First Report of the Huanglongbing Bacterium ‘Candidatus Liberibacter asiaticus’ Infecting Satkara (Citrus macroptera) in India

In India, satkara (Citrus macroptera) is found in the northeastern regions of Shella and Dowki near Cherrapunji in Meghalaya, the Jampui Hills of Tripura and Mizoram, and the Chendel District of Manipur. Locally, it is called satkara because ‘sat’ refers to multiples of seven and the fruit generally contains fourteen segments. The fruit is used in the preparation of pickles and its oil is used in the perfume industry. In January 2007, in Behliangchhip, Jampui Hills, Tripura, India, we noticed seven satkara trees of 26 showing leaf mottling and yellowing in young shoots, symptoms typical of huanglongbing (HLB). HLB is a destructive citrus disease caused by a nonculturable, phloem-limited alpha-proteobacterium of the genus ‘Candidatus Liberibacter’. Among the three known ‘Ca. Liberibacter’ species (Ca. Liberibacter asiaticus, Ca. L. africanus, and Ca. L. americanus), only Ca. L. asiaticus has been reported in India (1) but not from satkara. To identify the pathogen, total DNA was extracted and purified from 200 mg of leaf midribs from five symptomatic and five symptomless trees with the DNeasy Plant Mini Kit (Qiagen, Gmbh, Hilden, Germany) as per the manufacturer's instructions. Samples were tested for ‘Ca. L. asiaticus’ by PCR with primer sets OI1/OI2c targeting the 16S rDNA locus (3) and A2/J5 targeting the beta-operon locus of ribosomal proteins (2). DNA samples from all symptomatic leaves were positive with both primer sets. The OI1/OI2c primers generated an amplicon of approximately 1,160 bp and digestion of the amplicon by XbaI yielded two DNA fragments of approximately 640 bp and 520 bp, suggesting the presence of ‘Ca. L. asiaticus’(3). The A2/J5 primer set generated an ~703-bp amplicon, indicating ‘Ca. L. africanus’ was not present. No DNA was amplified from the asymptomatic satkara trees. One each of the OI1/OI2c and A2/J5 amplicons was purified, cloned (pGEM-T Easy vector, Promega, Hampshire, UK) and sequenced (Bangalore Genei, Bengaluru, Karnataka, India). The derived sequences, 1167 bp for the OI1/OI2c amplicon and 703 bp for the A2/J5 amplicon, have been deposited in the GenBank database under Accession Nos. GQ369792 and GU074017, respectively. Sequence comparison revealed that GQ369792 and GU074017 shared >99% identity to the corresponding regions of ‘Ca. L. asiaticus’ in the GenBank database. No DNA was amplified by PCR with primer set GB1/GB2 (4) specific for ‘Ca. L. americanus’. To our knowledge, this is the first report of molecular identification of ‘Ca. L. asiaticus’ infecting satkara in India. References: (1) A. K. Das. Curr. Sci. 87:1183, 2004. (2) A. Hocquellet et al. Mol. Cell. Probes 13:373, 1999. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996. (4) D. C. Teixeira et al. Mol. Cell. Probes 19:173, 2005.

Download Full-text

First report of ‘Candidatus Liberibacter asiaticus’ in Diaphorina communis

Australasian Plant Disease Notes ◽

10.1007/s13314-011-0031-9 ◽

2011 ◽

Vol 7 (1) ◽

pp. 1-4 ◽

Cited By ~ 17

Author(s):

N. J. Donovan ◽

G. A. C. Beattie ◽

G. A. Chambers ◽

P. Holford ◽

A. Englezou ◽

...

Keyword(s):

Candidatus Liberibacter Asiaticus ◽

First Report ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus

Download Full-text

First report on molecular evidence of Candidatus Liberibacter asiaticus associated with citrus Huanglongbing in Venezuela

Journal of Plant Pathology ◽

10.1007/s42161-020-00616-0 ◽

2020 ◽

Vol 102 (4) ◽

pp. 1333-1333

Author(s):

Edgloris Marys ◽

Eduardo Rodríguez-Román ◽

Rafael Mejías ◽

Alexander Mejías ◽

Mailyn Mago ◽

...

