First Report of Leaf Blight and Stem Dieback of St. John's-Wort Caused by Diploceras hypericinum in Oregon

St. John's-wort, Hypericum perforatum L., was formerly considered a noxious weed in the Pacific Northwest and is now grown commercially for its medicinal properties. In May 1999, plants from a 5-ha field in Jefferson County, OR, were observed with yellowing leaves and stem dieback. Lower leaves showed marginal necrosis or circular, expanding, uniformly brown, unremarkable leaf lesions that appeared randomly over the lamina and consumed from a quarter to nearly the entire leaf area. Remaining leaf tissue was chlorotic, and affected leaves eventually abscised. Infection of the stems resulted in girdling lesions 0.5 to 1.0 cm in length that caused chlorosis, wilting, and eventual dieback of tissues distal to the lesion. Diploceras hypericinum (Cesati) Diedicke was sporulating on affected stems and leaves. The fungus was isolated from surface-disinfested tissue onto 1.5% water agar. A single-spore isolate was used to inoculate 10-month-old plants raised from seed in sand. Spores from 6-week-old cultures grown on 50% potato-dextrose agar were harvested, suspended in phosphate buffer with 0.2% gelatin (PBG), and sprayed onto three plants using a DeVilbiss atomizer. Inoculum concentration was 7 × 103 and 3 ml per plant were used (plants were 8 to 10 cm tall). Three control plants were sprayed with sterile PBG. Inoculated and control plants were separately bagged to retain moisture and maintained at 22 to 25°C. Four days later, inoculated plants exhibited leaf spots similar to those originally observed, followed by stem dieback. D. hypericinum was isolated from all inoculated plants but not from control plants. The known distribution of D. hypericinum is France, Germany, Portugal, Sweden, Greece, and Ontario, Canada (1,2). This is the first report of D. hypericinum causing leaf blight and stem dieback of St. John's-wort in the United States. References: (1) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN. (2) T. R. Nag Raj. 1993. Coelomycetous Anamorphs with Appendage-bearing Conidia. Mycologue Publications, Waterloo, Canada.

Download Full-text

First Report of Leaf Blight and Stem Canker of Pachysandra terminalis Caused by Pseudonectria pachysandricola in Korea

Plant Disease ◽

10.1094/pdis-09-11-0813 ◽

2012 ◽

Vol 96 (2) ◽

pp. 287-287

Author(s):

K. S. Han ◽

J. H. Park ◽

S. E. Cho ◽

H. D. Shin

Keyword(s):

