First Report of Cryptocline taxicola Infecting Pacific Yew (Taxus brevifolia) in Eastern North America

To our knowledge, this is the first report of Cryptocline taxicola (Allesch.) Petrak (Coelomycetes) on Pacific yew (Taxus brevifolia Nuttall) and the first observation of the fungus infecting living needles. C. taxicola is known to occur on needles of Taxus baccata in Europe (on T. baccata var. fastigiata) and North America (Vermont) (on T. baccata var. canadensis) (2). In August 1999 and 2000, chlorotic and necrotic current and second-year needles of Pacific yew were observed to have fruiting bodies, sometimes greater than 400 per needle, on the upper surface. Acervuli were circular to subcircular, yellowish, surrounded by brown circles, subcuticular to intraepidermal, at first covered, later exposed by the fissure of the cuticule, and 150 to 350 μm wide. Hyphae in host tissue were septate, brownish, and 3 to 4.5 μm in diameter. Conidiophores were phialidic, cylindrical, hyaline, 10 to 20 × 2.5 to 4.5 μm. Mature conidia were ellipsoidal to oval, truncate at the base, obtuse at the apex, hyaline to slightly pigmented, 8 to 17 × 4 to 5 μm. From these symptomatic needles, C. taxicola was often isolated (>85%) on potato dextrose agar. Koch's postulates were completed for C. taxicola by spraying current-year living needles, on one twig of each of separate plants (five) of T. brevifolia with a conidial suspension of 4 × 103 conidia per ml. Five control twigs were sprayed with sterile, distilled water. Twigs were covered with black sterile plastic bags and incubated outdoors for 24 h, when the bags were removed. Within 3 weeks, inoculated needles exhibited chlorotic and necrotic symptoms similar to those originally observed, but symptoms were never observed on control twigs. The fungus was reisolated (91%) only from the symptomatic needles. T. brevifolia trees growing in the Montreal Botanical Garden (Quebec, Canada) are clones originating from the Pacific Coast of the United States. We found that Pacific yew was colonized more frequently on the dry rock outcrops in the Alpine and Chinese Garden tree plantations. We believe that inappropriate stand selection, unfavorable humid conditions, and a thin organic soil layer may predispose Pacific yew to infection by this fungal species. A similar effect has been reported in Europe (1) for Cryptocline pseudotsugae causing serious levels of disease in a Pseudotsuga menziesii plantations. References: (1) T. L. Cech. Forstschutz Aktuell. 25:13, 2000. (2) G. Morgan-Jones. Can. J. Bot. 51:309, 1973.

Download Full-text

First Report of Volutella Blight on Pachysandra Caused by Volutella pachysandricola in China

Plant Disease ◽

10.1094/pdis-11-11-0997 ◽

2012 ◽

Vol 96 (4) ◽

pp. 584-584

Author(s):

Q. Bai ◽

Y. Xie ◽

R. Dong ◽

J. Gao ◽

Y. Li

Keyword(s):

