First Molecular Identification of a Begomovirus Isolated from Tomato in Madagascar

In April 2001, reduced leaf size, leaf curling, yellowing symptoms, and reduced yield were observed in tomato plants in the southwestern (Toliary, Morondava, Miandrivazo) and northern (Antsiranana) regions of Madagascar. Symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV, genus Begomovirus, family Geminiviridae). Large populations of Bemisia tabaci (Gennadius) were observed colonizing tomato, other crops, and weeds. Leaf samples were collected from tomato plants from 14 sites located in northern, central, and southern Madagascar. Two plant samples collected near Antsiranana, one sample near Morondava, and one sample near Toliary were positive in triple-antibody sandwich enzyme-linked immunosorbent assay using a begomovirus-specific antibody purchased from ADGEN (Nellies Gates, Auchincruive, Scotland, UK). A 500-bp product was amplified and cloned (2) from two leaf samples collected near Toliary and one near Morondava using a pair of degenerate primers that are expected to amplify a region of the A component of begomoviruses between the intergenic conserved nonanucleotide sequence and the first 200 nucleotides of the coat protein ORF. The sequences corresponding to the two Toliary samples (GenBank Accession Nos. AJ422123 and AJ422124) and the Morondava sample (GenBank No. AJ422125) showed the most significant alignments (NCBI, BLAST) with begomoviruses, Tobacco leaf curl virus from Zimbabwe (GenBank Accession No. AF 350330) and Tomato leaf curl virus from Tanzania (GenBank Accession No. U73498) with 76 to 77% nucleotide identity (Clustal method, MegAlign, DNASTAR, London) and South African cassava mosaic viruses (SACMV GenBank Accession Nos. AJ422132 and AF155806) and East African cassava mosaic viruses from Malawi (GenBank Accession Nos. AJ006459 and AJ006460) with 74 to 75.5% nucleotide identity. The low nucleotide identity suggests that the begomovirus isolated from tomato in Madagascar is a new species. Since the core region of the coat protein gene is a molecular marker for provisional classification of begomoviruses (1), this region was amplified for the Morondava isolate with degenerate primers. The 519nt core fragment obtained showed the most significant alignments with SACMV (GenBank Accession No. AF329227), Cassava geminivirus from Mozambique (GenBank Accession No. AF329240), and with TYLCV (GenBank Accession Nos. AB014346 and AF105975) with 81 to 82% nucleotide identity. According to the current taxonomic criteria (4), the begomovirus from Madagascar is a new one that is related to begomoviruses from the southern part of Africa and to TYLCV and is provisionally named Tomato yellow leaf curl Morondava virus (TYLCMV). Tomato yellow leaf curl disease was previously described in Madagascar by Reckhaus (3) who presumed that it was caused by TYLCV. Although symptoms in the tomato plant from which TYLCMV was isolated were similar to those induced by TYLCV, TYLCV was not detected in our samples. References: (1) J. K. Brown et al. Arch. Virol. 146:1581, 2001 (2) M. Peterschmitt et al. Plant Dis. 83:303, 1999. (3) P. Reckhaus, Maladies et ravageurs des cultures maraîchères: A l'exemple de Madagascar. GTZ, Weikersem, 1997. (4) M. H. V. van Regenmortel et al. Virus Taxonomy. Seventh Rep. Int. Comm. Taxon. Viruses. Academic Press, San Diego, 2000.

Download Full-text

First Report of Tomato yellow leaf curl virus on Tomato Crops in Greece

Plant Disease ◽

10.1094/pdis.2001.85.6.678c ◽

2001 ◽

Vol 85 (6) ◽

pp. 678-678 ◽

Cited By ~ 13

Author(s):

A. D. Avgelis ◽

N. Roditakis ◽

C. I. Dovas ◽

N. I. Katis ◽

C. Varveri ◽

...