United States ◽

Its Region ◽

Stem Canker ◽

The United States ◽

Culture Collection ◽

Leaf Blight ◽

First Report ◽

Cornell University ◽

Plastic Bags ◽

Young Leaves

Pachysandra terminalis Siebold & Zucc., known as Japanese pachysandra, is a creeping evergreen perennial belonging to the family Buxaceae. In April 2011, hundreds of plants showing symptoms of leaf blight and stem canker with nearly 100% incidence were found in a private garden in Suwon, Korea. Plants with the same symptoms were found in Seoul in May and Hongcheon in August. Affected leaves contained tan-to-yellow brown blotches. Stem and stolon cankers first appeared as water soaked and developed into necrotic lesions. Sporodochia were solitary, erumpent, circular, 50 to 150 μm in diameter, salmon-colored, pink-orange when wet, and with or without setae. Setae were hyaline, acicular, 60 to 100 μm long, and had a base that was 4 to 6 μm wide. Conidiophores were in a dense fascicle, not branched, hyaline, aseptate or uniseptate, and 8 to 20 × 2 to 3.5 μm. Conidia were long, ellipsoid to cylindric, fusiform, rounded at the apex, subtruncate at the base, straight to slightly bent, guttulate, hyaline, aseptate, 11 to 26 × 2.5 to 4.0 μm. A single-conidial isolate formed cream-colored colonies that turned into salmon-colored colonies on potato dextrose agar (PDA). Morphological and cultural characteristics of the fungus were consistent with previous reports of Pseudonectria pachysandricola B.O. Dodge (1,3,4). Voucher specimens were housed at Korea University (KUS). Two isolates, KACC46110 (ex KUS-F25663) and KACC46111 (ex KUS-F25683), were accessioned in the Korean Agricultural Culture Collection. Fungal DNA was extracted with DNeasy Plant Mini DNA Extraction Kits (Qiagen Inc., Valencia, CA). The complete internal transcribed spacer (ITS) region of rDNA was amplified with the primers ITS1/ITS4 and sequenced using ABI Prism 337 automatic DNA sequencer (Applied Biosystems, Foster, CA). The resulting sequence of 487 bp was deposited in GenBank (Accession No. JN797821). This showed 100% similarity with a sequence of P. pachysandricola from the United States (HQ897807). Isolate KACC46110 was used in pathogenicity tests. Inoculum was prepared by harvesting conidia from 2-week-old cultures on PDA. Ten young leaves wounded with needles were sprayed with conidial suspensions (~1 × 106 conidia/ml). Ten young leaves that served as the control were treated with sterile distilled water. Plants were covered with plastic bags to maintain a relative humidity of 100% at 25 ± 2°C for 24 h. Typical symptoms of brown spots appeared on the inoculated leaves 4 days after inoculation and were identical to the ones observed in the field. P. pachysandricola was reisolated from 10 symptomatic leaf tissues, confirming Koch's postulates. No symptoms were observed on control plants. Previously, the disease was reported in the United States, Britain, Japan, and the Czech Republic (2,3), but not in Korea. To our knowledge, this is the first report of P. pachysandricola on Pachysandra terminalis in Korea. Since this plant is popular and widely planted in Korea, this disease could cause significant damage to nurseries and the landscape. References: (1) B. O. Dodge. Mycologia 36:532, 1944. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ , September 24, 2011. (3) I. Safrankova. Plant Prot. Sci. 43:10, 2007. (4) W. A. Sinclair and H. H. Lyon. Disease of Trees and Shrubs. 2nd ed. Cornell University Press, Ithaca, NY, 2005.

Download Full-text

First Report of Alternaria Leaf Spot of Banana Caused by Alternaria alternata in the United States

Plant Disease ◽

10.1094/pdis-01-13-0007-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1116-1116 ◽

Cited By ~ 3

Author(s):

V. Parkunan ◽

S. Li ◽

E. G. Fonsah ◽

P. Ji

Keyword(s):

United States ◽

Alternaria Alternata ◽

Leaf Spot ◽

Morphological Characteristics ◽

The United States ◽

Its Sequencing ◽

Single Spore ◽

First Report ◽

Alternaria Leaf Spot ◽

Leaf Spots

Research efforts were initiated in 2003 to identify and introduce banana (Musa spp.) cultivars suitable for production in Georgia (1). Selected cultivars have been evaluated since 2009 in Tifton Banana Garden, Tifton, GA, comprising of cold hardy, short cycle, and ornamental types. In spring and summer of 2012, 7 out of 13 cultivars (African Red, Blue Torres Island, Cacambou, Chinese Cavendish, Novaria, Raja Puri, and Veinte Cohol) showed tiny, oval (0.5 to 1.0 mm long and 0.3 to 0.9 mm wide), light to dark brown spots on the adaxial surface of the leaves. Spots were more concentrated along the midrib than the rest of the leaf and occurred on all except the newly emerged leaves. Leaf spots did not expand much in size, but the numbers approximately doubled during the season. Disease incidences on the seven cultivars ranged from 10 to 63% (10% on Blue Torres Island and 63% on Novaria), with an average of 35% when a total of 52 plants were evaluated. Six cultivars including Belle, Ice Cream, Dwarf Namwah, Kandarian, Praying Hands, and Saba did not show any spots. Tissue from infected leaves of the seven cultivars were surface sterilized with 0.5% NaOCl, plated onto potato dextrose agar (PDA) media and incubated at 25°C in the dark for 5 days. The plates were then incubated at room temperature (23 ± 2°C) under a 12-hour photoperiod for 3 days. Grayish black colonies developed from all the samples, which were further identified as Alternaria spp. based on the dark, brown, obclavate to obpyriform catenulate conidia with longitudinal and transverse septa tapering to a prominent beak attached in chains on a simple and short conidiophore (2). Conidia were 23 to 73 μm long and 15 to 35 μm wide, with a beak length of 5 to 10 μm, and had 3 to 6 transverse and 0 to 5 longitudinal septa. Single spore cultures of four isolates from four different cultivars were obtained and genomic DNA was extracted and the internal transcribed spacer (ITS1-5.8S-ITS2) regions of rDNA (562 bp) were amplified and sequenced with primers ITS1 and ITS4. MegaBLAST analysis of the four sequences showed that they were 100% identical to two Alternaria alternata isolates (GQ916545 and GQ169766). ITS sequence of a representative isolate VCT1FT1 from cv. Veinte Cohol was submitted to GenBank (JX985742). Pathogenicity assay was conducted using 1-month-old banana plants (cv. Veinte Cohol) grown in pots under greenhouse conditions (25 to 27°C). Three plants were spray inoculated with the isolate VCT1FT1 (100 ml suspension per plant containing 105 spores per ml) and incubated under 100% humidity for 2 days and then kept in the greenhouse. Three plants sprayed with water were used as a control. Leaf spots identical to those observed in the field were developed in a week on the inoculated plants but not on the non-inoculated control. The fungus was reisolated from the inoculated plants and the identity was confirmed by morphological characteristics and ITS sequencing. To our knowledge, this is the first report of Alternaria leaf spot caused by A. alternata on banana in the United States. Occurrence of the disease on some banana cultivars in Georgia provides useful information to potential producers, and the cultivars that were observed to be resistant to the disease may be more suitable for production. References: (1) E. G. Fonsah et al. J. Food Distrib. Res. 37:2, 2006. (2) E. G. Simmons. Alternaria: An identification manual. CBS Fungal Biodiversity Center, Utrecht, Netherlands, 2007.