Morphological Characteristics ◽

Stem Canker ◽

Botanical Garden ◽

The United States ◽

Culture Collection ◽

Leaf Blight ◽

Conidial Suspension ◽

First Report ◽

Leaf Spots ◽

Plastic Bags

Pachysandra (Pachysandra terminalis, Buxaceae) and Japanese Pachysandra, also called Japanese Spurge, is a woody ornamental groundcover plant distributed mostly in Zhejiang, Guizhou, Henan, Hubei, Sichuan, Shanxi, and Gansu provinces in China. In April 2010, P. terminalis asymptomatic plants were shipped from Beijing Botanical Garden Institute of Botany Chinese Academy of Science to the garden nursery of Jilin Agricultural University (43°48′N, 125°23′E), Jilin Province. In June 2011, Volutella blight (sometimes called leaf blight and stem canker) of P. terminalis was observed on these plants. Infected leaves showed circular or irregular, tan-to-brown spots often with concentric rings and dark margins. The spots eventually grew and coalesced until the entire leaf died. Cankers appeared as greenish brown and water-soaked diseased areas, subsequently turning brown or black, and shriveled and often girdled the stems and stolons. During wet, humid weather in autumn, reddish orange, cushion-like fruiting structures of the fungus appeared on the stem cankers and undersides of leaf spots. Symptoms of the disease were consistent with previous descriptions (2–4). Five isolates were obtained from necrotic tissue of leaf spots and cankers of stems and stolons and cultured on potato dextrose agar. The colony surface was salmon colored and slimy. Conidia were hyaline, one celled, spindle shaped, and 12.57 to 22.23 × 3.33 to 4.15 μm with rounded ends. Morphological characteristics of the fungus were consistent with the description by Dodge (2), and the fungus was identified as Volutella pachysandricola (telemorph Pseudonectria pachysandricola). The internal transcribed spacer (ITS) regions of the nuclear rDNA were amplified using primers ITS4/ITS5 (1). The ITS sequences were 553 bp long and identical among these five isolates (GenBank Accession No. HE612114). They were 100% identical to Pseudonectria pachysandricola voucher KUS-F25663 (Accession No. JN797821) and 99% identical to P. pachysandricola culture-collection DAOM (Accession No. HQ897807). Pathogenicity was confirmed by spraying leaves of clonally propagated cuttings of P. terminalis with a conidial suspension (1 × 106 conidia/ml) of the isolated V. pachysandricola. Control leaves were sprayed with sterile water. Plants were covered with plastic bags and kept in a greenhouse at 20 to 25°C for 72 h. After 5 to 8 days, typical disease symptoms appeared on leaves, while the control plants remained healthy. V. pachysandricola was reisolated from the leaf spots of inoculated plants. Pachysandra leaf blight and stem canker also called Volutella blight, is the most destructive disease of P. terminalis and previously reported in the northern humid areas of the United States (Illinois, Connecticut, Ohio, Indiana, Iowa, Massachusetts, Missouri, Kentucky, and Wisconsin), northern Europe (Britain, Germany, and Poland), and the Czech Republic. To our knowledge, this is the first report of the disease caused by V. pachysandricola in China. The disease may become a more significant problem in P. terminalis cultivation areas if the disease spreads on P. terminalis in nursery beds. References: (1) D. E. L. Cooke et al. Mycol. Res. 101:667, 1997. (2) B. O. Dodge. Mycologia 36:532, 1944. (3) S. M. Douglas. Online publication. Volutella Blight of Pachysandra. The Connecticut Agricultural Experiment Station, 2008. (4) I. Safrankova. Plant Protect. Sci.43:10, 2007.

Download Full-text

First Report of Leaf Spot Caused by Septoria erigerontis on Erigeron strigosus in Korea

Plant Disease ◽

10.1094/pdis-08-12-0755-pdn ◽

2012 ◽

Vol 96 (12) ◽

pp. 1827-1827

Author(s):

J. H. Park ◽

K. S. Han ◽

S. H. Hong ◽

H. D. Shin

Keyword(s):

North America ◽

Leaf Spot ◽

Morphological Characteristics ◽

Its Region ◽

The United States ◽

Culture Collection ◽

Leaf Spot Disease ◽

Conidial Suspension ◽

Voucher Specimen ◽

First Report

Erigeron strigosus Muhl. ex Willd., known as daisy fleabane, is native to North America and was accidently introduced to Korea in the 1990s (2). It is increasingly invasive in natural and managed ecosystems throughout Korea. In June 2011, a leaf spot was first observed on daisy fleabanes growing wild in Hongcheon County of Korea. A voucher specimen was deposited in the Korea University Herbarium (KUS-F25759). Symptoms developed on lower leaves as small, distinct, reddish brown lesions, which enlarged progressively and turned into pale, dull brown spots surrounded by dark purplish-brown margins. Black pycnidia became visible in the lesions. Pycnidia were epigenous, occasionally hypogenous, scattered, dark brown to rusty brown, globose, embedded in host tissue or partly erumpent, 60 to 160 μm in diameter, with ostioles measuring 10 to 30 μm in diameter. Conidia were straight to mildly curved or even flexuous, guttulate, hyaline, 30 to 75 × 1.5 to 2 μm, and one- to seven-septate. Based on the morphological characteristics, the fungus was consistent with Septoria erigerontis Peck (3,4). Conidia were harvested from cirrhi of pycnidia on leaf lesions with a drop of sterile water and then directly streaked onto water agar media using a bacterial loop. Isolates were incubated at 24°C for 48 h. Germinating conidia were individually transferred to potato dextrose agar (PDA) plates. An isolate was deposited in the Korean Agricultural Culture Collection (Accession No. KACC46120). Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 505 bp was deposited in GenBank (Accession No. JX480493). A GenBank BLAST search was conducted with the 505-bp sequence showing 100% identity with the sequences of S. erigerontis ex Erigeron annuus (EF535638, GU269862). Pathogenicity was tested by spraying leaves of three potted plants with a conidial suspension (2 × 105 conidia/ml) harvested from a 4-week-old PDA culture. Control leaves were sprayed with sterile distilled water. The plants were placed in a dew chamber at 26°C in darkness and continuous dew for the first 24 h and then moved to a greenhouse bench. After 7 days, leaf spot symptoms identical to those observed in the field developed on the leaves inoculated with the fungus. No symptoms were observed on control plants. S. erigerontis was reisolated from the lesions of inoculated plants, fulfilling Koch's postulates. A leaf spot disease of E. strigosus associated with S. erigerontis has been reported in the United States and Canada (1). To our knowledge, this is the first report of leaf spot on E. strigosus caused by S. erigerontis outside of North America as well as in Korea. References: (1) D. F. Farr and A. Y. Rossman. Fungal Databases. Syst. Mycol. Microbiol. Lab., Online publication. ARS, USDA, Retrieved June 2, 2012. (2) S. H. Park. Colored Illustrations of Naturalized Plants of Korea. Ilchokak Publishers, Seoul, Korea, 1995. (3) M. J. Priest. Fungi of Australia: Septoria. ABRS/CSIRO Publishing, Melbourne, Australia, 1997. (4) E. Radulescu et al. Septoriozele din Romania. Ed. Acad. Rep. Soc. Romania, Bucuresti, Romania, 1973.

