scholarly journals A New Tomato leaf curl virus from Mayotte

Plant Disease ◽  
2004 ◽  
Vol 88 (6) ◽  
pp. 681-681 ◽  
Author(s):  
J. M. Lett ◽  
H. Delatte ◽  
F. Naze ◽  
B. Reynaud ◽  
A. L. Abdoul-Karime ◽  
...  
Keyword(s):  
Tomato Leaf ◽  
Nucleotide Identity ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
Tomato Plants ◽  
Embl Accession ◽  
Pcr Products ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl

In June 2003, symptoms of stunting and leaf curling resembling symptoms of tomato leaf curl disease, as well as reductions in yields, were observed on tomato plants in the western (Combani and Kahani) and eastern (Dembeni, Kaoueni, and Tsararano) regions of Mayotte, a French island in the Comoros Archipelago located in the northern part of the Mozambique Channel. The whitefly, Bemisia tabaci (Gennadius), was observed colonizing tomato plants and other vegetable crops at low levels. Overall, 13 leaf samples with symptoms were collected from tomato plants among the five regions and tested for the presence of begomoviruses using a polymerase chain reaction (PCR) assay with two sets of degenerate primers designed to amplify two regions of the A component of begomoviruses. Primers MP16 and MP82 amplify an approximately 500-bp fragment located between the intergenic conserved nonanucleotide sequence and the first 200 bp of the coat protein (CP) gene (2). Primers AV494 and AC1048 amplify the approximately 550-bp core region of the CP gene (3). Six leaf samples, one from Combani, three from Dembeni, and two from Kahani, gave a PCR product of the expected size with both sets of primers. No PCR products were obtained with degenerate primers designed for begomovirus DNA B or β. The approximately 500- and 550-bp PCR products from one sample each of Combani (EMBL Accession Nos. AJ620912 and AJ620915, respectively), Dembeni (EMBL Accession Nos. AJ620911 and AJ620914, respectively), and Kahani (EMBL Accession Nos. AJ620913 and AJ620916, respectively) were sequenced. For the 489-bp sequences obtained with the MP16/MP82 primer set, the three isolates had 90 to 95% nucleotide identity (DNAMAN; Lynnon BioSoft, Quebec). The most significant sequence alignments (NCBI and BLAST) were with begomoviruses; 80 to 83% nucleotide identity was obtained with the Tomato yellow leaf curl Morondava virus (TYLCMV) isolates from Madagascar (EMBL Accession Nos. AJ422123 and AJ422124), 80 to 82% nucleotide identity was obtained with the South African cassava mosaic virus (SACMV) isolates (GenBank and EMBL Accession Nos. AF155806 and AJ422132), and 79 to 81% nucleotide identity was obtained with the East African cassava mosaic Malawi virus (EMBL Accession No. AJ006460). For the 522-bp sequences obtained with the AV494/AC1048 primer set, 95 to 97% nucleotide identity was shown between the three isolates. The most significant sequence alignments were also with begomoviruses; TYLCMV isolate Morondava (EMBL Accession No. AJ422125) with 86 to 88% nucleotide identity, Tomato yellow leaf curl virus isolates (GenBank and EMBL Accession Nos. AF105975, AJ489258, AB014346, AF024715, AF071228, and X76319) with 86 to 87% nucleotide identity, and SACMV isolate M12 (EMBL Accession No. AJ422132) with 85 to 86% nucleotide identity. According to the current taxonomic criteria for the provisional classification of a new begomovirus species, nucleotide sequence identity in the core region of the CP <90% (1), the tomato begomovirus from Mayotte is a new species and is provisionally named Tomato leaf curl Mayotte virus. References: (1) J. K. Brown et al. Arch. Virol. 146:1581, 2001. (2) P. Umaharan et al. Phytopathology 88:1262, 1998. (3) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals Evidence for the Association of a Bipartite Geminivirus with Tomato Leaf Curl Disease in Pakistan