Keyword(s):

Disease Incidence ◽

Rflp Analysis ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Comparisons ◽

Tomato Plants ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

In late summer 2000, tomato (Lycopersicon esculentum Mill.) grown in greenhouses in Ierapetra, Tympaki, and Chania (Crete) showed leaf curling, reduced leaf size, yellowing, shortened internodes, and a bushy appearance. More than 30 ha of tomato greenhouses were affected and the disease incidence ranged from 15 to 60% with estimated crop losses of over $500,000. Similar symptoms were observed in tomato samples from Marathon (Attiki) and Southern Peloponnese. All greenhouses with infected plants were infested with high populations of Bemisia tabaci (Gennadius), which were also observed outside the greenhouses on several weeds. Tomato symptoms were similar to those caused by Tomato yellow leaf curl virus (TYLCV). The assumed virus could not be transmitted mechanically but successful transmission was obtained by grafting onto healthy tomato plants. Over 100 samples of symptomatic tomato plants collected from Crete and southern Peloponnese gave positive reactions when tested by ELISA using monoclonal antibodies to TYLCV-European (Adgen Ltd). The serological results were confirmed by PCR using two pairs of primers, universal degenerate (1) and MA 13 and MA 17 (2), amplifying different parts of the virus genome. The restriction fragment length polymorphism (RFLP) analysis (AluI, HaeIII, and TaqI) of the 541 bp amplicon obtained with the degenerate primers showed patterns similar to TYLCV-Is (Israeli species). The second pair of primers gave the expected 348 bp product, which was sequenced. Sequence comparisons revealed 99% identity with TYLCV-Is (EMBL no. X15656, X76319). The resulting sequence was at least 97.7% identical to sequences of TYLCV isolates from the Dominician Republic (EMBL no. AF024715), Cuba (EMBL no. AJ223505), Portugal (EMBL no. AF105975), Iran (EMBL no. AJ13271), and Spain (EMBL no. AF071228). The disease appeared for the first time in 1992 in Tymbaki, but was limited to very few plants in one glasshouse. However, the cause was not determined. To our knowledge, this is the first report of TYLCV of the Begomovirus genus in Greece. References: (1) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (2) J. Navas-Castillo et al. J. Virol. Methods 75:195, 1998.

Download Full-text

First Report of Tomato Yellow Leaf Curl Virus in Réunion Island

Plant Disease ◽

10.1094/pdis.1999.83.3.303b ◽

1999 ◽

Vol 83 (3) ◽

pp. 303-303 ◽

Cited By ~ 22

Author(s):

M. Peterschmitt ◽

M. Granier ◽

R. Mekdoud ◽

A. Dalmon ◽

O. Gambin ◽

...

Keyword(s):

Tomato Yellow Leaf ◽

Economic Losses ◽

Enzyme Linked Immunosorbent Assay ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Capsid Protein Gene ◽