Download Full-text

First Report of Southern tomato virus on Tomatoes in Southwest France

Plant Disease ◽

10.1094/pdis-01-13-0017-pdn ◽

2013 ◽

Vol 97 (8) ◽

pp. 1124-1124 ◽

Cited By ~ 9

Author(s):

T. Candresse ◽

A. Marais ◽

C. Faure

Keyword(s):

North America ◽

Seed Transmission ◽

The United States ◽

High Rate ◽

Reference Sequence ◽

Tomato Mosaic Virus ◽

Potential Contribution ◽

First Report ◽

Tomato Sample ◽

Potential Pathogenicity

Southern tomato virus (STV) is a recently described virus of tomato reported to be associated with a new disorder in this crop, the tomato yellow stunt disease (2). However, its detection in asymptomatic seedlings of some tomato varieties raises doubts about its pathogenicity (2). STV has a small 3.5-kb dsRNA genome with properties that place it in an intermediate position between the Totiviridae and Partitiviridae families. STV also has an unusual biology because, while being seed-transmitted at a high rate, it is neither mechanically nor graft-transmitted (2). It has so far only been reported from North America (Mississipi and California in the United States, as well as Mexico) (2). Agents with similar genomic organizations but apparently not associated with specific disease symptoms have recently been reported from faba bean, rhododendrons, and blueberry and proposed to represent a novel family of dsRNA viruses tentatively named Amalgamaviridae (1). In the course of plant virus metagenomics experiments, double stranded RNAs extracted from tomato samples from Southwest France collected in 2011 (variety unknown) were analyzed by 454 pyrosequencing. BLAST analysis of the contigs assembled from individual sequencing reads revealed a ca. 2.2 kb long contig with very high (99.7%) identity with the STV reference sequence deposited in GenBank (NC_011591). In order to confirm the presence of STV, an STV-specific primer pair (STV-fw 5′ CTGGAGATGAAGTGCTCGAAGA 3′ and STV-rev 5′ TGGCTCGTCTCGCATCCTTCG 3′) was designed and used to amplify by RT-PCR an 894-bp fragment from the relevant tomato sample. A PCR product of the expected size was obtained and the identity of the amplified agent verified by sequencing of the amplicon. The sequence obtained was identical to contig obtained through pyrosequencing of purified dsRNAs and has been deposited in GenBank (KC333078). This is, to our knowledge, the first report of STV infecting tomato crops outside of North America. The tomato sample from France from which STV was recovered showed distinct viral infection symptoms (e.g., mosaics, leaf deformation), that are clearly different from the symptoms reported for the tomato yellow stunt disease (2). However, the plants were found to be also infected with Tomato mosaic virus and Potato virus Y, so that it is not possible to draw firm conclusions about a potential contribution of STV to the symptoms observed. The high rate of STV seed transmission and its reported presence in commercial seed lots of several varieties (2) suggest that its distribution could be much broader than is currently known and further efforts are clearly needed to provide a final and conclusive answer as to the potential pathogenicity of this agent to tomato crops. References: (1) R. R. Martin et al. Virus Res. 155:175, 2011. (2) S. Sabanadzovic et al. Virus Res. 140:130, 2009.

Download Full-text

The biology of Canadian weeds. 130. Solidago nemoralis Ait.

