a pGEM-T easy vector (Promega, Madison, WI) and sequenced. BLAST analyses of the three Korean sequences obtained (GenBank Accession Nos. AB822635, AB822636, and AB822637) showed 97% nucleotide sequence identity with a flowering cherry isolate from Japan (EU188439), and shared 98.8 to 99.6% nucleotide and 99.6 to 100% amino acid similarities to each other. The CNRMV positive samples were also tested for Apple chlorotic leaf spot virus (ACLSV), Cherry mottle leaf virus (CMLV), Cherry rasp leaf virus (CRLV), Cherry leafroll virus (CLRV), Cherry virus A (CVA), Little cherry virus 1 (LChV-1), Prune dwarf virus (PDV), and Prunus necrotic ringspot virus (PNRSV) by RT-PCR. One of the three CNRMV-positive samples was also infected with CVA. To confirm CNRMV infection by wood indexing, Prunus serrulata cv. Kwanzan plants were graft-inoculated with chip buds from the CNRMV-positive sweet cherry trees. At 3 to 4 weeks post-inoculation, the Kwanzan plants showed quick decline with leaves wilting and dying; CNRMV infection of the indicators was confirmed by RT-PCR. To our knowledge, this is the first report of CNRMV infection of sweet cherry trees in Korea. Screening for CNRMV in propagation nurseries should minimize spread of this virus within Korea. References: (1) R. Li and R. Mock. Arch. Virol. 153:973, 2008. (2) R. Li and R. Mock. J. Virol. Methods 129:162, 2005.

scholarly journals First Report of Freesia sneak virus in Freesia sp. in Virginia

Plant Disease ◽  
2009 ◽  
Vol 93 (9) ◽  
pp. 965-965 ◽  
Author(s):  
A. M. Vaira ◽  
M. A. Hansen ◽  
C. Murphy ◽  
M. D. Reinsel ◽  
J. Hammond
Keyword(s):  
Nucleic Acid ◽  
Mosaic Virus ◽  
The United States ◽  
Research Unit ◽  
Yellow Mosaic Virus ◽  
Cdna Clones ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
First Report ◽  
Leaf Necrosis

In the spring of 2008, freesia, cvs. Honeymoon and Santana, with striking virus-like symptoms similar to freesia leaf necrosis disease were received by the Virginia Tech Plant Disease Clinic from a cut-flower nursery in Gloucester, VA and forwarded for analysis to the USDA-ARS Floral and Nursery Plants Research Unit in Beltsville, MD. Approximately 25% of the plants had coalescing, interveinal, chlorotic, whitish, necrotic or dark brown-to-purple necrotic spots on leaves. Symptomatic plants were scattered within the planting. Fifteen symptomatic plants were collected between March and May of 2008, and nucleic acid extracts were analyzed for ophiovirus infection by reverse transcription (RT)-PCR with ophiovirus-specific degenerate primers (2). The diagnostic 136-bp ophiovirus product from the RdRp gene was amplified from 14 of 15 freesia plants tested. A partially purified virus preparation was analyzed by transmission electron microscopy and potyvirus- and ophiovirus-like particles were detected. The potyviruses, Freesia mosaic virus (FreMV) and Bean yellow mosaic virus (BYMV), each cause mosaic symptoms (3), although BYMV may induce necrosis late in the season. RT-PCR performed on the same nucleic acid samples using potyvirus coat protein (CP)-specific degenerate primers D335 and U335 (1) amplified the diagnostic 335-bp fragment from 2 of 15 plants. Cloned sequence from these plants was identified as FreMV. The ophiovirus CP gene was amplified by RT-PCR and cloned from two symptomatic freesia plants using primers FreSVf-CP-XhoI 5′-GACTCGAGAAATGTCTGGAAAATACTCTGTTC-3′ and FreSVf-CP-BamHI 5′-CCAGGATCCTTAGATAGTGAATCCATAAGCTG-3′, based on the sequence of Freesia sneak virus (FreSV) isolates from freesia (GenBank No. DQ885455) and lachenalia (4). The approximate 1.3-kb amplicon was cloned and sequences of two cDNA clones were identical (GenBank No. FJ807730). The deduced amino acid sequence showed 99% identity with the Italian FreSV CP sequence (GenBank No. DQ885455), confirming FreSV in the symptomatic freesia plants. To our knowledge, this is the first report of FreSV in Virginia and the United States. Soilborne freesia leaf necrosis disease has been reported in Europe since the 1970s (3); several viral causal agents have been hypothesized but recent findings correlate best with the ophiovirus. In Virginia, the presence of FreSV, but not FreMV, was strongly correlated with the leaf necrosis syndrome. FreSV, likely soilborne through Olpidium brassicae, may pose a new soilborne threat for bulbous ornamentals, since it has been recently detected also in Lachenalia spp. (Hyacinthaceae) from South Africa (4). Although specific testing of O. brassicae was not performed, the disease may potentially persist in the soil for years in O. brassicae resting spores and development of symptoms may be affected by environmental conditions (3). References: (1) S. A. Langeveld et al. J. Gen. Virol. 72:1531, 1991. (2) A. M. Vaira et al. Arch.Virol. 148:1037, 2003. (3) A. M. Vaira et al. Acta Hortic. 722:191, 2006. (4) A. M. Vaira et al. Plant Dis. 91:770, 2007.

scholarly journals First Report of a New Potyvirus, Tricyrtis virus Y, and Lily virus X, a Potexvirus, in Tricyrtis formosana in the United States

Plant Disease ◽  
2008 ◽  
Vol 92 (4) ◽  
pp. 648-648 ◽  
Author(s):  
R. L. Jordan ◽  
M. A. Guaragna ◽  
T. Van Buren ◽  
M. L. Putnam
Keyword(s):  
United States ◽  
Amino Acid ◽  
Mosaic Virus ◽  
The United States ◽  
Cdna Clones ◽  
Gene Products ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
First Report

Tricyrtis formosana (toad lily) is an herbaceous perennial in the family Liliaceae. Native to Asia, T. formosana is now used in the United States as an ornamental border plant in woodland and shade gardens. A T. formosana var. stolonifera plant showing chlorosis and mild mosaic symptoms obtained from a commercial grower in Columbia County, Oregon tested positive for potyvirus by ELISA using our genus Potyvirus broad spectrum reacting PTY-1 Mab (3). Electron microscopic examination of negatively stained leaf-dip preparations from symptomatic leaves showed a mixture of two sizes of flexuous rod-shaped particles, approximately 700 nm long (resembling potyviruses) and 470 nm long (resembling potexviruses). Total RNA extracts from symptomatic leaves were used in reverse transcription (RT)-PCR assays with potyvirus- or potexvirus-specific primers. The degenerate primers for the genus Potyvirus (2) direct the amplification of approximately 1,600-bp fragments from the 3′ terminus of most potyviruses. Overlapping potexvirus cDNA clones were generated using degenerate genus Potexvirus replicase primers, and later, virus-specific primers in 3′ RACE (4). The RT-PCR amplified fragments were cloned and sequenced. Analysis of the 1,688 nt potyvirus sequence (GenBank Accession No. AY864850) using BLAST showed highest identity with members of the Bean common mosaic virus (BCMV) subgroup of potyviruses. Pairwise amino acid comparisons of the CP region of the new potyvirus showed 78% identity to strains of Bean common mosaic necrosis virus, 77% identity with Soybean mosaic virus and Ceratobium mosaic virus, 72 to 76% identity to strains of BCMV, and only 50 to 64% identity with 54 other potyviruses. Additionally, similar pairwise analysis of the CP nucleotide sequence and 3′NCR of the new potyvirus generally revealed the same identity trend as described for the CP amino acid sequences, albeit with the highest nucleotide identities at less than 73% for CP and less than 66% for the 3′NCR. These results suggest that this virus is a new species in the genus Potyvirus (1), which we have tentatively named Tricyrtis virus Y (TrVY). BLAST analysis of the 3′ terminal 3,010 nt potexvirus sequence (GenBank Accession No. AY864849) showed 89% nucleotide identity with Lily virus X (LVX). Pairwise amino acid comparisons of the putative gene products revealed 98, 95, 94 and 99% identity with LVX TGBp1, TGBp2, TGBp3-like, and CP, respectively, and 97% identity with the 108 nt 3′NCR. Homology with other members of the genus Potexvirus was less than 50% for these corresponding genes and gene products. ELISA and RT-PCR analysis for these two viruses in toad lily plants obtained from a grower in Illinois also revealed the presence of TrVY in three of seven cultivars and LVX coinfecting only one of the plants. The standard propagation method for T. formosana is plant division, which along with mechanical contact, provides efficient means for spread of both viruses. To our knowledge, this is the first description of this potyvirus and the first report of any potyvirus in T. formosana. LVX has been reported in Lilium formosanum, but to our knowledge, this is also the first report of LVX in T. formosana. References: (1) P. H. Berger et al. Potyviridae. Page 819 in: Virus Taxonomy: 8th Rep. ICTV, 2005. (2) M. A. Guaragna et al. Acta. Hortic. 722:209, 2006. (3) R. L. Jordan and J. Hammond. J. Gen. Virol. 72:1531, 1991. (4) C. J. Maroon-Lango et al. Arch. Virol. 150:1187, 2005.

scholarly journals First Report of Calosphaeria pulchella Associated with Branch Dieback of Sweet Cherry Trees in California

Plant Disease ◽  
2010 ◽  
Vol 94 (9) ◽  
pp. 1167-1167 ◽  
Author(s):  
F. P. Trouillas ◽  
J. D. Lorber ◽  
F. Peduto ◽  
J. Grant ◽  
W. W. Coates ◽  
...  
Keyword(s):  
Sweet Cherry ◽  
Prunus Avium ◽  
Large Diameter ◽  
The United States ◽  
Internal Transcribed Spacer Region ◽  
First Report ◽  
Agar Plug ◽  
Vascular Discoloration ◽  
Branch Dieback ◽  
Cherry Trees

California is the second largest sweet cherry producer in the United States with approximately 10,800 ha and an average annual crop value of approximately $150 million. Perennial canker diseases constitute major threats to the cherry industry productivity by reducing tree health, longevity, and yields. During the course of summer 2006, we observed severe limb and branch dieback of sweet cherry (Prunus avium L.) in San Joaquin, San Benito, Contra Costa, and Stanislaus counties of California. Isolation from diseased branches repeatedly yielded the fungus Calosphaeria pulchella (Pers.: Fr.) J. Schröt. (1,2). Cankers and vascular necroses had developed in tree limbs and branches, generally initiating from the heart wood and later spreading into the sapwood. External symptoms of disease may be unapparent throughout the early stages of infection, particularly in large diameter shoots. Older infections often appeared as wilted leaves. Branches and trunks affected with cankers from which C. pulchella was isolated also generally bore perithecia of C. pulchella beneath the periderm. Perithecia were nonstromatic and arranged in dense, circinate groups, with elongated necks converging radially and fissuring the periderm. Asci were unitunicate, clavate, and 45 to 55 × 5 to 5.5 μm. Ascospores were allantoid to suballantoid, hyaline, and 5 to 6 × 1 μm. Colonies on potato dextrose agar (PDA) were dark pink to red in their center with a white margin. Conidia were hyaline, allantoid to oblong-ellipsoidal, and (3–) 4 to 6 (–9) × 1.5 to 2 (–2.5) μm. Identification of C. pulchella isolates also was confirmed by sequence comparison in GenBank database using the internal transcribed spacer region (ITS1-5.8S-ITS2) of the rDNA. Sequences of California isolates shared 100% similarity with C. pulchella reference isolate CBS 115999 (EU367451) (2). ITS sequences of the California isolates used in this study were deposited into GenBank (Nos. HM237297 to HM237300). Pathogenicity of four isolates recovered from the margin of active cankers was determined by branch inoculations. In December 2006, 2- to 4-year-old twigs of P. avium cv. Bing were inoculated with a 5-mm cork borer to remove bark and by placing an agar plug from the growing margin of 8-day-old colonies directly into the fresh wound, mycelium side down. Ten branches per isolate were inoculated. Ten control shoots were inoculated with noncolonized agar plugs. Inoculations were covered with vaseline and wrapped with Parafilm to retain moisture. Branches were harvested in July 2007 and taken to the laboratory to be examined for canker development, and the extent of vascular discoloration in each branch was assessed. Isolations from the edge of discolored tissue were conducted to fulfill Koch's postulates. After 8 months, C. pulchella was reisolated from 100% of the inoculated branches. Length of vascular discoloration averaged 62.5 mm in branches inoculated with the four C. pulchella isolates and 16.5 mm in the control twigs. No fungi were reisolated from the slightly discolored tissue of the controls. To our knowledge, this study constitutes the first report of C. pulchella as a pathogen of sweet cherry trees in California. References: (1) M. E. Barr. Mycologia 77:549, 1985. (2) U. Damm et al. Persoonia 20:39, 2008.

scholarly journals First Report of Mosaic Disease Caused by Colombian datura virus on Solanum lycopersicum Plants Commercially Cultivated in Japan

Plant Disease ◽  
2014 ◽  
Vol 98 (5) ◽  
pp. 698-698 ◽  
Author(s):  
Y. Tomitaka ◽  
T. Usugi ◽  
R. Kozuka ◽  
S. Tsuda
Keyword(s):  
Nucleotide Sequence ◽  
Solanum Lycopersicum ◽  
Mosaic Disease ◽  
Causal Agent ◽  
Cultivated Plants ◽  
Rt Pcr ◽  
Degenerate Primers ◽  
Specific Primers ◽  
Tomato Plants ◽  
First Report

In 2009, some commercially grown tomato (Solanum lycopersicum) plants in Chiba Prefecture, Japan, exhibited mosaic symptoms. Ten plants from a total of about 72,000 cultivated plants in the greenhouses showed such symptoms. To identify the causal agent, sap from leaves of the diseased plants was inoculated into Chenopodium quinoa and Nicotiana benthamiana plants. Local necrotic lesions appeared on inoculated leaves of C. quinoa, but no systemic infection was observed. Systemic mosaic symptoms were observed on the N. benthamiana plants inoculated. Single local lesion isolation was performed three times using C. quinoa to obtain a reference isolate for further characterization. N. benthamiana was used for propagation of the isolate. Sap from infected leaves of N. benthamiana was mechanically inoculated into three individual S. lycopersicum cv. Momotaro. Symptoms appearing on inoculated tomatoes were indistinguishable from those of diseased tomato plants found initially in the greenhouse. Flexuous, filamentous particles, ~750 nm long, were observed by electron microscopy in the sap of the tomato plants inoculated with the isolate, indicating that the infecting virus may belong to the family Potyviridae. To determine genomic sequence of the virus, RT-PCR was performed. Total RNA was extracted from the tomato leaves experimentally infected with the isolate using an RNeasy Plant Mini kit (QIAGEN, Hilden, Germany). RT-PCR was performed by using a set of universal, degenerate primers for Potyviruses as previously reported (2). Amplicons (~1,500 bp) generated by RT-PCR were extracted from the gels using the QIAquick Gel Extraction kit (QIAGEN) and cloned into pCR-BluntII TOPO (Invitrogen, San Diego, CA). DNA sequences of three individual clones were determined using a combination of plasmid and virus-specific primers, showing that identity among three clones was 99.8%. A consensus nucleotide sequence of the isolate was deposited in GenBank (AB823816). BLASTn analysis of the nucleotide sequence determined showed 99% identity with a partial sequence in the NIb/coat protein (CP) region of Colombian datura virus (CDV) tobacco isolate (JQ801448). Comparison of the amino acid sequence predicted for the CP with previously reported sequences for CDV (AY621656, AJ237923, EU571230, AM113759, AM113754, and AM113761) showed 97 to 100% identity range. Subsequently, CDV infection in both the original and experimentally inoculated plants was confirmed by RT-PCR using CDV-specific primers (CDVv and CDVvc; [1]), and, hence, the causal agent of the tomato disease observed in greenhouse tomatoes was proved to be CDV. The first case of CDV on tomato was reported in Netherlands (3), indicating that CDV was transmitted by aphids from CDV-infected Brugmansia plants cultivated in the same greenhouse. We carefully investigated whether Brugmansia plants naturally grew around the greenhouses, but we could not find them inside or in proximity to the greenhouses. Therefore, sources of CDV inoculum in Japan are still unclear. This is the first report of a mosaic disease caused by CDV on commercially cultivated S. lycopersicum in Japan. References: (1) D. O. Chellemi et al. Plant Dis. 95:755, 2011. (2) J. Chen et al. Arch. Virol. 146:757, 2001. (3) J. Th. J. Verhoeven et al. Eur. J. Plant. Pathol. 102:895, 1996.

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Sign in / Sign up

Export Citation Format

Share Document