Pcr Product ◽

Leaf Curl Virus ◽

Leaf Curl

In September 1997, stunting, reduced leaf size, leaf curling, and yellow margins were observed on tomato plants on a farm on the south coast of Réunion, a French island belonging to the Mascarenes archipelago. To our knowledge, these symptoms appeared to be characteristic of a tomato yellow leaf curl virus (TYLCV) infection. Diseased plants gave positive reactions with a triple antibody sandwich-enzyme-linked immunosorbent assay (TAS-ELISA), using ADGEN antibodies specific for begomoviruses (1). The serological results were confirmed by polymerase chain reaction (PCR) with a pair of degenerate primers—MP16, 5′-CCTCTAGATAATATTAC(C/T)(G/T)(G/A)(A/T)(T/G)G(G/A)CC-3′ and MP82, 5′-CGGAATTC(T/C)TGNAC(C/T)TT(G/A)CANGGNCC(T/C)T C(G/A)CA-3′—designed by Malla Padidam (ILTAB, San Diego, CA) to amplify a region of the A component of begomoviruses, between the intergenic conserved nonanucleotide sequence (TAATATTAC) and the first 5′ quarter of the capsid protein gene. A 500-bp PCR product was obtained from a symptomatic plant but not from a healthy looking one. After cloning the PCR product in a pGEM-T Easy vector (Promega, Madison, WI) and sequencing it with plasmid-specific primers (SP6, T7), the sequence was compared with the sequences of the NCBI data base, with the use of BLAST. Nineteen sequences among those producing the highest scoring segment pairs were compared with each other and with the 500-bp PCR product from Réunion by the Clustal method of MegAlign (DNASTAR, London). The Réunion sequence (AJ010790) was at least 94% similar to sequences of TYLCV isolates from the Dominican Republic (AF024715), Cuba (AJ223505), and Israel (X15656, X76319 for the mild clone). Based on these results, it appeared that the analyzed tomato plant was infected by a geminivirus isolate belonging to the Israeli species of TYLCV. A preliminary survey was carried out from December 1997 to April 1998 in both outdoor and protected tomato crops. Infected plants were detected by TAS-ELISA in 52 of the 123 locations visited. Severe economic losses were observed: 14 locations with 60 to 100% yield reduction and 11 locations with 40 to 60% yield reduction. All the infected samples were collected in the leeward coast, which is the driest region of the island. Although Bemisia tabaci (Gennadius) has been recorded since 1938 in Réunion (2), it has been observed on tomato crops only since 1997 and population levels were low compared with those of Trialeurodes vaporariorum Westwood. During the first six months of 1998, B. tabaci was found on Euphorbia heterophylla L., Lantana camara L., Solanum melongena L., S. nigrum L., and Phaseolus vulgaris L. These host plants often occur near infected tomato crops. References: (1) S. Macintosh et al. Ann. Appl. Biol. 121:297, 1992. (2) L. Russell and J. Etienne. Proc. Entomol. Soc. Wash. 87:202, 1985.

Download Full-text

Engineering resistance against Tomato yellow leaf curl virus via the CRISPR/Cas9 system in tomato

10.1101/237735 ◽

2017 ◽

Cited By ~ 1

Author(s):

Manal Tashkandi ◽

Zahir Ali ◽

Fatimah Aljedaani ◽

Ashwag Shami ◽

Magdy M. Mahfouz

Keyword(s):

Coat Protein ◽

Virus Resistance ◽

Nicotiana Benthamiana ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

Guide Rna ◽

Multiple Generations ◽

Leaf Curl Virus ◽

Leaf Curl

AbstractCRISPR/Cas systems confer molecular immunity against phages and conjugative plasmids in prokaryotes. Recently, CRISPR/Cas9 systems have been used to confer interference against eukaryotic viruses. Here, we engineered Nicotiana benthamiana and tomato (Solanum lycopersicum) plants with the CRISPR/Cas9 system to confer immunity against the Tomato yellow leaf curl virus (TYLCV). Targeting the TYLCV genome with Cas9-single guide RNA at the sequences encoding the coat protein (CP) or replicase (Rep) resulted in efficient virus interference, as evidenced by low accumulation of the TYLCV DNA genome in the transgenic plants. The CRISPR/Cas9-based immunity remained active across multiple generations in the N. benthamiana and tomato plants. Together, our results confirmed the efficiency of the CRISPR/Cas9 system for stable engineering of TYLCV resistance in N. benthamiana and tomato, and opens the possibilities of engineering virus resistance against single and multiple infectious viruses in other crops.

Download Full-text

First Report of Tomato yellow leaf curl virus in Hawaii

Plant Disease ◽

10.1094/pdis-94-5-0641b ◽

2010 ◽

Vol 94 (5) ◽

pp. 641-641 ◽

Cited By ~ 6

Author(s):

M. J. Melzer ◽

D. Y. Ogata ◽

S. K. Fukuda ◽

R. Shimabuku ◽

W. B. Borth ◽

...