Canadian Journal of Plant Science ◽

10.4141/p03-200 ◽

2004 ◽

Vol 84 (4) ◽

pp. 1221-1233 ◽

Cited By ~ 1

Author(s):

Jerry G. Chmielewski ◽

John C. Semple

Keyword(s):

United States ◽

North America ◽

Deciduous Forest ◽

Sandy Soils ◽

The United States ◽

Eastern Deciduous Forest ◽

Rock Outcrops ◽

Native North American ◽

Forest Region ◽

Riparian Habitats

Solidago nemoralis, the gray goldenrod, is a polycarpic hemicryptophyte that reproduces vegetatively from branched caudices. This native North American species is morphologically variable throughout its range, and includes an eastern (ssp. nemoralis) and western (ssp. decemflora) race. The eastern subspecies occurs throughout the eastern deciduous forest region of North America and is commonly diploid, though tetraploids do occur throughout. The western race typically occurs on the prairies and is strictly tetraploid. The species occupies riparian habitats, rock outcrops and open fields and roadsides and grows best in well-drained sandy soils in full sunlight. Although the species is weedy in both Canada and the United States it is not noxious. Key words: Solidago nemoralis, gray goldenrod, verge d'or des bois, Asteraceae, Compositae

Download Full-text

First Report of Leaf Spot of Rudbeckia hirta var. pulcherrima Caused by Septoria rudbeckiae in Korea

Plant Disease ◽

10.1094/pdis-02-12-0172-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 911-911 ◽

Cited By ~ 1

Author(s):

J. H. Park ◽

S. E. Cho ◽

K. S. Han ◽

H. D. Shin

Keyword(s):

Leaf Spot ◽

The United States ◽

Flowering Plant ◽

Leaf Spot Disease ◽

Morphological Identification ◽

Its Sequence ◽

Conidial Suspension ◽

First Report ◽

Rudbeckia Hirta ◽

Close Phylogenetic Relationship

Rudbeckia hirta L. var. pulcherrima Farw. (synonym R. bicolor Nutt.), known as the black-eyed Susan, is a flowering plant belonging to the family Asteraceae. The plant is native to North America and was introduced to Korea for ornamental purposes in the 1950s. In July 2011, a previously unknown leaf spot was first observed on the plants in a public garden in Namyangju, Korea. Leaf spot symptoms developed from lower leaves as small, blackish brown lesions, which enlarged to 6 mm in diameter. In the later stages of disease development, each lesion was usually surrounded with a yellow halo, detracting from the beauty of the green leaves of the plant. A number of black pycnidia were present in diseased leaf tissue. Later, the disease was observed in several locations in Korea, including Pyeongchang, Hoengseong, and Yangpyeong. Voucher specimens were deposited at the Korea University Herbarium (KUS-F25894 and KUS-F26180). An isolate was obtained from KUS-F26180 and deposited at the Korean Agricultural Culture Collection (Accession No. KACC46694). Pycnidia were amphigenous, but mostly hypogenous, scattered, dark brown-to-rusty brown, globose, embedded in host tissue or partly erumpent, 50 to 80 μm in diameter, with ostioles 15 to 25 μm in diameter. Conidia were substraight to mildly curved, guttulate, hyaline, 25 to 50 × 1.5 to 2.5 μm, and one- to three-septate. Based on the morphological characteristics, the fungus was consistent with Septoria rudbeckiae Ellis & Halst. (1,3,4). Morphological identification of the fungus was confirmed by molecular data. Genomic DNA was extracted using the DNeasy Plant Mini DNA Extraction Kit (Qiagen Inc., Valencia, CA.). The internal transcribed spacer (ITS) region of rDNA was amplified using the ITS1/ITS4 primers and sequenced. The resulting sequence of 528 bp was deposited in GenBank (Accession No. JQ677043). A BLAST search showed that there was no matching sequence of S. rudbeckiae; therefore, this is the first ITS sequence of the species submitted to GenBank. The ITS sequence showed >99% similarity with those of many Septoria species, indicating their close phylogenetic relationship. Pathogenicity was tested by spraying leaves of three potted young plants with a conidial suspension (2 × 105 conidia/ml), which was harvested from a 4-week-old culture on potato dextrose agar. Control leaves were sprayed with sterile water. The plants were covered with plastic bags to maintain 100% relative humidity (RH) for the first 24 h. Plants were then maintained in a greenhouse (22 to 28°C and 70 to 80% RH). After 5 days, leaf spot symptoms identical to those observed in the field started to develop on the leaves inoculated with the fungus. No symptoms were observed on control plants. S. rudbeckiae was reisolated from the lesions of inoculated plants, confirming Koch's postulates. A leaf spot disease associated with S. rudbeckiae has been reported on several species of Rudbeckia in the United States, Romania, and Bulgaria (1–4). To our knowledge, this is the first report of leaf spot on R. hirta var. pulcherrima caused by S. rudbeckiae in Korea. References: (1) J. B. Ellis and B. D. Halsted. J. Mycol. 6:33, 1890. (2) D. F. Farr and A. Y. Rossman. Fungal Databases. Systematic Mycology and Microbiology Laboratory, ARS, USDA. Retrieved from http://nt.ars-grin.gov/fungaldatabases/ February 2, 2012. (3) E. Radulescu et al. Septoriozele din Romania. Ed. Acad. Rep. Soc. Romania, Bucuresti, Romania, 1973. (4) S. G. Vanev et al. Fungi Bulgaricae 3:1, 1997.