Download Full-text

First report of Coleus blumei viroid 1 in commercial Coleus blumei in the United States

Plant Disease ◽

10.1094/pdis-05-21-0917-pdn ◽

2021 ◽

Author(s):

Gardenia Orellana ◽

Alexander V Karasev

Keyword(s):

United States ◽

Leaf Tissue ◽

The United States ◽

Universal Primers ◽

Rt Pcr ◽

Universal Primer ◽

Tissue Samples ◽

First Report ◽

Specific Pcr ◽

Coleus Blumei

Coleus scutellarioides (syn. Coleus blumei) is a widely grown evergreen ornamental plant valued for its highly decorative variegated leaves. Six viroids, named Coleus blumei viroid 1 to 6 (CbVd-1 to -6) have been identified in coleus plants in many countries of the world (Nie and Singh 2017), including Canada (Smith et al. 2018). However there have been no reports of Coleus blumei viroids occurring in the U.S.A. (Nie and Singh 2017). In April 2021, leaf tissue samples from 27 cultivars of C. blumei, one plant of each, were submitted to the University of Idaho laboratory from a commercial nursery located in Oregon to screen for the presence of viroids. The sampled plants were selected randomly and no symptoms were apparent in any of the samples. Total nucleic acids were extracted from each sample (Dellaporta et al. 1983) and used in reverse-transcription (RT)-PCR tests (Jiang et al. 2011) for the CbVd-1 and CbVd-5 with the universal primer pair CbVds-P1/P2, which amplifies the complete genome of all members in the genus Coleviroid (Jiang et al. 2011), and two additional primer pairs, CbVd1-F1/R1 and CbVd5-F1/R1, specific for CbVd-1 and CbVd-5, respectively (Smith et al. 2018). Five C. blumei plants (cvs Fire Mountain, Lovebird, Smokey Rose, Marrakesh, and Nutmeg) were positive for a coleviroid based on the observation of the single 250-nt band in the RT-PCR test with CbVds-P1/P2 primers. Two of these CbVd-1 positive plants (cvs Lovebird and Nutmeg) were also positive for CbVd-1 based on the presence of a single 150-nt band in the RT-PCR assay with CbVd1-F1/R1 primers. One plant (cv Jigsaw) was positive for CbVd-1, i.e. showing the 150-nt band in RT-PCR with CbVd1-F1/R1 primers, but did not show the ca. 250-bp band in RT-PCR with primers CbVds-P1/P2. None of the tested plants were positive for CbVd-5, either with the specific, or universal primers. All coleviroid- and CbVd-1-specific PCR products were sequenced directly using the Sanger methodology, and revealed whole genomes for five isolates of CbVd-1 from Oregon, U.S.A. The genomes of the five CbVd-1 isolates displayed 96.9-100% identity among each other and 96.0-100% identity to the CbVd-1 sequences available in GenBank. Because the sequences from cvs Lovebird, Marrakesh, and Nutmeg, were found 100% identical, one sequence was deposited in GenBank (MZ326145). Two other sequences, from cvs Fire Mountain and Smokey Rose, were deposited in the GenBank under accession numbers MZ326144 and MZ326146, respectively. To the best of our knowledge, this is the first report of CbVd-1 in the United States.

