Early expression of thyroid hormone receptor β and retinoid X receptor γ in the Xenopus embryo

We studied potential modulators of antithrombin gene expression. A putative hormone response element (HRE) was identified by sequence similarity analysis of the antithrombin promoter, situated between nucleotides -92 and -54 relative to the transcription start site. This HRE contains three hexanucleotide motifs with an AGGTCA consensus, which are potential targets of members of the steroid/thyroid superfamily of nuclear receptors. Stimulation of the hepatoma cell line HepG2 with the receptor ligands l-3,5,3´-tri-iodothyronine, all-trans retinoic acid, or their combination, increased production of antithrombin into the culture medium by 1.3-, 1.6-, and 2.0-fold, respectively. In contrast, the receptor ligand 1,25-dihydroxycholecalciferol [1,25-(OH)2VitD3] did not influence antithrombin production. Analysis of promoter chloramphenicol acetyltransferase (CAT) constructs, showed that the first 86 bp of the antithrombin promoter region are sufficient for basal transcription. The DNA length polymorphism of 32 bp or 108 bp, located upstream of position -276, did not influence antithrombin promoter activity. The antithrombin promoter activity dropped to background values when deleting the region -97/-49 of promoter fragment -453/+57. Transactivation of the antithrombin promoter by retinoid X receptor α (RXRα) (5–7-fold) or thyroid hormone receptor β (TRβ) (4–5-fold) was only observed when at least -167/+57 bp of the promoter region is present in CAT constructs, and when the appropriate ligand of the nuclear receptor was added. This transactivation was not observed upon deletion of the antithrombin promoter region -97/-49. With three copies of the antithrombin promoter fragment -109/-42 in front of the thymidine kinase minimal promoter, transactivation was only obtained with RXRα, and not with TRβ. In conclusion, these results indicate that the ligand-dependent enhancement of antithrombin gene expression is regulated by RXRα as well as by TRβ. Transactivation of antithrombin gene expression by RXRα and TRβ appears to be dependent upon the presence of promoter region up to nucleotide -167. The HRE segment (-109/-42) only confers RXRα responsiveness to a heterologous promoter. Further study is needed to unravel the exact nature of this HRE and its 5´-flanking sequences.

Download Full-text

Mouse Sterol Response Element Binding Protein-1c Gene Expression Is Negatively Regulated by Thyroid Hormone

Endocrinology ◽

10.1210/en.2006-0116 ◽

2006 ◽

Vol 147 (9) ◽

pp. 4292-4302 ◽

Cited By ~ 50

Author(s):

Koshi Hashimoto ◽

Masanobu Yamada ◽

Shunichi Matsumoto ◽

Tsuyoshi Monden ◽

Teturou Satoh ