scholarly journals Synergistic Effects of a Tomato chlorosis virus and Tomato yellow leaf curl virus Mixed Infection on Host Tomato Plants and the Whitefly Vector

2021 ◽  
Vol 12 ◽  
Author(s):  
Jie Li ◽  
Ji-cheng Wang ◽  
Tian-bo Ding ◽  
Dong Chu

In China, Tomato chlorosis virus (ToCV) and Tomato yellow leaf curl virus (TYLCV) are widely present in tomato plants. The epidemiology of these viruses is intimately associated with their vector, the whitefly (Bemisia tabaci MED). However, how a ToCV+TYLCV mixed infection affects viral acquisition by their vector remains unknown. In this study, we examined the growth parameters of tomato seedlings, including disease symptoms and the heights and weights of non-infected, singly infected and mixed infected tomato plants. Additionally, the spatio-temporal dynamics of the viruses in tomato plants, and the viral acquisition and transmission by B. tabaci MED, were determined. The results demonstrated that: (i) ToCV+TYLCV mixed infections induced tomato disease synergism, resulting in a high disease severity index and decreased stem heights and weights; (ii) as the disease progressed, TYLCV accumulated more in upper leaves of TYLCV-infected tomato plants than in lower leaves, whereas ToCV accumulated less in upper leaves of ToCV-infected tomato plants than in lower leaves; (iii) viral accumulation in ToCV+TYLCV mixed infected plants was greater than in singly infected plants; and (iv) B. tabaci MED appeared to have a greater TYLCV, but a lower ToCV, acquisition rate from mixed infected plants compared with singly infected plants. However, mixed infections did not affect transmission by whiteflies. Thus, ToCV+TYLCV mixed infections may induce synergistic disease effects in tomato plants.

2021 ◽  
Author(s):  
Wendy Marchant ◽  
Saurabh Gautam ◽  
Bhabesh Dutta ◽  
Rajagopalbab Srinivasan

Begomoviruses are whitefly-transmitted viruses that infect many agricultural crops. Numerous reports exist on individual host plants harboring two or more begomoviruses. Mixed infection allows recombination events to occur among begomoviruses. However, very few studies have examined mixed infection of different isolates/variants/strains of a Begomovirus species in hosts. In this study, the frequency of mixed infection of tomato yellow leaf curl virus (TYLCV) variants in field-grown tomato was evaluated. At least 60% of symptomatic field samples were infected with more than one TYLCV variant. These variants differed by a few nucleotides and amino acids resembling a quasispecies. Subsequently, in the greenhouse, single and mixed infection of two TYLCV variants (“variant #2” and “variant #4”) that shared 99.5% nucleotide identity and differed by a few amino acids was examined. Plant-virus variant-whitefly interactions including transmission of one and/or two variants, variants’ concentrations, competition between variants in inoculated tomato plants, and whitefly acquisition of one and/or two variants were assessed. Whiteflies transmitted both variants to tomato plants at similar frequencies; however, the accumulation of variant #4 was greater than variant#2 in tomato plants. Despite differences in variants’ accumulation in inoculated tomato plants, whiteflies acquired variant #2 and variant #4 at similar frequencies. Also, whiteflies acquired greater amounts of TYLCV from singly-infected plants than from mixed-infected plants. These results demonstrated that even highly similar TYLCV variants could differentially influence component (whitefly-variant-plant) interactions.


2001 ◽  
Vol 91 (2) ◽  
pp. 188-196 ◽  
Author(s):  
Murad Ghanim ◽  
Shai Morin ◽  
Henryk Czosnek

Whiteflies (Bemisia tabaci, biotype B) were able to transmit Tomato yellow leaf curl virus (TYLCV) 8 h after they were caged with infected tomato plants. The spread of TYLCV during this latent period was followed in organs thought to be involved in the translocation of the virus in B. tabaci. After increasing acquisition access periods (AAPs) on infected tomato plants, the stylets, the head, the midgut, a hemolymph sample, and the salivary glands dissected from individual insects were subjected to polymerase chain reaction (PCR) without any treatment; the presence of TYLCV was assessed with virus-specific primers. TYLCV DNA was first detected in the head of B. tabaci after a 10-min AAP. The virus was present in the midgut after 40 min and was first detected in the hemolymph after 90 min. TYLCV was found in the salivary glands 5.5 h after it was first detected in the hemolymph. Subjecting the insect organs to immunocapture-PCR showed that the virus capsid protein was in the insect organs at the same time as the virus genome, suggesting that at least some TYLCV translocates as virions. Although females are more efficient as vectors than males, TYLCV was detected in the salivary glands of males and of females after approximately the same AAP.


2020 ◽  
Author(s):  
Liping Huang ◽  
Shuaixin Wang ◽  
Zhuo Zhang ◽  
Xuguo Zhou ◽  
Zhanhong Zhang ◽  
...  

Abstract Background: Tomato yellow leaf curl virus (TYLCV) causes critical production loss in tomato cultivation. The control of TYLCV in tomato is done mainly by using pesticide which is difficult and expensive, making it essential to find an environmentally friendly chemical agent to control TYLCV. Dufulin has been widely used to prevent and control viral diseases in tobacco and rice in recent years. In this study, we investigated the effect and mechanism of Dufulin on TYLCV on tomato plants.Methods: The control effect of Dufulin on TYLCV was evaluated by field experiments. The expression level of PI II and NPR1 in healthy and TYLCV-infected tomato after treatments were determined by Real-time fluorescent quantitative PCR (qRT-PCR). Handheld chlorophyll meter was applied to compare the content of chlorophyll and nitrogen in healthy and TYLCV-infected tomato after treatments.Results: It showed that the relative control effect of 20% Dufulin on TYLCV reached above 68% in 2018 to 2020. Jasmonic acid (JA) level was higher on healthy tomato, but lower on TYLCV-infected tomato plants treated with Dufulin compared to control. Salicylic acid (SA) level was higher on healthy and TYLCV-infected tomato plants treated with Dufulin compared to control. Chlorophyll content on healthy and TYLCV-infected tomato plants was higher after treatment with Dufulin compared to control. Nitrogen content on tomato plants showed no significant difference after spraying Dufulin compared to control.Conclusions: We found the first evidence of control effects TYLCV using Dufulin. It induced plant defense and increased plant chlorophyll content to help plants resist infection which is helpful for future control of TYLCV in tomato.


Plant Disease ◽  
2014 ◽  
Vol 98 (7) ◽  
pp. 1017-1017 ◽  
Author(s):  
G. Anfoka ◽  
F. Haj Ahmad ◽  
M. Altaleb ◽  
M. Al Shhab

In Jordan, as well as many countries in the region, tomato production is threatened by begomoviruses belonging to the tomato yellow leaf curl virus complex (1). In 2013, an experiment was conducted at Homret Al-Sahen, Jordan (GPS coordinates 32°05′06″ N, 35°38′52″ E), to evaluate different tomato breeding lines for resistance against viruses causing tomato yellow leaf curl disease (TYLCD). Disease symptoms, typical of those caused by TYLCV complex, were observed in many susceptible lines. However, some lines exhibited unusual symptoms including severe leaf curling and stunting. To identify the causal agent of these symptoms, total nucleic acids were extracted from 21 symptomatic plants and used as templates in PCR analysis using nine primers, previously described to detect Tomato yellow leaf curl virus, Tomato yellow leaf curl Sardinia virus, and two recombinants between TYLCV and TYLCSV (3). In addition, the universal primer pair β01/β02 (2) was used to investigate the association of satDNA β with the disease. The PCR products characteristic of TYLCV (664 bp) could be amplified from five plants indicating single infection, while double infection with TYLCV and satDNA β (1,320 bp) was detected in seven plants. Mixed infection with TYLCV, TYLCSV (628 bp), and satDNA β was detected in another seven symptomatic plants and only one plant was infected with TYLCV and TYLCSV. A single plant had mixed infection with TYLCV, TYLCSV, and RecA (a recombinant between TYLCV/TYLCSV) (538 bp) (3). Amplicons obtained from two plants using β01/β02 primers were directly sequenced as 1,320-bp PCR products. Both sequences were found identical and, therefore, this sequence was deposited in the GenBank under the accession number KJ396939. Phylogenetic analysis revealed that this satDNA β sequence had the highest nucleotide (95%) identity with Okra leaf curl virus (OkLCV) satDNA 3 (AF397217) and OkLCV satDNA 10 (AF397215). The contribution of the satDNA β in the modulation of the TYLCD symptoms will be further investigated. Few years ago, another satDNA (Tomβ01-Om) was reported in Oman to be associated with TYLCD (4). However, to the best of our knowledge, this is the first report on the detection of satDNA β in tomato plants infected with viruses causing TYLCD in Jordan. The increasing diversity of begomoviruses causing TYLCD in the region is of great concern due to the possible emergence of more virulent viruses and subsequent increased losses to tomato production. References: (1) G. Anfoka et al. J. Plant Pathol. 90:311, 2008. (2) R. W. Briddon and J. Stanley. Virology 344:198, 2006. (3) S. Davino et al. Virus Res. 143:15, 2009. (4) A. J. Khan et al. Virus Gene 36:169, 2008.


Plant Disease ◽  
2008 ◽  
Vol 92 (5) ◽  
pp. 836-836 ◽  
Author(s):  
Y. Martínez-Zubiaur ◽  
E. Fiallo-Olivé ◽  
J. Carrillo-Tripp ◽  
R. Rivera-Bustamante

Whitefly-transmitted viruses have caused severe losses in tomato crops (Solanum lycopersicum) in Cuba. In 2006 and 2007, tomato greenhouses across eastern Cuba exhibited high levels of Bemisia tabaci (B biotype) infestation. Some plants showed interveinal chlorosis and a severe yellow mosaic, combined with leaf brittleness. These symptoms were different from those induced by Tomato yellow leaf curl virus (TYLCV-IL(CU)). Only 12 of 31 symptomatic samples resulted in positive PCR assays with TYLCV-specific primers (CTGAATGTTTGGATGGAAATGTGC and GCTCGTAAGTTTCCTCAACGGAC). A reverse transcription (RT)-PCR analysis for Tomato chlorosis virus (ToCV) with generic (HS-11/HS-12) and specific primers (ToC-5/ToC-6) was also carried out (2). Sequence analysis of the cloned RT-PCR products (463 bp) confirmed the presence of ToCV in Cuba. The fragment had 97 to 98% identity with GenBank isolates from Spain (DQ136146), Florida (AY903448), and Reunion Island, France (AJ968396). Cloned TYLCV and ToCV amplicons were used as probes to reanalyze the selected 31 samples by a dot-blot hybridization assay in search of mixed infections (1). The assay showed 16 samples to be positive for ToCV, 4 for TYLCV, 8 for both, and 3 samples were negative. To our knowledge, this is the first report of ToCV and TYLCV/ToCV mixed infections in Cuba. References: (1) Y. Abou-Jawdha et al. Plant Dis. 90:378, 2006. (2) C. I. Dovas et al. Plant Dis. 86:1345, 2002.


Plant Disease ◽  
2015 ◽  
Vol 99 (5) ◽  
pp. 588-592 ◽  
Author(s):  
Eui-Joon Kil ◽  
Hee-Seong Byun ◽  
Sunhoo Kim ◽  
Seungchan Cho ◽  
Sungrae Cho ◽  
...  

Tomato yellow leaf curl virus (TYLCV), one of the most serious plant viruses in tropical and subtropical regions, is transmitted to host plants by the vector insect Bemisia tabaci. In order to control TYLCV, it is important to identify weed hosts for overwintering TYLCV. Stellaria aquatica, a winter-hardy weed, was found growing with TYLCV-infected tomato plants in greenhouse production. TYLCV was detected in S. aquatica plants by polymerase chain reaction and Southern blot hybridization analysis. The intergenic region nucleotide sequences amplified from TYLCV-infected tomato plants, TYLCV-viruliferous whiteflies, and S. aquatica were identical. During winter (December to February), TYLCV-viruliferous whiteflies and TYLCV-infected tomato plants were removed or absent from greenhouses. However, S. aquatica plants were observed over a period of 10 months from August to May in such greenhouses, and TYLCV was consistently detected in some of these plants. To investigate the transmission of TYLCV from TYLCV-infected S. aquatica plants to healthy tomato plants by whiteflies, TYLCV-infected S. aquatica plants were transplanted to pots in cages with nonviruliferous whiteflies and healthy tomato plants. After 4 weeks, tomato plants developed typical TYLCV disease symptoms, and TYLCV was detected in both whiteflies and tomato plants. These results show that S. aquatica can act as a winter-hardy reservoir for TYLCV, and suggest that this weed could play an important role in overwintering of TYLCV in tomato greenhouses.


Plant Disease ◽  
2006 ◽  
Vol 90 (3) ◽  
pp. 379-379 ◽  
Author(s):  
K. S. Ling ◽  
A. M. Simmons ◽  
R. L. Hassell ◽  
A. P. Keinath ◽  
J. E. Polston

Tomato yellow leaf curl virus (TYLCV), a begomovirus in the family Geminiviridae, causes yield losses in tomato (Lycopersicon esculentum Mill.) around the world. During 2005, tomato plants exhibiting TYLCV symptoms were found in several locations in the Charleston, SC area. These locations included a whitefly research greenhouse at the United States Vegetable Laboratory, two commercial tomato fields, and various garden centers. Symptoms included stunting, mottling, and yellowing of leaves. Utilizing the polymerase chain reaction (PCR) and begomovirus degenerate primer set prV324 and prC889 (1), the expected 579-bp amplification product was generated from DNA isolated from symptomatic tomato leaves. Another primer set (KL04-06_TYLCV CP F: 5′GCCGCCG AATTCAAGCTTACTATGTCGAAG; KL04-07_TYLCV CP R: 5′GCCG CCCTTAAGTTCGAAACTCATGATATA), homologous to the Florida isolate of TYLCV (GenBank Accession No. AY530931) was designed to amplify a sequence that contains the entire coat protein gene. These primers amplified the expected 842-bp PCR product from DNA isolated from symptomatic tomato tissues as well as viruliferous whitefly (Bemisia tabaci) adults. Expected PCR products were obtained from eight different samples, including three tomato samples from the greenhouse, two tomato plants from commercial fields, two plants from retail stores, and a sample of 50 whiteflies fed on symptomatic plants. For each primer combination, three PCR products amplified from DNA from symptomatic tomato plants after insect transmission were sequenced and analyzed. All sequences were identical and generated 806 nucleotides after primer sequence trimming (GenBank Accession No. DQ139329). This sequence had 99% nucleotide identity with TYLCV isolates from Florida, the Dominican Republic, Cuba, Guadeloupe, and Puerto Rico. In greenhouse tests with a total of 129 plants in two separate experiments, 100% of the tomato plants became symptomatic as early as 10 days after exposure to whiteflies previously fed on symptomatic plants. A low incidence (<1%) of symptomatic plants was observed in the two commercial tomato fields. In addition, two symptomatic tomato plants obtained from two different retail garden centers tested positive for TYLCV using PCR and both primer sets. Infected plants in both retail garden centers were produced by an out-of-state nursery; this form of “across-state” distribution may be one means of entry of TYLCV into South Carolina. To our knowledge, this is the first report of TYLCV in South Carolina. Reference: (1) S. D. Wyatt and J. K. Brown. Phytopathology 86:1288, 1996.


Plant Disease ◽  
2019 ◽  
Vol 103 (6) ◽  
pp. 1437-1437 ◽  
Author(s):  
M. Granier ◽  
L. Tomassoli ◽  
A. Manglli ◽  
M. Nannini ◽  
M. Peterschmitt ◽  
...  

Sign in / Sign up

Export Citation Format

Share Document