Download Full-text

First Report of Downy Mildew Caused by Plasmopara obducens on Impatiens in California

Plant Disease ◽

10.1094/pdis.2004.88.8.909b ◽

2004 ◽

Vol 88 (8) ◽

pp. 909-909 ◽

Cited By ~ 14

Author(s):

S. N. Wegulo ◽

S. T. Koike ◽

M. Vilchez ◽

P. Santos

Keyword(s):

United States ◽

Downy Mildew ◽

Disease Incidence ◽

Leaf Tissue ◽

The United States ◽

Plant Diseases ◽

Single Type ◽

First Report ◽

Commercial Grower ◽

Impatiens Walleriana

During February 2004, diseased double impatiens (Impatiens walleriana) plants were received from a commercial grower in southern California. The upper surfaces of symptomatic leaves were pale yellow with no distinct lesions. Diseased leaves later wilted, and severely affected leaves abscised from the stem. At the nursery, only double impatiens plants in the Fiesta series were infected, and some cultivars were more heavily infected than others. Disease incidence in cv. Sparkler Hot pink was nearly 100%. The interior of infected leaves was colonized by coenocytic mycelium. A conspicuous white growth was observed only on the underside of leaves. Sporangiophores were hyaline, thin walled, emergent from stomata, and had slightly swollen bases. Sporangiophore branching was distinctly monopodial. Smaller sporangiophore branches were arranged at right angles to the supporting branches, and tips of branches measured 8 to 14 μm long. Sporangia were ovoid and hyaline with a single pore on the distal ends. Distal ends of sporangia were predominantly flat but occasionally had a slight papilla. Short pedicels were present on the attached ends. Sporangia measured 19.4 to 22.2 (-25.0) μm × 13.9 to 16.7 (-19.4) μm. Oospores were not observed in leaf tissue. On the basis of symptoms and morphology of the organism, the pathogen was identified as Plasmopara obducens J. Schröt. Pathogenicity tests were done on double type cvs. Fiesta, Tioga Red, and Tioga Cherry Red and on single type cvs. Cajun Watermelon and Accent Lilac. Plants were spray inoculated with sporangiospore suspensions (1 × 104 sporangiospores per milliliter), incubated for 24 h in a dew chamber (18 to 20°C), and then maintained in a greenhouse (22 to 24°C). Symptoms and signs of downy mildew developed after 12 days only on inoculated cv. Fiesta plants, and the pathogen morphology matched that of the originally observed pathogen. Nontreated control plants did not develop downy mildew. To our knowledge, this is the first report of downy mildew on impatiens in California. P. obducens is one of two causal agents of downy mildew of impatiens (2,4). The other pathogen, Bremiella sphaerosperma, has dichotomous sporangiophore branching and causes lesions with well-defined margins (2,4). In the United States, the disease has been recorded in the eastern and northeastern states and in Indiana, Minnesota, Mississippi, Montana, and Wisconsin (3). In Canada, the disease has been recorded in Manitoba and Quebec (1). References: (1) I. L. Conners. An Annotated Index of Plant Diseases in Canada and Fungi Recorded on Plants in Alaska, Canada, and Greenland. Research Branch, Canada Department of Agriculture, Publication 1251, 1967. (2) O. Constantinescu. Mycologia 83:473, 1991. (3) D. F. Farr et al. Fungi on Plants and Plant Products in the United States. The American Phytopathological Society, 1989. (4) G. W. Wilson. Bull. Torrey Bot. Club 34:387, 1907.

Download Full-text

First Report of Alternaria tenuissima Causing Postharvest Decay on Apple Fruit from Cold Storage in the United States

Plant Disease ◽

10.1094/pdis-07-13-0802-pdn ◽

2014 ◽

Vol 98 (5) ◽

pp. 690-690 ◽

Cited By ~ 1

Author(s):

L. P. Kou ◽

V. L. Gaskins ◽

Y. G. Luo ◽

W. M. Jurick

Keyword(s):

United States ◽

South Africa ◽

Cold Storage ◽

Fungal Pathogens ◽

The United States ◽

Apple Fruit ◽

Conidial Suspension ◽

Single Spore ◽

Alternaria Tenuissima ◽

First Report

Apples are grown and stored for 9 to 12 months under controlled atmosphere conditions in the United States. During storage, apples are susceptible to various fungal pathogens, including several Alternaria species (2). Alternaria tenuissima (Nees) Wiltshire causes dry core rot (DCR) on apples during storage and has recently occurred in South Africa (1). Losses range widely, but typically occur at 6 to 8% annually due to this disease (2). In February 2013, ‘Nittany’ apples with round, dark-colored, dry, spongy lesions were obtained from wooden bins in a commercial cold storage facility located in Pennsylvania. Symptomatic fruits were transported to the lab, rinsed with sterile water, and the lesions were sprayed with 70% ethanol until runoff and wiped dry. The skin was aseptically removed with a scalpel, and asymptomatic tissue was placed onto potato dextrose agar (PDA) and incubated at 25°C. Two single-spore isolates were propagated on PDA and permanent cultures were maintained as slants and stored at 4°C. The fungus produced a cottony white mycelium that turned olive-green to brown with abundant aerial hyphae and had a dark brown to black reverse on PDA. Isolates were identified as Alternaria based on conidial morphology as the spores were slightly melanized and obclavate to obpyriform catentulate with longitudinal and transverse septa attached in unbranched chains on simple short conidiophores. Conidia ranged from 10 to 70 μm long (mean 27.7 μm) and 5 to 15 μm wide (mean 5.25 μm) (n = 50) with 1 to 6 transverse and 0 to 2 longitudinal septa. Conidial beaks, when present, were short (5 μm or less) and tapered. Mycelial genomic DNA was extracted, and a portion of the histone gene (357 bp) was amplified via gene specific primers (Alt-His3-F/R) using conventional PCR (Jurick II, unpublished). The forward and reverse sequences were assembled into a consensus representing 2× coverage and MegaBLAST analysis showed that both isolates were 100% identical to Alternaria tenuissima isolates including CR27 (GenBank Accession No. AF404622.1) that caused DCR on apple fruit during storage in South Africa. Koch's postulates were conducted using 10 organic ‘Gala’ apple fruit that were surface sterilized with soap and water, sprayed with 70% ethanol, and wiped dry. The fruit were aseptically wounded with a nail to a 3 mm depth, inoculated with 50 μl of a conidial suspension (1 × 104 conidia/ml), and stored at 25°C in 80 count boxes on paper trays for 21 days. Mean lesion diameters on inoculated ‘Gala’ apple fruit were 19.1 mm (±7.4), water only controls (n = 10 fruit) were symptomless, and the experiment was repeated. Symptoms observed on artificially inoculated ‘Gala’ apple fruit were similar to the decay observed on ‘Nittany’ apples from cold storage. Based on our findings, it is possible that A. tenuissima can cause decay that originates from wounded tissue in addition to dry core rot, which has been reported (1). Since A. tenuissima produces potent mycotoxins, even low levels of the pathogen could pose a health problem for contaminated fruit destined for processing and may impact export to other countries. To the best of our knowledge, this is the first report of alternaria rot caused by A. tenuissima on apple fruit from cold storage in the United States. References: (1) J. C. Combrink et al. Decid. Fruit Grow. 34:88, 1984. (2) M. Serdani et al. Mycol. Res. 106:562, 2002. (3) E. E. Stinson et al. J. Agric. Food Chem. 28:960, 1980.

Download Full-text

First Report of Leaf Blight on Fan Columbine (Aquilegia flabellata) Caused by Rhizoctonia solani AG 4 in Italy

Plant Disease ◽

10.1094/pdis-93-4-0433a ◽

2009 ◽

Vol 93 (4) ◽

pp. 433-433 ◽

Cited By ~ 2

Author(s):

A. Garibaldi ◽

G. Gilardi ◽

D. Bertetti ◽

M. L. Gullino

Keyword(s):

United States ◽

Rhizoctonia Solani ◽

Aqueous Suspension ◽

Morphological Characteristics ◽

The United States ◽

Leaf Blight ◽

Herbaceous Plant ◽

Pathogenicity Test ◽

First Report ◽

Leaf Petiole

Aquilegia flabellata (Ranunculaceae), fan columbine, is a perennial herbaceous plant with brilliant blue-purple flowers with white petal tips. It can also be grown for cut flower production. In April of 2008, in several nurseries located near Biella (northern Italy), a leaf blight was observed on 10 to 15% of potted 30-day-old plants grown on a sphagnum peat substrate at 15 to 20°C and relative humidity of 80 to 90%. Semicircular, water-soaked lesions developed on leaves just above the soil line at the leaf-petiole junction and later along the leaf margins. Lesions expanded over several days along the midvein until the entire leaf was destroyed. Blighted leaves turned brown, withered, and abscised. Severely infected plants died. Diseased tissue was disinfested for 10 s in 1% NaOCl, rinsed with sterile water, and plated on potato dextrose agar (PDA) amended with 25 mg/liter streptomycin sulfate. A fungus with the morphological characteristics of Rhizoctonia solani was consistently recovered, then transferred and maintained in pure culture. Ten-day-old mycelium grown on PDA at 22 ± 1°C appeared light brown, rather compact, and had radial growth. Sclerotia were not present. Isolates obtained from affected plants successfully anastomosed with tester isolate AG 4 (AG 4 RT 31, obtained from tobacco plants). Results were consistent with other reports on anastomosis reactions (2). Pairings were also made with tester isolates of AG 1, 2.1, 2.2, 3, 6, 7, 11, and BI with no anastomoses observed between the recovered and tester isolates. The internal transcribed spacer (ITS) region of rDNA was amplified using primers ITS4/ITS6 and sequenced. BLASTn analysis (1) of the 648-bp fragment showed a 100% homology with the sequence of R. solani AG-4 AB000018. The nucleotide sequence has been assigned GenBank Accession No. FJ 534555. For pathogenicity tests, the inoculum of R. solani was prepared by growing the pathogen on PDA for 10 days. Five plants of 30-day-old A. flabellata were grown in 3-liter pots. Inoculum consisting of an aqueous suspension of PDA and mycelium disks (5 g of mycelium + agar per plant) was placed at the collar of plants. Five plants inoculated with water and PDA fragments alone served as control treatments. Plants were maintained in a greenhouse at temperatures between 20 and 24°C. The first symptoms, similar to those observed in the nursery, developed 7 days after the artificial inoculation. R. solani was consistently reisolated from infected leaves and stems. Control plants remained healthy. The pathogenicity test was carried out twice with similar results. The presence of R. solani AG1-IB on A. flabellata has been reported in Japan (4), while in the United States, Rhizoctonia sp. is described on Aquilegia sp. (3). This is, to our knowledge, the first report of leaf blight of A. flabellata caused by R. solani in Italy as well as in Europe. References: (1) S. F. Altschul et al. Nucleic Acids Res. 25:3389, 1997. (2) D. E. Carling. Grouping in Rhizoctonia solani by hyphal anastomosis reactions. In: Rhizoctonia Species: Taxonomy, Molecular Biology, Ecology, Pathology and Disease Control. Kluwer Academic Publishers, The Netherlands, 1996. (3) D. F. Farr et al. Fungi on Plants and Products in the United States. The American Phytopathological Society, St Paul, MN, 1989. (4) E. Imaizumi et al. J. Gen. Plant Pathol. 66:210, 2000.

Download Full-text

First Report of Powdery Mildew, Caused by an Oidium sp., on Poinsettia in California

Plant Disease ◽

10.1094/pdis.1998.82.1.128a ◽

1998 ◽

Vol 82 (1) ◽

pp. 128-128 ◽

Cited By ~ 3

Author(s):

S. T. Koike ◽

G. S. Saenz

Keyword(s):