Keyword(s):

Molecular Evidence ◽

Candidatus Liberibacter Asiaticus ◽

First Report ◽

Candidatus Liberibacter ◽

Citrus Huanglongbing ◽

Liberibacter Asiaticus

Download Full-text

Distribution of Candidatus Liberibacter species in Eastern Africa, and the First Report of Candidatus Liberibacter asiaticus in Kenya

Scientific Reports ◽

10.1038/s41598-020-60712-0 ◽

2020 ◽

Vol 10 (1) ◽

Cited By ~ 3

Author(s):

Inusa J. Ajene ◽

Fathiya M. Khamis ◽

Barbara van Asch ◽

Gerhard Pietersen ◽

Nurhussen Seid ◽

...

Keyword(s):

Eastern Africa ◽

Candidatus Liberibacter Asiaticus ◽

First Report ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus

Download Full-text

First Report of ‘Candidatus Liberibacter asiaticus’ Associated with Huanglongbing on Citrus latifolia in Martinique and Guadeloupe, French West Indies

Plant Disease ◽

10.1094/pdis-08-13-0879-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 683-683 ◽

Cited By ~ 1

Author(s):

G. Cellier ◽

A. Moreau ◽

N. Cassam ◽

B. Hostachy ◽

P. Ryckewaert ◽

...

Keyword(s):

West Indies ◽

Plant Protection ◽

The United States ◽

Nutrient Deficiencies ◽

Candidatus Liberibacter Asiaticus ◽

Protein Subunit ◽

French West Indies ◽

First Report ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus

Huanglongbing is an unculturable vascular citrus pathogen transmitted from infected to healthy plants through grafting or by citrus psyllids, Diaphorina citri mainly in Asia and America and Trioza erytreae in Africa. This phloem limited gram-negative bacterium causes dramatic yield losses and is classified into three species based on 16S rDNA sequence analysis (2): (i) ‘Candidatus Liberibacter asiaticus’ (Las), the most epidemiologically active, widespread and heat tolerant species; (ii) ‘Ca. L. africanus’ (Laf), only found in Africa; and (iii) the newly described ‘Ca. L. americanus’ (Lam), which appeared in 2005 in Brazil (5). Considered as a quarantine organism in America and Europe, Las is actively affecting North America and Asia, and research is leading toward psyllid management and resistance breeding. Despite the fact that Reunion Island has successfully controlled Las by introducing a psyllid parasitoid, Tamarixia radiata (1), this strategy was less effective or reproducible within other territories. D. citri was first detected in Guadeloupe in 1998, where the control of the the psyllid population has been effective with T. radiata (3); and was first detected in Martinique in 2012. Following the outbreak in the United States and the Caribbean, and also supported by reports of symptoms in citrus orchards, local National Plant Protection Organizations (NPPO) organized a detection survey across both islands to verify the occurrence of Huanglongbing. Since 2012, 450 sites were prospected each year in Martinique and Guadeloupe, where 20 leaves from 10 to 30 trees were analyzed. DNA extraction was performed (DNeasy Plant Mini Kit, Qiagen) on fresh or dried leaf midribs, along with negative control midribs (Citrus paradisi ‘Star Rubis’) and PCR amplification was done with the species-specific primers A2/J5 (4) and GB1/GB3 (5). Only Las-specific 703-bp amplicons were obtained (n = 43) and 20 were sequenced (Beckman Coulter Genomics, United Kingdom; sequences available through GenBank Accession Nos. KF699074 to KF699093) and blasted against the National Center for Biotechnology Information non-redondant database (NCBI-nr). BLAST analysis revealed 100% identity with the 50S ribosomal protein subunit L1 (rplA) and L10 (rplJ) of ‘Ca. L. asiaticus’ (all strains), and no significant homology to other organisms. Additionally, sequence assembly on a reference genome (NC_012985) showed 100% homology. Huanglongbing was detected in Guadeloupe on March 2012 at Le Moule (East coast) in a Tahiti lime orchard (C. latifolia) and crossed the island in 6 months. Las was detected in Martinique on May 2013 on Tahiti lime (C. latifolia) at Bellefontaine (Northwest) in a private garden and at Le Lorrain (Northeast) in an orchard. Other species from the Rutaceae family were affected by HLB (C. reticulat and C. sinensis) on both islands; however, few of the positive samples showed HLB symptoms (blotchy mottle patterns and green islands on leaves), but presented symptoms similar to nutrient deficiencies. Despite the former presence of T. radiata in Guadeloupe and its detection in Martinique a few weeks after the detection of D. citri, where it had a mean parasitism rate of 70%, an outbreak of HLB spread across both islands. These analyses confirm the presence of HLB in Martinique and Guadeloupe and to our knowledge represent the first report of Las in the French West Indies. Introduction events remain unclear, but this report raises the importance of plant certification, psyllid population control, and surveillance of territories close to the French West Indies, with regards to the risk that HLB presents to citrus production worldwide. References: (1) B. Aubert et al. Fruits. 38, 1983. (2) J. M. Bové. J. Plant Pathol. 88:1, 2006. (3) J. Etienne et al. Fruits. 56:05, 2001. (4) A. Hocquellet et al. Mol. Cell. Probes 13:5, 1999. (5) D. C. Teixeira et al. Mol. Cell. Probes 19:3, 2005.

Download Full-text

Ultrastructural Changes and Putative Phage Particles Observed in Sweet Orange Leaves Infected with ‘Candidatus Liberibacter asiaticus’

Plant Disease ◽

10.1094/pdis-01-14-0106-re ◽

2015 ◽

Vol 99 (3) ◽

pp. 320-324 ◽

Cited By ~ 14

Author(s):

S. M. Fu ◽

John Hartung ◽

C. Y. Zhou ◽

H. N. Su ◽

J. Tan ◽

...

Keyword(s):

Sweet Orange ◽

Light And Electron Microscopy ◽

Ultrastructural Changes ◽

Candidatus Liberibacter Asiaticus ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus ◽

Orange Trees ◽

First Time ◽

Citrus Disease ◽

Putative Phage

Huanglongbing (HLB), also known as citrus greening, is currently the most destructive citrus disease. Anatomical analyses of HLB-affected sweet orange were carried out by light and electron microscopy. As compared with healthy citrus, the phloem plasmodesmata were plugged with callose, and in some samples the phloem was collapsed. Chloroplast structures were deformed. Prophage sequences occupy a significant portion of the genome of ‘Candidatus Liberibacter asiaticus’ and have been used to distinguish strains from Yunnan and Guangdong provinces in China and Florida. Interestingly, a large number of possible putative phage particles were observed attached on the surface of ‘Ca. L. asiaticus’ cells in plants inoculated with strain FJ3 from Fujian Province, China. Phage particles have been observed previously only in periwinkle plants artificially inoculated in Florida with ‘Ca. L. asiaticus’ that carried the SC1-type prophage. PCR assays verified the presence of the SC1-type prophage sequences previously described from this bacterium in Florida in the FJ3 isolate. This is the first time that suspected phage particles have been observed in sweet orange trees infected with ‘Ca. L. asiaticus.’

Download Full-text

First Report of Citrus Greening Disease and Associated Bacterium “Candidatus Liberibacter asiaticus” from Bhutan

Plant Disease ◽

10.1094/pdis.2003.87.4.448b ◽

2003 ◽

Vol 87 (4) ◽

pp. 448-448 ◽

Cited By ~ 4

Author(s):

Y. S. Ahlawat ◽

V. K. Baranwal ◽

Thinlay ◽

Doe Doe ◽

S. Majumder

Keyword(s):