Download Full-text

First Report of a Leaf Spot Caused by Alternaria brassicae on the Invasive Weed Lepidium draba in North America

Plant Disease ◽

10.1094/pdis-93-8-0846a ◽

2009 ◽

Vol 93 (8) ◽

pp. 846-846 ◽

Cited By ~ 1

Author(s):

A. J. Caesar ◽

R. T. Lartey

Keyword(s):

North America ◽

Chinese Cabbage ◽

Leaf Spot ◽

The United States ◽

Alternaria Brassicae ◽

Voucher Specimen ◽

First Report ◽

Leaf Spots ◽

Black Spots ◽

Lepidium Draba

The exotic, rangeland weed Lepidium draba L., a brassicaceous perennial, is widely distributed in the United States. For example, Oregon contains 100,000 ha of land infested with L. draba (2). Because it is capable of aggressive spread and has the potential to reduce the value of wheat-growing land (4), it is the target of biological control research. The application of multiple pathogens has been advocated for control of other brassicaceous weeds, including the simultaneous application of biotrophic and necrotrophic pathogens (3). In pursuit of this approach, in 2007, we discovered the occurrence of leaf spots on approximately 90% of L. draba plants near Shepherd, MT, which were distinct from leaf lesions caused by Cercospora bizzozeriana (1). The lesions were initially tiny, black spots enlarging over time to become circular to irregular and cream-colored around the initial black spots and sometimes with dark brown borders or chlorotic halos. Conidia from the lesions were light brown, elongate and obclavate, produced singly from short conidia, with 8 to 12 transverse septa, and 2 to 6 longitudinal septa. The spore body measured 25 to 35 × 200 to 250 μm with a beak cell 42 to 100 μm long. On the basis of conidial and cultural characteristics, the fungus was identified as Alternaria brassicae (Berk.) Sacc. Leaf tissues bordering lesions were plated on acidified potato dextrose agar. Colonies on V8 and alfalfa seed agar were black with concentric rings, eventually appearing uniformly black after 10 to 14 days. The internal transcribed spacer region of rDNA was amplified using primers ITS1 and ITS4 and sequenced. BLAST analysis of the 575-bp fragment showed a 100% homology with a sequence of A. brassicae Strain B from mustard (GenBank Accession No. DQ156344). The nucleotide sequence has been assigned GenBank Accession No. FJ869872. For pathogenicity tests, aqueous spore suspensions approximately 105/ml were prepared from cultures grown at 20 to 25°C for 10 to 14 days on V8 agar and sprayed on leaves of three L. draba plants. Inoculated plants were enclosed in plastic bags and incubated at 20 to 22°C for 72 to 80 h. In addition, three plants of the following reported hosts of A. brassicae were inoculated: broccoli, canola, Chinese cabbage, collards, broccoli raab, kale, mustard greens, radish, rape kale, and turnip. Within 10 days, leaf spots similar to those described above developed on plants of radish, canola, Chinese cabbage, and turnip and A. brassicae was reisolated and identified. Control plants sprayed with distilled water remained symptomless. These inoculations were repeated and results were the same. To our knowledge, this is the first report of a leaf spot disease caused by A. brassicae on L. draba in North America. A voucher specimen has been deposited with the U.S. National Fungus Collections (BPI No. 878750A). References: (1) A. J. Caesar et al. Plant Dis. 93:108, 2009. (2) G. L. Kiemnec and M. L. McInnis. Weed Technol. 16:231, 2002. (3) A. Maxwell and J. K. Scott. Adv. Bot. Res. 43:143, 2005. (4) G. A. Mulligan and J. N. Findlay. Can. J. Plant Sci. 54:149, 1974.