Keyword(s):

Tomato Plant ◽

Tomato Yellow Leaf ◽

Nucleotide Identity ◽

Yellow Leaf ◽

Pcr Assay ◽

Tomato Plants ◽

Plant Samples ◽

Leaf Curl Virus ◽

Leaf Curl Disease ◽

Leaf Curl

Tomato yellow leaf curl disease, caused by the begomovirus Tomato yellow leaf curl virus (TYLCV; family Geminiviridae), is an economically important disease of tomato (Solanum lycopersicum L.) that can be very destructive in tropical and subtropical regions (1). In October 2009, tomato plants showing stunted new growth, interveinal chlorosis, and upward curling of leaf margins were reported by a residential gardener in Wailuku, on the island of Maui. Similar symptoms were observed in approximately 200 tomato plants at a University of Hawaii research farm in Poamoho, on the island of Oahu in November 2009. The similarity between these symptoms and those of tomato yellow leaf curl disease and the presence of whiteflies (Bemisia spp.), the vector of TYLCV, suggested the causal agent was a geminivirus such as TYLCV. Total nucleic acids were extracted from a tomato plant sample from Wailuku and Poamoho and used in a PCR assay with degenerate primers PAR1c715 and PAL1v1978 for geminivirus detection (4). The ~1.5-kbp amplicon expected to be produced from a geminivirus template was generated from the symptomatic tomato plant samples but not from a greenhouse-grown control tomato plant. The amplicons were cloned by the pGEM-T Easy vector (Promega, Madison, WI). Three clones from each sample were sequenced, revealing 97 to 99% nucleotide identity to TYLCV sequences in GenBank and a 98.9% nucleotide identity between the Wailuku (Accession No. GU322424) and Poamoho (Accession No. GU322423) isolates. A multiplex PCR assay for the detection and discrimination between the IL and Mld clades of TYLCV was also performed on these isolates (2). A ~0.8-kbp amplicon was generated from both isolates confirming the presence of TYLCV and their inclusion into the TYLCV-IL clade (2). Seven symptomatic and three asymptomatic tomato plant samples from Poamoho were tested for TYLCV using a squash-blot hybridization assay (3) utilizing a digoxigenin-labeled probe derived from the ~1.5-kbp PCR amplicon. All symptomatic tomato plants and one asymptomatic tomato plant were found to be infected with TYLCV. How the virus entered Hawaii and how long it has been present is unknown. The most plausible route is through infected plant material such as an asymptomatic alternative host rather than viruliferous whiteflies. It appears TYLCV is not a recent introduction into Hawaii since the Wailuku gardener observed similar disease symptoms for a few years before submitting samples for testing. In January 2010, TYLCV was also detected in two commercial tomato farms on Oahu, posing a serious threat to the state's $10 million annual tomato crop. References: (1) H. Czosnek and H. Laterrot. Arch. Virol. 142:1392, 1997. (2) P. Lefeuvre et al. J. Virol. Methods 144:165, 2007. (3) N. Navot et al. Phytopathology 79:562, 1989. (4) M. R. Rojas et al. Plant Dis. 77:340, 1993.

Download Full-text

Progressive aggregation of Tomato yellow leaf curl virus coat protein in systemically infected tomato plants, susceptible and resistant to the virus

Virus Research ◽

10.1016/j.virusres.2012.09.017 ◽

2013 ◽

Vol 171 (1) ◽

pp. 33-43 ◽

Cited By ~ 25

Author(s):

Rena Gorovits ◽

Adi Moshe ◽

Mikhail Kolot ◽

Iris Sobol ◽

Henryk Czosnek

Keyword(s):

Coat Protein ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

Virus Coat Protein ◽

Infected Tomato ◽

Virus Coat ◽

Leaf Curl Virus ◽

Leaf Curl

Download Full-text

First Report of Tomato yellow leaf curl virus in Venezuela

Plant Disease ◽

10.1094/pdis-91-6-0768a ◽

2007 ◽

Vol 91 (6) ◽

pp. 768-768 ◽

Cited By ~ 27

Author(s):

K. Zambrano ◽

O. Carballo ◽

F. Geraud ◽

D. Chirinos ◽

C. Fernández ◽

...

Keyword(s):

Pcr Amplification ◽

Leaf Size ◽

Molecular Data ◽

Tomato Yellow Leaf ◽

Nucleotide Identity ◽

Yellow Leaf ◽

Mild Strain ◽

First Report ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a member of the family Geminiviridae, is a serious production constraint to tomato worldwide. In the new world, the virus had been identified as the causal agent of tomato yellow leaf curl disease in the Caribbean countries of the Dominican Republic, Cuba, and Guadeloupe and also in Florida and the Yucatan Peninsula (1). Molecular data from these TYLCV isolates identified the virus as the TYLCV prototype from Israel. During April 2004, tomato plants showing symptoms such as chlorotic leaf edges, upward leaf cupping, leaf mottling, and reduced leaf size indicative of TYLCV were observed in commercial fields in Zulia state, Venezuela. Whiteflies (Bemisia tabaci Gennadius) were present in the field and appeared to be associated with the disease. Leaf samples from nine symptomatic plants were collected and brought to the lab at Instituto Venezolano de Investigaciones Científicas (IVIC) for further analyses. Geminivirus infection of samples was confirmed by PCR amplification with the degenerate primer pair PAL1v1978 and PAR1c494 (2). TYLCV coat protein gene-specific primers KL04-06_TYLCV CP F and KL04-07_TYLCV CP R (3) were used to confirm the diagnosis. These primers amplified the expected 842-bp PCR product from the nine symptomatic samples. One of the resulting amplicons was cloned into the pCR-TOPO vector (Invitrogen, Carlsbad, CA) and sequenced (GenBank Accession No. DQ302033). Sequence comparison with those available in the NCBI database indicated that the sequenced portion of the genome shared 99% nucleotide identity with the TYLCV mild strain from Portugal (GenBank Accession No. AF105975) and 98% nucleotide identity with the TYLCV mild strain from Spain (GenBank Accession No. AF071228), TYLCV Israel isolate (GenBank Accession No. AM234066), and TYLCV Mexico isolate (GenBank Accession No. DQ631892). To our knowledge, this is the first report of TYLCV infecting tomato crops in South America. Further studies are needed to clarify how TYLCV has been introduced into Venezuela. References: (1) J. E. Polston and P. K. Anderson. Plant Dis. 81:1358, 1997. (2) M. R. Rojas et al. Plant Dis. 77:340, 1993. (3) K. S. Ling et al. Plant Dis. 90:379, 2006.

Download Full-text

First Report of Tomato yellow leaf curl virus in Louisiana

Plant Disease ◽

10.1094/pdis.2001.85.2.230d ◽

2001 ◽

Vol 85 (2) ◽

pp. 230-230 ◽

Cited By ~ 11

Author(s):

R. A. Valverde ◽

P. Lotrakul ◽

A. D. Landry ◽

J. E. Boudreaux

Keyword(s):

The United States ◽

Tomato Yellow Leaf ◽

Yield Reduction ◽

Yellow Leaf ◽

Degenerate Primers ◽

Tomato Plants ◽

First Report ◽

Biotype B ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV) is a begomovirus (Geminiviridae) that causes a serious disease of tomato throughout the world. In 1997, the strain from Israel of TYLCV (TYLCV-IS) was found infecting tomatoes in Florida for the first time in the United States (1). During late spring of 2000, approximately 90% of the tomato plants (Lycopersicon esculentum) in a farm near New Orleans exhibited severe stunting, leaf cupping, and chlorosis. Symptoms were similar to those caused by TYLCV. Whiteflies (Bemisia tabaci biotype B) were present in the field but in relatively low numbers. The effect on yield reduction varied from negligible (late infections) to 100% (early infections). Six selected plants showing symptoms were assayed by polymerase chain reaction (PCR) using begomovirus-specific primers. Capsicum frutescens infected with an isolate of Texas pepper virus from Costa Rica was used as positive control. DNA was extracted using Plant DNAzol Reagent (GIBCO BRL). PCR was conducted using degenerate primers AV494/AC1048 that amplify the core coat protein region of most begomoviruses (2). PCR yielded a DNA fragment of approximately 550 bp, suggesting that a begomovirus was associated with the disease. The amplified DNA of one field isolate was cloned and the nucleotide (nt) sequence determined. Sequence comparisons with other begomoviruses in the GenBank Database indicated that the Louisiana isolate shared 100% nt identity with TYLCV-IS (GenBank Accession X76319). Successful transmission (100%) to Bonny Best tomato were obtained with four groups of 10 whiteflies each (B. tabaci biotype B) that fed on TYLCV-IS infected tomato plants. Acquisition and transmission feedings were for 2 days. In all cases, the virus was diagnosed by the ability to reproduce typical TYLCV-like symptoms in tomato and PCR. The virus was also successfully graft-transmitted to tomato cv. Bonny Best, Nicotiana benthamiana, and tomatillo (Physalis ixocarpa) using scions from tomato plants infected with a whitefly transmitted virus isolate. This is the first report of TYLCV-IS in Louisiana. References: (1) J. E. Polston et al. Plant Dis. 83:984–988, 1999. (2) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288–1293, 1996.

Download Full-text

First Report of Tomato yellow leaf curl virus Infecting Common Bean in China

Plant Disease ◽

10.1094/pdis-03-12-0258-pdn ◽

2012 ◽

Vol 96 (8) ◽

pp. 1229-1229 ◽

Cited By ~ 3

Author(s):

Y. H. Ji ◽

Z. D. Cai ◽

X. W. Zhou ◽

Y. M. Liu ◽

R. Y. Xiong ◽

...

Keyword(s):

Common Bean ◽

Large Population ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Degenerate Primers ◽

Sequence Alignments ◽

First Report ◽

Sequence Identity ◽

Leaf Curl Virus ◽

Leaf Curl

Common bean (Phaseolus vulgaris) is one of the most economically important vegetable crops in China. In November 2011, symptoms with thickening and crumpling of leaves and stunting were observed on common bean with incidence rate of 50 to 70% in the fields of Huaibei, northern Anhui Province, China. Diseased common bean plants were found to be infested with large population of whiteflies (Bemisia tabaci), which induced leaf crumple symptoms in healthy common beans, suggesting begomovirus etiology. To identify possible begomoviruses, 43 symptomatic leaf samples from nine fields were collected and total DNA of each sample was extracted. PCR was performed using degenerate primers PA and PB to amplify a specific region covering AV2 gene of DNA-A and part of the adjacent intergenic region (2). DNA fragments were successfully amplified from 37 out of 43 samples and PCR amplicons of 31 samples were used for sequencing. Sequence alignments among them showed that the nucleotide sequence identity ranged from 99 to 100%, which implied that only one type of begomovirus might be present. Based on the consensus sequences, a primer pair MB1AbF (ATGTGGGATCCACTTCTAAATGAATTTCC) and MB1AsR (GCGTCGACAGTGCAAGACAAACTACTTGGGGACC) was designed and used to amplify the circular viral DNA genome. The complete genome (Accession No. JQ326957) was 2,781 nucleotides long and had the highest sequence identity (over 99%) with Tomato yellow leaf curl virus (TYLCV; Accession Nos. GQ352537 and GU199587). These samples were also examined by dot immunobinding assay using monoclonal antibody against TYLCV and results confirmed that TYLCV was present in the samples. These results demonstrated that the virus from common bean is an isolate of TYLCV, a different virus from Tomato yellow leaf curl China virus (TYLCCNV). TYLCV is a devastating pathogen causing significant yield losses on tomato in China since 2006 (4). The virus has also been reported from cowpea in China (1) and in common bean in Spain (3). To our knowledge, this is the first report of TYLCV infecting common bean in China. References: (1) F. M. Dai et al. Plant Dis. 95:362, 2011. (2) D. Deng et al. Ann. Appl. Biol. 125:327, 1994. (3) J. Navas-Castillo et al. Plant Dis. 83:29, 1999. (4) J. B. Wu et al. Plant Dis. 90:1359, 2006.

Download Full-text

First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽

10.1094/pd-90-0379c ◽

2006 ◽

Vol 90 (3) ◽

pp. 379-379 ◽

Cited By ~ 13

Author(s):

K. S. Ling ◽

A. M. Simmons ◽

R. L. Hassell ◽

A. P. Keinath ◽

J. E. Polston

Keyword(s):

South Carolina ◽

The United States ◽

Tomato Yellow Leaf ◽

Yellow Leaf ◽

Tomato Plants ◽

First Report ◽

Pcr Products ◽

Primer Sequence ◽

Leaf Curl Virus ◽

Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

Download Full-text