Citrus Greening ◽

Ribosomal Protein Genes ◽

Candidatus Liberibacter Asiaticus ◽

African Countries ◽

First Report ◽

Citrus Greening Disease ◽

Pcr Product ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus ◽

Greening Disease

During July 2002, surveys of mandarin orchards were conducted in Punakha Valley and Wangdue districts of Bhutan. Symptoms of the greening disease were observed in most of the orchard. The incidence of disease was recorded up to 30% in 24 private orchards with more than 5,000 trees total. Affected trees were generally stunted with leaves showing symptoms of mottling. Sometimes, symptoms were seen only on one part of the canopy. The greening disease is caused by a fastidious phloem restricted bacterium, “Candidatus Liberibacter asiaticus” in Asian countries and “Candidatus Liberibacter africanus” in African countries. To confirm the presence of this bacterium causing greening disease in Bhutan, 33 leaf samples were collected from seven locations in Bhutan and stored at -80°C. Petioles and midribs were used for extraction of DNA using DNeasy Plant Mini Kit (Qiagen Gmbh, Hilden, Germany). Polymerase chain reaction (PCR) was initially performed with a sample from Rimchu, Bhutan using primer pair 5′TATAAAGGTTGACCTTTCGAGTTT/5′ACAAAAGCAGAAATAGCACGAACAA previously designed for amplification of ribosomal protein genes of β-operon of two liberibacter species (1). An amplicon of approximately 700 bp was obtained. The size of the PCR product is similar to that amplified from “Candidatus Liberibacter asiaticus”. The amplicon was cloned in pGEM-T easy vector and sequenced. The clone was 703 nt long and showed 100% sequence homology with the corresponding sequence of “Candidatus Liberibacter asiaticus” confirming that “Candidatus Liberibacter asiaticus” is the cause of greening disease in Bhutan. Later, one sample from each location was analyzed and found to be positive to greening. To our knowledge, this is the first report of this bacterium and greening disease in Bhutan, and citrus greening appears to be the main cause of declining citrus in the Punakha Region of Bhutan. Reference: (1) A. Jocquellet et al. Page 363 in: Proc. Conf. Int. Organ. Citrus Virol. 14th. IOCV, Riverside, CA, 2000.

Download Full-text

First Report of ‘Candidatus Liberibacter asiaticus’ from Atalantia buxifolia in Guangdong, China

Plant Disease ◽

10.1094/pdis-92-2-0314c ◽

2008 ◽

Vol 92 (2) ◽

pp. 314-314 ◽

Cited By ~ 5

Author(s):

X. Deng ◽

Z. Lou ◽

Z. Feng ◽

H. Li ◽

J. Chen ◽

...

Keyword(s):

Candidatus Liberibacter Asiaticus ◽

Chinese Medicinal Herb ◽

First Report ◽

Landscape Plant ◽

Healthy Control ◽

Candidatus Liberibacter ◽

Citrus Huanglongbing ◽

Health Progress ◽

Liberibacter Asiaticus ◽

Band Characteristic

Atalantia buxifolia (Poir.) Oliv., synonym Severinia buxifolia (Poir.) Ten. as commonly found in literature, is a common landscape plant and a popular Chinese medicinal herb known as Jiubingle or Dongfengjie. It remains unclear if this rutaceous plant could host ‘Candidatus Liberibacter asiaticus’, the pathogen of citrus Huanglongbing (HLB) in Guangdong, P. R. China. This information is important for HLB control in citrus because infected A. buxifolia could serve as a source of inoculum. In August of 1994, three A. buxifolia plants adjacent to a citrus experimental orchard of the South China Agricultural University at Guangzhou were found showing leaf mottle/yellowing symptoms. Two buds from each plant were grafted onto three mandarin trees (Citrus reticulata cv. Pongan) in a psyllid-proof screenhouse for indexing. By October of 1995, typical leaf mottle symptoms were observed in all three grafted trees compared with a healthy control. In March of 1996, one of the A. buxifolia plants was transferred to a screenhouse and has been maintained there. The leaf mottle/yellowing symptoms persisted but did not significantly affect plant growth. DNA was extracted from leaf samples in October 2006 by using the CTAB (cetyltrimethylammoniumbromide) method and assayed by nested-PCR using the general bacterial 16S rDNA primer set fDl/rD1 as the first round of amplification and primer set OI1/OI2c as second round amplification (1,3). After agarose gel electrophoresis and staining with ethidium bromide, an approximate 1.1-kb DNA band was detected in symptomatic samples but not healthy leaf samples of A. buxifolia and C. reticulata. XbaI digestion of the amplicons yielded approximate 500- and 600-bp fragments, characteristic of ‘Ca. L. asiaticus’. Similarly, a standard PCR with primer set A5/J2 (3) yielded an approximate 700-bp DNA band characteristic of ‘Ca. L. asiaticus’ from symptomatic samples only. To our knowledge, this is the first report of graft transmission and PCR detection of ‘Ca. L. asiaticus’ from A. buxifolia in Guangdong, P. R. China. This work also confirms the findings from Taiwan (2) that A. buxifolia could serve as a source of ‘Ca. L. asiaticus’. References: (1) X. Deng et al. Online publication. doi:10.1094/PHP-2007-0419-01-BR. Plant Health Progress, 2007. (2) T.-H. Hung et al. Eur. J. Plant Pathol. 107:183, 2001. (3) S. Jagoueix et al. Mol. Cell. Probes 10:43, 1996.

Download Full-text

First Report of the Causal Agent of Huanglongbing (“Candidatus Liberibacter asiaticus”) in Brazil

Plant Disease ◽

10.1094/pdis.2004.88.12.1382c ◽

2004 ◽

Vol 88 (12) ◽

pp. 1382-1382 ◽

Cited By ~ 131

Author(s):

H. D. Coletta-Filho ◽

M. L. P. N. Targon ◽

M. A. Takita ◽

J. D. De Negri ◽

J. Pompeu ◽

...

Keyword(s):

Polymerase Chain Reaction Amplification ◽

The Philippines ◽

Sao Paulo ◽

The State ◽

Nutritional Deficiencies ◽

São Paulo ◽

Candidatus Liberibacter Asiaticus ◽

First Report ◽

Candidatus Liberibacter ◽

Liberibacter Asiaticus

Huanglongbing (ex-greening) disease is one of the most serious diseases of citrus. It is caused by the phloem-limited, gram-negative bacterium “Candidatus Liberibacter spp.”. This bacterium is not well characterized mainly because it is still uncultured. There are two known strains, Asian (“Candidatus Liberibacter asiaticus”) and African (“Candidatus Liberibacter africanus”) that cause severe damage to citrus plants including twig dieback, decline, and death. Symptoms first appear as leaf mottling and chlorosis occurring in one shoot or sector of trees. Later, leaf symptoms resemble nutritional deficiencies (Zn, Ca, and N) that vary depending on the strains, with more severe symptoms caused by “Ca. L. asiaticus”. The Asian strains are transmitted by the Asian citrus psyllid (AsCP), Diaphorina citri, which is present in Brazil. The bacterium has been detected in citrus plants in many geographic locations including China, Japan, Thailand, India, the Philippines, the Arabian Peninsula, and Africa. In 2004, plants showing Huanglongbing symptoms were observed in the Araraquara County, a central region of the State of Sao Paulo, the largest citrus-producing area in Brazil. To verify the presence of “Ca. L. spp.” in these plants, leaf samples of sweet orange cvs. Hamlin and Valencia were used for DNA extraction and polymerase chain reaction amplification using the specific OI1 and Oi2c primers (1). Amplification of the 16S rDNA was positive for 2 (cvs. Hamlin and Valencia) of 10 analyzed plants. The amplified fragments were cloned and sequenced. The amplicons obtained from both plants showed the same sequence, which differed from “Ca. L. africanus”, utilized as the positive control in the amplification experiment (27 divergent bases in 1,160). The sequences were used for BLAST searches, and the results showed identities ranging from 94.71 to 100% with “Ca. L. spp.” sequences available at the National Center for Biotechnology Information database (on-line publication). The highest scores were obtained with “Ca. L. asiaticus sequences. These analyses confirmed the presence of such agent in the State of Sao Paulo. To our knowledge, this is the first report of “Ca. L. asiaticus” in Brazil as well as elsewhere in the Americas. The significance of this report relates to the potential damage that this pathogen could cause to the citrus industry in the largest citrus-producing country in the world. It remains unclear how and when the pathogen entered Brazil. Reference: (1) S. Jagoueix et al. Mol. Cell Probes 10:43, 1996.

Download Full-text