Plant Disease ◽  
1997 ◽  
Vol 81 (8) ◽  
pp. 958-958 ◽  
Author(s):  
S. Mansoor ◽  
S. H. Khan ◽  
M. Saeed ◽  
A. Bashir ◽  
Y. Zafar ◽  
...  
Keyword(s):  
Tomato Leaf ◽  
Cotton Leaf ◽  
Degenerate Primers ◽  
Tomato Plants ◽  
Tomato Leaf Curl Disease ◽  
Eastern Hemisphere ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

Tomato leaf curl disease is the most important constraint on tomato production in Pakistan, where it is found throughout the country. The disease, which occurs in high incidence in Punjab and Sindh provinces, causes 30 to 40% yield losses in the spring crop and uneconomically high losses when grown as an autumn crop. The symptoms of the disease include upward or downward leaf curling, vein thickening, and stunting of the plant. The disease is transmitted by Bemisia tabaci whiteflies (non-B, biotype K) and is suspected to be caused by a geminivirus. For the detection of geminivirus, total DNA was extracted from infected plants, fractionated in an agarose gel, transferred to a nylon membrane, and Southern blotted. A full-length clone of DNA-A of cotton leaf curl virus from Pakistan (S. Mansoor, I. Bedford, M. S. Pinner, A. Bashir, R. Briddon, J. Stanley, Y. Zafar, K. A. Malik, and P. G. Markham, unpublished) was labeled with [32P]dCTP by the oligo-labeling method and hybridized at medium stringency. Geminivirus DNA forms that are normally found in infected plants were detected in plants with tomato leaf curl disease but not in healthy plants. To further confirm the presence of a whiteflytransmitted geminivirus, universal primers for dicot-infecting geminiviruses (1) were used in polymerase chain reaction (PCR) and a product of expected size (approximately 2.7 kb) was detected. The 2.7-kb PCR-amplified DNA from diseased tomato plants was labeled with [32P]dCTP and used as probe in Southern hybridization. This probe also detected geminivirus DNA forms at medium stringency. Both monopartite and bipartite geminiviruses transmitted by whiteflies have been reported to cause leaf curl symptoms on tomato from the Eastern hemisphere. Degenerate primers (PBLv2040 and PCRc1), which amplify B component DNA, were used to determine if tomato leaf curl was monopartite or bipartite (2). A product of expected size (0.65 kb) was amplified, suggesting this virus to be bipartite. DNA-B PCR product obtained from diseased tomato plants was hybridized as described above and detected geminivirus DNA forms at medium stringency. Samples of diseased tomato plants were collected from tomato fields throughout Punjab. DNA-A was detected in all 20 samples whereas DNA B was detected in 17 samples when hybridized by dot blot method at medium stringency. Our data show that tomato leaf curl virus from Pakistan is a bipartite geminivirus. This is the first evidence for a bipartite geminivirus in tomato plants from Pakistan. References: (1) R. W. Briddon and P. G. Markham. Mol. Biotechnol. 1:202, 1993. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Use of Tomato leaf curl virus (TYLCV) truncated Rep gene sequence to engineer TYLCV resistance in tomato plants

2009 ◽  
Vol 53 (2) ◽  
pp. 99-104 ◽  
Author(s):  
H. Tamarzizt ◽  
S. Chouchane ◽  
R. Lengliz ◽  
D. Maxwell ◽  
M. Marrakchi ◽  
...  
Keyword(s):  
Gene Sequence ◽  
Tomato Leaf ◽  
Tomato Plants ◽  
Tomato Leaf Curl Virus ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Geminiviruses Infecting Tomato Crops in Nicaragua

Plant Disease ◽  
2000 ◽  
Vol 84 (8) ◽  
pp. 843-846 ◽  
Author(s):  
Aldo Rojas ◽  
Anders Kvarnheden ◽  
Jari P. T. Valkonen
Keyword(s):  
Phylogenetic Analysis ◽  
Tomato Leaf ◽  
The Other ◽  
Central American ◽  
Mottle Virus ◽  
Degenerate Primers ◽  
Tomato Plants ◽  
Polymerase Chain ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus

Geminiviruses transmitted by whiteflies are believed to be responsible for the devastating epidemic in tomato crops in Nicaragua, as well as in other Central American countries. Polymerase chain reaction with degenerate primers was used to amplify partial sequences of the geminivirus coat protein gene from samples of diseased tomato plants collected from the major tomato-growing areas of Nicaragua. The data indicated the presence of geminiviruses in all tested regions of the country. DNA sequence analysis and phylogenetic analysis of the amplified sequences showed that they corresponded to four different geminiviruses related to the other begomoviruses native to the Americas. One of the viruses, which was detected in three regions of Nicaragua, is probably Sinaloa tomato leaf curl virus. The sequences of two of the other detected viruses showed close relationships with several geminiviruses, including Tomato mottle virus, Tomato leaf crumple virus, and Sida golden mosaic virus, all of which previously have been reported from Central America. The fourth virus is closely related at sequence level to a tomato-infecting geminivirus from Honduras, putatively designated Tomato mild mottle virus. This virus seems to be different from the other known American begomoviruses because it groups separately in the phylogenetic analysis.

scholarly journals Tomato Leaf Curl Virus of Tomato: Scenarios and Confronts

2021 ◽  
Author(s):  
Ariptha Shankar
Keyword(s):  
Genetic Engineering ◽  
Viral Disease ◽  
Tomato Leaf ◽  
Tomato Crop ◽  
Tomato Plants ◽  
Tomato Leaf Curl Disease ◽  
Crop Development ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato leaf curl disease (TLCD) is the most common viral disease in the tomato plant. It is caused by begomoviruses, which are viruses that cause plant development to be slowed. Many of the traditional disease management methods are still in use. They are, however, ineffective and out of date. Modern biotechnology is being used to detect illness in tomato plants as early as possible, thus reducing damage to the plants. Through genetic engineering, the spread of viruses may be controlled or prevented entirely. Here reviewed many methods for decreasing or eliminating the viral influence on crop growth through biotechnology and genomics. We also investigated the possibility of genetic engineering to reduce or remove the virus TLCD impact on tomato crop development.

scholarly journals First Molecular Identification of a Begomovirus Isolated from Tomato in Madagascar

Plant Disease ◽  
2002 ◽  
Vol 86 (12) ◽  
pp. 1404-1404 ◽  
Author(s):  
H. Delatte ◽  
B. Reynaud ◽  
J. M. Lett ◽  
M. Peterschmitt ◽  
M. Granier ◽  
...  
Keyword(s):  
Coat Protein ◽  
Leaf Size ◽  
Tomato Yellow Leaf ◽  
Nucleotide Identity ◽  
Enzyme Linked Immunosorbent Assay ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

In April 2001, reduced leaf size, leaf curling, yellowing symptoms, and reduced yield were observed in tomato plants in the southwestern (Toliary, Morondava, Miandrivazo) and northern (Antsiranana) regions of Madagascar. Symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV, genus Begomovirus, family Geminiviridae). Large populations of Bemisia tabaci (Gennadius) were observed colonizing tomato, other crops, and weeds. Leaf samples were collected from tomato plants from 14 sites located in northern, central, and southern Madagascar. Two plant samples collected near Antsiranana, one sample near Morondava, and one sample near Toliary were positive in triple-antibody sandwich enzyme-linked immunosorbent assay using a begomovirus-specific antibody purchased from ADGEN (Nellies Gates, Auchincruive, Scotland, UK). A 500-bp product was amplified and cloned (2) from two leaf samples collected near Toliary and one near Morondava using a pair of degenerate primers that are expected to amplify a region of the A component of begomoviruses between the intergenic conserved nonanucleotide sequence and the first 200 nucleotides of the coat protein ORF. The sequences corresponding to the two Toliary samples (GenBank Accession Nos. AJ422123 and AJ422124) and the Morondava sample (GenBank No. AJ422125) showed the most significant alignments (NCBI, BLAST) with begomoviruses, Tobacco leaf curl virus from Zimbabwe (GenBank Accession No. AF 350330) and Tomato leaf curl virus from Tanzania (GenBank Accession No. U73498) with 76 to 77% nucleotide identity (Clustal method, MegAlign, DNASTAR, London) and South African cassava mosaic viruses (SACMV GenBank Accession Nos. AJ422132 and AF155806) and East African cassava mosaic viruses from Malawi (GenBank Accession Nos. AJ006459 and AJ006460) with 74 to 75.5% nucleotide identity. The low nucleotide identity suggests that the begomovirus isolated from tomato in Madagascar is a new species. Since the core region of the coat protein gene is a molecular marker for provisional classification of begomoviruses (1), this region was amplified for the Morondava isolate with degenerate primers. The 519nt core fragment obtained showed the most significant alignments with SACMV (GenBank Accession No. AF329227), Cassava geminivirus from Mozambique (GenBank Accession No. AF329240), and with TYLCV (GenBank Accession Nos. AB014346 and AF105975) with 81 to 82% nucleotide identity. According to the current taxonomic criteria (4), the begomovirus from Madagascar is a new one that is related to begomoviruses from the southern part of Africa and to TYLCV and is provisionally named Tomato yellow leaf curl Morondava virus (TYLCMV). Tomato yellow leaf curl disease was previously described in Madagascar by Reckhaus (3) who presumed that it was caused by TYLCV. Although symptoms in the tomato plant from which TYLCMV was isolated were similar to those induced by TYLCV, TYLCV was not detected in our samples. References: (1) J. K. Brown et al. Arch. Virol. 146:1581, 2001 (2) M. Peterschmitt et al. Plant Dis. 83:303, 1999. (3) P. Reckhaus, Maladies et ravageurs des cultures maraîchères: A l'exemple de Madagascar. GTZ, Weikersem, 1997. (4) M. H. V. van Regenmortel et al. Virus Taxonomy. Seventh Rep. Int. Comm. Taxon. Viruses. Academic Press, San Diego, 2000.