United States ◽

Powdery Mildew ◽

Pacific Northwest ◽

The United States ◽

Euphorbia Pulcherrima ◽

American Phytopathological Society ◽

First Report ◽

The Pacific ◽

Uninoculated Control ◽

Alternative Identification

In December 1996 and January 1997, powdery mildew was observed on potted poinsettia (Euphorbia pulcherrima Willd. ex Klotzsch) plants in Monterey County, CA. Mycelia were observed on stems, petioles, mature and immature leaves, and bracts. Severely diseased leaves became twisted and bent and senesced prematurely. The white mycelia were conspicuous, epiphytic, and amphigenous; hyphae measured 4.6 to 6.9 μm in diameter. Growth initially was in patches but eventually became effused. Appressoria were slightly lobed to lobed and sometimes opposite. Conidiophore foot cells were cylindrical, sometimes bent at the base, and slightly flexuous to flexuous. Foot cells measured 30.0 to 46.2 μm × 5.8 to 6.9 μm and were followed by one to two shorter cells. Conidia were cylindrical to slightly doliform and measured 25.4 to 32.3 μm × 11.6 to 18.5 μm. The length-to-width ratios of conidia generally were greater than 2.0. Conidia were produced singly, placing the fungus in the Pseudoidium-type powdery mildew group. Conidia germinated at the ends, and no fibrosin bodies were observed. Cleistothecia were not found. The fungus was identified as an Oidium species. Pathogenicity was demonstrated by gently pressing infected leaves having abundant sporulation onto leaves of potted poinsettia plants (cvs. Freedom Red, Peter Star Marble, and Nutcracker White), incubating the plants in a moist chamber for 48 h, and then maintaining plants in a greenhouse. After 12 to 14 days, powdery mildew colonies developed on the inoculated plants, and the pathogen was morphologically identical to the original isolates. Uninoculated control plants did not develop powdery mildew. This is the first report of powdery mildew on poinsettia in California. This fungus appears similar to Microsphaera euphorbiae but has longer, slightly flexuous foot cells that do not match the description for M. euphorbiae (1,2). An alternative identification would be Erysiphe euphorbiae; however, there are no available mitosporic descriptions for morphological comparisons (1,2). In the United States, powdery mildew of poinsettia previously has been reported in various states in the Pacific Northwest, Midwest, and Northeast. References: (1) U. Braun. Beih. Nova Hedwigia 89:1, 1987. (2) D. F. Farr et al. 1989. Fungi on Plants and Plant Products in the United States. American Phytopathological Society, St. Paul, MN.

Download Full-text

First Report of Alternanthera mosaic virus Infection in Angelonia in the United States

Plant Disease ◽

10.1094/pdis-92-10-1473b ◽

2008 ◽

Vol 92 (10) ◽

pp. 1473-1473 ◽

Cited By ~ 7

Author(s):

B. E. Lockhart ◽

M. L. Daughtrey

Keyword(s):

United States ◽

Nucleotide Sequence ◽

Mosaic Virus ◽

Genomic Sequence ◽

Nutrient Deficiency ◽

Leaf Tissue ◽

The United States ◽

Nucleotide Sequence Analysis ◽

Degenerate Primers ◽

First Report

Stunting, chlorosis, and light yellow mottling resembling symptoms of nutrient deficiency were observed in angelonia (Angelonia angustifolia) in commercial production in New York. Numerous, filamentous particles 520 to 540 nm long and spherical virus particles 30 nm in diameter were observed by transmission electron microscopy (TEM) in negatively stained partially purified extracts of symptomatic Angelonia leaf tissue. Two viruses, the filamentous potexvirus Alternanthera mosaic virus (AltMV) and the spherical carmovirus Angelonia flower break virus (AnFBV) were subsequently identified on the basis of nucleotide sequence analysis of amplicons generated by reverse transcription (RT)-PCR using total RNA isolated from infected leaf tissue. A 584-bp portion of the replicase-encoding region of the AltMV genome was obtained with the degenerate primers Potex 2RC (5′-AGC ATR GNN SCR TCY TG-3′) and Potex 5 (5′-CAY CAR CAR GCM AAR GAT GA-3′) (3). Forward (AnFBV CP 1F-5′-AGC CTG GCA ATC TGC GTA CTG ATA-3′) and reverse (AnFBV CP 1R-5′-AAT ACC GCC CTC CTG TTT GGA AGT-3′) primers based on the published AnFBV genomic sequence (GenBank Accession No. NC_007733) were used to amplify a portion of the viral coat protein (CP) gene. The nucleotide sequence of the amplicon generated using the potexvirus-specific primers (GenBank Accession No. EU679362) was 99% identical to the published AltMV (GenBank Accession No. NC_007731) sequence and the nucleotide sequence of the amplicon obtained using the AnFBV CP primers was 99% identical to the published AnFBV genomic sequence (GenBank Accession No. EU679363). AnFBV occurs widely in angelonia (1) and AltMV has been identified in phlox (2). These data confirm the presence of AltMV and AnFBV in diseased angelonia plants showing stunting and nutrient deficiency-like symptoms and substantiates, to our knowledge, this first report of AltMV in angelonia in the United States. References: (1) S. Adkins et al. Phytopathology 96:460, 2006. (2) J. Hammond et al. Arch. Virol. 151:477, 2006. (3) R. A. A. van der Vlugt and M. Berendeson. Eur. J. Plant Pathol. 108:367, 2002.