Download Full-text

First Report of Anthracnose of Onion Caused by Colletotrichum coccodes in Ohio

Plant Disease ◽

10.1094/pdis-01-14-0032-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1271-1271 ◽

Cited By ~ 2

Author(s):

F. Baysal-Gurel ◽

N. Subedi ◽

D. P. Mamiro ◽

S. A. Miller

Keyword(s):

Leaf Tissue ◽

Its Region ◽

The United States ◽

Tween 20 ◽

Colletotrichum Coccodes ◽

Academic Press ◽

Conidial Suspension ◽

First Report ◽

Allium Cepa L ◽

Total Dna

Dry bulb onion (Allium cepa L. cvs. Pulsar, Bradley, and Livingston) plants with symptoms of anthracnose were observed in three commercial fields totaling 76.5 ha in Huron Co., Ohio, in July 2013. Symptoms were oval leaf lesions and yellowing, curling, twisting, chlorosis, and death of leaves. Nearly half of the plants in a 32.8-ha field of the cv. Pulsar were symptomatic. Concentric rings of acervuli with salmon-colored conidial masses were observed in the lesions. Conidia were straight with tapered ends and 16 to 23 × 3 to 6 μm (2). Colletotrichum coccodes (Wallr.) S. Hughes was regularly isolated from infected plants (2). Culturing diseased leaf tissue on potato dextrose agar (PDA) amended with 30 ppm rifampicin and 100 ppm ampicillin at room temperature yielded white aerial mycelia and salmon-colored conidial masses in acervuli. Numerous spherical, black microsclerotia were produced on the surface of colonies after 10 to 14 days. To confirm pathogen identity, total DNA was extracted directly from a 7-day-old culture of isolate SAM30-13 grown on PDA, using the Wizard SV Genomic DNA Purification System (Promega, Madison, WI) following the manufacturer's instructions. The ribosomal DNA internal transcribed spacer (ITS) region was amplified by PCR using the primer pair ITS1 and ITS4 (2), and sequenced. The sequence, deposited in GenBank (KF894404), was 99% identical to that of a C. coccodes isolate from Michigan (JQ682644) (1). Ten onion seedlings cv. Ebenezer White at the two- to three-leaf stage of growth were spray-inoculated with a conidial suspension (1 × 105 conidia/ml containing 0.01% Tween 20, with 10 ml applied/plant). Plants were maintained in a greenhouse (21 to 23°C) until symptoms appeared. Control plants were sprayed with sterilized water containing 0.01% Tween 20, and maintained in the same environment. After 30 days, sunken, oval lesions each with a salmon-colored center developed on the inoculated plants, and microscopic examination revealed the same pathogen morphology as the original isolates. C. coccodes was re-isolated consistently from leaf lesions. All non-inoculated control plants remained disease-free, and C. coccodes was not re-isolated from leaves of control plants. C. coccodes was reported infecting onions in the United States for the first time in Michigan in 2012 (1). This is the first report of anthracnose of onion caused by C. coccodes in Ohio. Unusually wet, warm conditions in Ohio in 2013 likely contributed to the outbreak of this disease. Timely fungicide applications will be necessary to manage this disease in affected areas. References: (1) A. K. Lees and A. J. Hilton. Plant Pathol. 52:3. 2003. (2) L. M. Rodriguez-Salamanca et al. Plant Dis. 96:769. 2012. (3) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Medical Tree Peony Root Rot Caused by Fusarium solani in Tongling, China

Plant Disease ◽

10.1094/pdis-02-12-0142-pdn ◽

2012 ◽

Vol 96 (6) ◽

pp. 909-909 ◽

Cited By ~ 10

Author(s):

M. Guo ◽

Y. M. Pan ◽

Z. M. Gao

Keyword(s):