scholarly journals INDUCTION OF RESISTANCE IN TOMATO PLANTS AGAINST TOMATO LEAF CURL VIRUS BY USING BIOCHAR AND SEED PRIMING

2018 ◽  
Vol 30 (1) ◽  
pp. 19
Author(s):  
Muhammad A. Zeshan ◽  
Yasir Iftikhar ◽  
Safdar Ali ◽  
Nadeem Ahmed ◽  
Muhammad U. Ghani ◽  
...  
Keyword(s):  
Disease Severity ◽  
Seed Priming ◽  
Tomato Leaf ◽  
Distilled Water ◽  
Tomato Plants ◽  
Tomato Seedlings ◽  
Tomato Leaf Curl Virus ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Leaf Curl

The experiment was conducted to check the effects of biochar and different priming agents on whitefly transmitted tomato leaf curl virus. Biochar was applied to potting mixture at 1%, 2% and 3% concentration. In order to check the effects of priming, tomato seedlings were primed with NaCl, glycerine and distilled water at three concentrations. After biochar application 22.43% disease severity was recorded that was significantly lower than control (40.12%). In graft inoculated plants, disease severity was in 15.32% while in control 50.23% disease severity was recorded. From primed seedling NaCl and glycerine shows good results then distilled water. In case of biochar, disease reduction was more at higher concentration (3%) than other two concentrations. Priming gave better results in case of whitefly inoculation.

Evidence for recombination among the tomato leaf curl virus strains/species from Bangalore, India

2002 ◽  
Vol 147 (2) ◽  
pp. 255-272 ◽  
Author(s):  
N. Kirthi ◽  
S. P. Maiya ◽  
M. R. N. Murthy ◽  
H. S. Savithri
Keyword(s):  
Tomato Leaf ◽  
Tomato Leaf Curl Virus ◽  
Tomato Leaf Curl ◽  
Leaf Curl Virus ◽  
Virus Strains ◽  
Leaf Curl

scholarly journals First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽  
2012 ◽  
Vol 96 (8) ◽  
pp. 1229-1229 ◽  
Author(s):  
Y. H. Ji ◽  
Z. D. Cai ◽  
X. W. Zhou ◽  
Y. M. Liu ◽  
R. Y. Xiong ◽  
...  
Keyword(s):  
Common Bean ◽  
Large Population ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Degenerate Primers ◽  
Sequence Alignments ◽  
First Report ◽  
Sequence Identity ◽  
Leaf Curl Virus ◽  
Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Sign in / Sign up

Export Citation Format

Share Document