Whitefly-mediated transmission and subsequent acquisition of highly similar and naturally occurring Tomato yellow leaf curl virus variants

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan
Keyword(s):  
Amino Acids ◽  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Plant Interactions ◽  
Tomato Plants ◽  
Individual Host ◽  
Field Samples ◽  
Leaf Curl Virus ◽  
Leaf Curl

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.

scholarly journals Detection of Satellite DNA Beta in Tomato Plants with Tomato Yellow Leaf Curl Disease in Jordan

Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1017-1017 ◽  
Author(s):  
G. Anfoka ◽  
F. Haj Ahmad ◽  
M. Altaleb ◽  
M. Al Shhab
Keyword(s):  
Mixed Infection ◽  
Tomato Yellow Leaf ◽  
Single Infection ◽  
Yellow Leaf ◽  
Tomato Production ◽  
Tomato Plants ◽  
Pcr Products ◽  
Leaf Curl Virus ◽  
Leaf Curl Disease ◽  
Leaf Curl

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.

scholarly journals Synergistic Effects of a Tomato chlorosis virus and Tomato yellow leaf curl virus Mixed Infection on Host Tomato Plants and the Whitefly Vector

2021 ◽  
Vol 12 ◽  
Author(s):  
Jie Li ◽  
Ji-cheng Wang ◽  
Tian-bo Ding ◽  
Dong Chu
Keyword(s):  
Mixed Infection ◽  
Temporal Dynamics ◽  
Tomato Yellow Leaf ◽  
Mixed Infections ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Infected Tomato ◽  
Tomato Chlorosis Virus ◽  
Leaf Curl Virus ◽  
Leaf Curl

In China, Tomato chlorosis virus (ToCV) and Tomato yellow leaf curl virus (TYLCV) are widely present in tomato plants. The epidemiology of these viruses is intimately associated with their vector, the whitefly (Bemisia tabaci MED). However, how a ToCV+TYLCV mixed infection affects viral acquisition by their vector remains unknown. In this study, we examined the growth parameters of tomato seedlings, including disease symptoms and the heights and weights of non-infected, singly infected and mixed infected tomato plants. Additionally, the spatio-temporal dynamics of the viruses in tomato plants, and the viral acquisition and transmission by B. tabaci MED, were determined. The results demonstrated that: (i) ToCV+TYLCV mixed infections induced tomato disease synergism, resulting in a high disease severity index and decreased stem heights and weights; (ii) as the disease progressed, TYLCV accumulated more in upper leaves of TYLCV-infected tomato plants than in lower leaves, whereas ToCV accumulated less in upper leaves of ToCV-infected tomato plants than in lower leaves; (iii) viral accumulation in ToCV+TYLCV mixed infected plants was greater than in singly infected plants; and (iv) B. tabaci MED appeared to have a greater TYLCV, but a lower ToCV, acquisition rate from mixed infected plants compared with singly infected plants. However, mixed infections did not affect transmission by whiteflies. Thus, ToCV+TYLCV mixed infections may induce synergistic disease effects in tomato plants.

scholarly journals First Report of Tomato yellow leaf curl virus in South Carolina

Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston
Keyword(s):  
South Carolina ◽  
The United States ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Pcr Products ◽  
Primer Sequence ◽  
Leaf Curl Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.

scholarly journals First Report of TYLCV-IS141, a Tomato Yellow Leaf Curl Virus Recombinant Infecting Tomato Plants Carrying the Ty-1 Resistance Gene in Sardinia (Italy)

Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  
Keyword(s):  
Resistance Gene ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
First Report ◽  
Virus Recombinant ◽  
Leaf Curl Virus ◽  
Leaf Curl

Interaction between ‘Candidatus Phytoplasma australasiae’ and Tomato yellow leaf curl virus in tomato plants

2020 ◽  
Vol 158 (3) ◽  
pp. 733-744
Author(s):  
Nazanin Ebadi ◽  
Gilda Najafipour ◽  
Mohammad Mehdi Faghihi ◽  
Kavous Ayazpour ◽  
Mohammad Salehi
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Leaf Curl

scholarly journals Rate of Tomato yellow leaf curl virus Translocation in the Circulative Transmission Pathway of its Vector, the Whitefly Bemisia tabaci

2001 ◽  
Vol 91 (2) ◽  
pp. 188-196 ◽  
Author(s):  
Murad Ghanim ◽  
Shai Morin ◽  
Henryk Czosnek
Keyword(s):  
Salivary Glands ◽  
Bemisia Tabaci ◽  
Virus Genome ◽  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Hemolymph Sample ◽  
Infected Tomato ◽  
Leaf Curl Virus ◽  
Leaf Curl