Fusarium Solani ◽

Root Rot ◽

Tap Water ◽

Blood Stasis ◽

The United States ◽

Effective Control ◽

Conidial Suspension ◽

Tree Peony ◽

First Report ◽

Peony Root

Tree peony bark, a main component of Chinese traditional medicine used for alleviating fever and dissipating blood stasis, is mainly produced in Tongling, China. Recently, tree peony cultivation in this area was seriously affected by root rot, with approximately 20 to 30% disease incidence each year. The disease severely affects yield and quality of tree peony bark. During the past 2 years, we collected 56 diseased tree peony plants from Mudan and Fenghuang townships in Tongling. We found reddish brown to dark brown root rot in mature roots, especially on those with injuries. Plant samples collected were disinfected with 2% sodium hypochlorite and isolations were conducted on potato sucrose agar (PSA). Eleven isolates were obtained and all had white fluffy aerial hypha on PSA. Two types of conidia were produced; the larger, reaphook-shaped ones had three to five septa and the smaller, ellipse-shaped ones had one or no septum. The reaphook-shaped conidia were 20.15 to 37.21 × 3.98 to 5.27 μm and the ellipse-shaped conidia were 6.02 to 15.52 × 2.21 to 5.33 μm in size. Chlamydospores were produced, with two to five arranged together. Biological characteristics of the fungi indicated that the optimum temperature for the mycelial growth on PSA was 25 to 30°C and the optimum pH range was 5.5 to 7.0. The above morphological characteristics point the fungal isolates to be Fusarium solani. To confirm pathogenicity, 30 healthy 1-year-old tree peony seedling plants were grown in pots (25 cm in diameter) with sterilized soil and a conidial suspension from one isolate (FH-1, 5 × 105 conidia/ml) was used for soil inoculation. Inoculated seedlings were maintained at 28°C in a greenhouse with a 12-h photoperiod of fluorescent light. Seedlings inoculated with distilled water were used as controls. After 3 weeks, the roots were collected and rinsed with tap water. Dark brown lesions were observed in the inoculated mature roots but not in the control roots. To confirm the identity of the pathogen, F. solani strains were reisolated from the lesions and total genomic DNA was extracted with the cetyltriethylammnonium bromide method from the mycelia of the reisolated strains (1). PCR was performed using the fungal universal primers ITS4 (5′-TCCTCCGCTTATTGATATGC-3′) and ITS5 (5′-GGAAGTAAAAGTCGTAACAAGG-3′) to amplify a DNA fragment of approximately 590 bp. The purified PCR products were sequenced (Invitrogen Co., Shanghai, China) and shared 100% sequence identity with each other. A comparison of the sequence (JQ658429.1) by the Clustal_W program (2) with those uploaded in GenBank confirmed with the fungus F. solani (100% sequence similarity to isolate S-0900 from the Great Plains of the United States; EU029589.1). To our knowledge, this is the first report of F. solani causing medical tree peony root rot in China. The existence of this pathogen in China may need to be considered for developing effective control strategies. References: (1). C. N. Stewart et al. Biotechniques 14:748, 1993. (2). J. D. Thompson et al. Nucleic Acids Res. 22:4673, 1994.

Download Full-text

First Report of Phomopsis citri Associated with Dieback of Citrus lemon in India

Plant Disease ◽

10.1094/pdis-04-14-0388-pdn ◽

2014 ◽

Vol 98 (9) ◽

pp. 1281-1281 ◽

Cited By ~ 2

Author(s):

S. Mahadevakumar ◽

Vandana Yadav ◽

G. S. Tejaswini ◽

S. N. Sandeep ◽

G. R. Janardhana

Keyword(s):

Fungal Pathogen ◽

The United States ◽

Apical Region ◽

Post Inoculation ◽

Pathogenicity Test ◽

Conidial Suspension ◽

Internal Transcribed Spacer Region ◽

Productivity Level ◽

First Report ◽

Dieback Disease

Lemon (Citrus lemon (L.) Burm. f.) is an important fruit crop cultivated worldwide, and is grown practically in every state in India (3). During a survey conducted in 2013, a few small trees in a lemon orchard near Mysore city (Karnataka) (12°19.629′ N, 76°31.892′ E) were found affected by dieback disease. Approximately 10 to 20% of trees were affected as young shoots and branches showed progressive death from the apical region downward. Different samples were collected and diagnosed via morphological methods. The fungus was consistently isolated from the infected branches when they were surface sanitized with 1.5% NaOCl and plated on potato dextrose agar (PDA). Plates were incubated at 26 ± 2°C for 7 days at 12/12 h alternating light and dark period. Fungal colonies were whitish with pale brown stripes having an uneven margin and pycnidia were fully embedded in the culture plate. No sexual state was observed. Pycnidia were globose, dark, 158 to 320 μm in diameter, and scattered throughout the mycelial growth. Both alpha and beta conidia were present within pycnidia. Alpha conidia were single celled (5.3 to 8.7 × 2.28 to 3.96 μm) (n = 50), bigittulate, hyaline, with one end blunt and other truncated. Beta conidia (24.8 to 29.49 × 0.9 to 1.4 μm) (n = 50) were single celled, filiform, with one end rounded and the other acute and curved. Based on the morphological and cultural features, the fungal pathogen was identified as Phomopsis citri H.S. Fawc. Pathogenicity test was conducted on nine healthy 2-year-old lemon plants via foliar application of a conidial suspension (3 × 106); plants were covered with polythene bags for 6 days and maintained in the greenhouse. Sterile distilled water inoculated plants (in triplicate) served as controls and were symptomless. Development of dieback symptoms was observed after 25 days post inoculation and the fungal pathogen was re-isolated from the inoculated lemon trees. The internal transcribed spacer region (ITS) of the isolated fungal genomic DNA was amplified using universal-primer pair ITS1/ITS4 and sequenced to confirm the species-level diagnosis (4). The sequence data of the 558-bp amplicon was deposited in GenBank (Accession No. KJ477016.1) and nBLAST search showed 99% homology with Diaporthe citri (teleomorph) strain 199.39 (KC343051.1). P. citri is known for its association with melanose disease of citrus in India, the United States, and abroad. P. citri also causes stem end rot of citrus, which leads to yield loss and reduction in fruit quality (1,2). Dieback disease is of serious concern for lemon growers as it affects the overall productivity level of the tree. To the best of our knowledge, this is the first report of P. citri causing dieback of lemon in India. References: (1) I. H. Fischer et al. Sci. Agric. (Piracicaba). 66:210, 2009. (2) S. N. Mondal et al. Plant Dis. 91:387, 2007. (3) S. P. Raychaudhuri. Proc. Int. Soc. Citriculture 1:461, 1981. (4) T. J. White et al. Page 315 in: PCR Protocols: A Guide to Methods and Applications. Academic Press, San Diego, CA, 1990.