Download Full-text

First Report of Powdery Mildew of Hypericum perforatum (St. John's-wort) Caused by an Anamorphic Microsphaera Species in the Pacific Northwest

Plant Health Progress ◽

10.1094/php-2004-0707-01-hn ◽

2004 ◽

Vol 5 (1) ◽

pp. 20 ◽

Cited By ~ 1

Author(s):

Dean A. Glawe

Keyword(s):

Powdery Mildew ◽

Pacific Northwest ◽

Hypericum Perforatum ◽

Growing Season ◽

Morphological Features ◽

King County ◽

First Report ◽

St John’S Wort ◽

St John's Wort ◽

The Pacific

St. John's-wort has been valued as a medicinal herb for centuries. During the 2002 growing season a specimen plant with powdery mildew symptoms was observed in a demonstration garden in Kenmore, King County, WA. This report provides information on symptoms of the disease, morphological features useful in characterizing the causal agent, and taxonomic aspects of the fungus. Accepted for publication 30 June 2004. Published 07 July 2004.

Download Full-text

First Report of Anthracnose Caused by Elsinoe ampelina on Muscadine Grapes (Vitis rotundifolia) in Northern Florida

Plant Disease ◽

10.1094/pdis-91-7-0905b ◽

2007 ◽

Vol 91 (7) ◽

pp. 905-905 ◽

Cited By ~ 7

Author(s):

H. K. Yun ◽

C. Louime ◽

J. Lu

Keyword(s):

United States ◽

Pcr Primers ◽

The United States ◽

Causal Agent ◽

Distilled Water ◽

Conidial Suspension ◽

Single Spore ◽

First Report ◽

Elsinoe Ampelina ◽

Muscadine Grapes

Anthracnose of grapes is an economically devastating disease caused by Elsinoe ampelina (2). Warm, humid weather favors disease development, and therefore in the United States, it is generally restricted to grape-growing areas east of the Rocky Mountains. Vitis vinifera is highly susceptible to the disease, which is one of the principal factors preventing the development of an industry with this high-quality grape in the southeastern United States. Growers in this area produce local species-such as muscadine grapes (V. rotundifolia Michx.) and hybrids. Muscadine grapes are known for their resistance or “immunity” to many diseases found in bunch (Euvitis spp. Planch.) grape species (1). As yet, there has been no formal report of anthracnose or its causal agent on muscadine grapes. E. ampelina was detected on muscadine leaves for the first time in the experimental vineyard at the Center for Viticulture and Small Fruit Research during the summer of 2006. Approximately 40% of the 52 muscadine cultivars in the collection showed circular or irregular black spots typical of anthracnose mainly on young leaves and tendrils. However, no symptoms were observed on fruits, shoot tips, or any other plant part. To confirm the causal agent, infected leaves were surface sterilized with 75% ethanol, dipped in 2% sodium hypochlorite for 15 s, rinsed in distilled water, dissected into small 0.5-cm leaf discs, and plated on potato dextrose agar (PDA) and incubated at 28°C. Single-spore isolates were grown on PDA. Colonies were slow growing and appeared as dark red mounds with some mycelia. Conidia were cylindrical and hyaline with pointed ends consistent with previous reports for E. ampelina (2). The identity was also confirmed by using the following PCR primers to the 18S RNA: left primer; TCCGTAGGTGAACCTGCGGA and right primer; TCCTACCTGAT CCGAGGTCA designed on the basis of the alignment of E. ampelina sequences deposited in NCBI database. To fulfill Koch's postulates, symptoms were reproduced by artificial inoculation onto young muscadines (cv. Carlos) and bunch (cv. Cabernet Sauvignon) grapevines. A conidial suspension was prepared from single-conidial cultures, and three experimental vines of each species were sprayed with 0.5 ml of suspension (2 × 105 conidia per ml), whereas three control plants were sprayed with distilled water. The plants were incubated in a moist chamber at 28°C with 16 h of light. The first typical symptoms appeared on V. vinifera 4 days postinoculation and on the muscadines 6 days postinoculation. To our knowledge, this is the first report confirming anthracnose disease on muscadine grapes. References: (1) J. Lu et al. Acta Hortic. 528:479, 2000. (2) R. C. Pearson and A. C. Gohen. Anthracnose. Pages 18–19 in: Compendium of Grape Diseases. The American Phytopathological Society. St. Paul, MN, 1994.

Download Full-text