Whiteflies (Bemisia tabaci, biotype B) were able to transmit Tomato yellow leaf curl virus (TYLCV) 8 h after they were caged with infected tomato plants. The spread of TYLCV during this latent period was followed in organs thought to be involved in the translocation of the virus in B. tabaci. After increasing acquisition access periods (AAPs) on infected tomato plants, the stylets, the head, the midgut, a hemolymph sample, and the salivary glands dissected from individual insects were subjected to polymerase chain reaction (PCR) without any treatment; the presence of TYLCV was assessed with virus-specific primers. TYLCV DNA was first detected in the head of B. tabaci after a 10-min AAP. The virus was present in the midgut after 40 min and was first detected in the hemolymph after 90 min. TYLCV was found in the salivary glands 5.5 h after it was first detected in the hemolymph. Subjecting the insect organs to immunocapture-PCR showed that the virus capsid protein was in the insect organs at the same time as the virus genome, suggesting that at least some TYLCV translocates as virions. Although females are more efficient as vectors than males, TYLCV was detected in the salivary glands of males and of females after approximately the same AAP.

scholarly journals Tomato curly stunt virus, a New Begomovirus of Tomato Within the Tomato yellow leaf curl virus-IS Cluster in South Africa

Plant Disease ◽  
2000 ◽  
Vol 84 (7) ◽  
pp. 810-810 ◽  
Author(s):  
G. Pietersen ◽  
A. M. Idris ◽  
K. Krüger ◽  
J. K. Brown
Keyword(s):  
South Africa ◽  
Sequence Analysis ◽  
Mosaic Virus ◽  
Tomato Yellow Leaf ◽  
African Cassava Mosaic Virus ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Leaf Curl Virus ◽  
Cassava Mosaic Virus ◽  
Leaf Curl

Tomato yellow leaf curl virus (TYLCV) causes a serious disease of tomato in many countries throughout the world. Preliminary reports suggested that TYLC disease was present in 1997 in South Africa. In 1998 140 ha of tomato fields in the Onderberg area were assessed for possible presence of TYLCV. Symptoms like those caused by TYLCV isolates in Israel were observed in most fields, and disease incidence ranged from <1 to 50%. Yield losses in individual plants ranged from negligible to 100% and appeared related to the age of the plants at time of infection. Two isolates of the suspect virus were experimentally transmitted from symptomatic tomato to virus-free, glasshouse-grown tomato seedlings by colony. Field and colony whiteflies were identified as the Bemisia tabaci based on mt COI sequence analysis (1). Attempts to transmit the suspect begomovirus by sap inoculation between tomato plants were unsuccessful. Polymerase chain reaction (PCR) amplification with degenerate PCR primers (2) that permit detection of the coat protein gene (AV1) and the common region (CR) of other begomoviruses yielded an amplicon of the expected size (2,100 bp), suggesting begomovirus association with diseased tomato plants. Nucleotide (nt) sequence analysis of AV1 for both tomato isolate AF261885 indicated that they were indistinguishable and shared less than 78% sequence identity with other well-studied begomoviruses, indicating a distinct, previously undescribed begomovirus species. AV1 sequence comparisons also revealed that its closest relatives were members of the TYLCV cluster, which includes South African cassava mosaic virus (77.4%) (AF11785), East African cassava mosaic virus (77.3%) (AJ006459), and TYLCV-IS (76.2%) (X15656). The theoretical Rep binding element in the CR, TCGGT, was identical to TYLCV-IS and Cotton leaf curl virus-Pakistan (AJ002448) (AJ002449). Here, we provisionally designate this new tomato-infecting begomoviral species, Tomato curly stunt virus from South Africa (ToCSV-SA). References: (1) D. R. Frohlich et al. Mol. Ecol. 8:1683, 1999. (2) A. M. Idris and J. K. Brown. Phytopathology 88:648, 1998.

scholarly journals Construction of Tomato yellow leaf curl virus Clones for Resistance Assessment in Tomato Plants

2013 ◽  
Vol 31 (2) ◽  
pp. 246-254 ◽  
Author(s):  
Seung Kook Choi ◽  
Hak Soon Choi ◽  
Eun Young Yang ◽  
In Sook Cho ◽  
Jeom Deog Cho ◽  
...  
Keyword(s):  
Tomato Yellow Leaf ◽  
Yellow Leaf ◽  
Tomato Plants ◽  
Resistance Assessment ◽  
Leaf Curl Virus ◽  
Leaf Curl
Sign in / Sign up

Export Citation Format

Share Document