Download Full-text

First Report of Guignardia citricarpa Associated with Citrus Black Spot on Sweet Orange (Citrus sinensis) in North America

Plant Disease ◽

10.1094/pdis-01-12-0101-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1225-1225 ◽

Cited By ~ 31

Author(s):

T. S. Schubert ◽

M. M. Dewdney ◽

N. A. Peres ◽

M. E. Palm ◽

A. Jeyaprakash ◽

...

Keyword(s):

North America ◽

Sweet Orange ◽

Black Spot ◽

The United States ◽

Yield Reduction ◽

Rrna Gene ◽

Specific Primers ◽

Oatmeal Agar ◽

First Report ◽

Citrus Black Spot

In March 2010, citrus black spot symptoms were observed on sweet orange trees in a grove near Immokalee, FL. Symptoms observed on fruit included hard spot, cracked spot, and early virulent spot. Hard spot lesions were up to 5 mm, depressed with a chocolate margin and a necrotic, tan center, often with black pycnidia (140 to 200 μm) present. Cracked spot lesions were large (15 mm), dark brown, with diffuse margins and raised cracks. In some cases, hard spots formed in the center of lesions. Early virulent spot lesions were small (up to 7 mm long), bright red, irregular, indented, and often with many pycnidia. In addition, small (2 to 3 mm), elliptical, reddish brown leaf lesions with depressed tan centers were observed on some trees with symptomatic fruit. Chlorotic halos appeared as they aged. Most leaves had single lesions, occasionally up to four per leaf. Tissue pieces from hard spots and early virulent spots were placed aseptically on potato dextrose agar (PDA), oatmeal agar, or carrot agar and incubated with 12 h of light and dark at 24°C. Cultures that grew colonies within a week were discarded. Fourteen single-spore cultures were obtained from the isolates that grew slower than the Guignardia mangiferae reference cultures, although pycnidia formed more rapidly in the G. mangiferae cultures (1). No sexual structures were observed. Cultures on half-PDA were black and cordlike with irregular margins with numerous pycnidia, often bearing white cirrhi after 14 days. Conidia (7.1 to 7.8 × 10.3 to 11.8 μm) were hyaline, aseptate, multiguttulate, ovoid with a flattened base surrounded by a hyaline matrix (0.4 to 0.6 μm) and a hyaline appendage on the rounded apex, corresponding to published descriptions of G. citricarpa (anomorph Phyllosticta citricarpa) (1). A yellow pigment was seen in oatmeal agar surrounding G. citricarpa, but not G. mangiferae colonies as previously reported (1,2). DNA was extracted from lesions and cultures and amplified with species-specific primers (2). DNA was also extracted from G. mangiferae and healthy citrus fruit. The G. citricarpa-specific primers produced a 300-bp band from fruit lesions and pure cultures. G. mangiferae-specific primers produced 290-bp bands with DNA from G. mangiferae cultures. The internally transcribed spacer (ITS) of the rRNA gene, translation-elongation factor (TEF), and actin gene regions were sequenced from G. citricarpa isolates and deposited in GenBank. These sequences had 100% homology with G. citricarpa ITS sequences from South Africa and Brazil, 100% homology with TEF, and 99% homology with actin of a Brazilian isolate. Pathogenicity tests with G. citricarpa were not done because the organism infects immature fruit and has an incubation period of at least 6 months (3). In addition, quarantine restrictions limit work with the organism outside a contained facility. To our knowledge, this is the first report of black spot in North America. The initial infested area was ~57 km2. The disease is of great importance to the Florida citrus industry because it causes serious blemishes and significant yield reduction, especially on the most commonly grown ‘Valencia’ sweet orange. Also, the presence of the disease in Florida may affect market access because G. citricarpa is considered a quarantine pathogen by the United States and internationally. References: (1) R. P. Baayen et al. Phytopathology 92:464, 2002. (2) N. A. Peres et al. Plant Dis. 91:525, 2007 (3) R. F. Reis et al. Fitopath Bras. 31:29, 2006.

Download Full-text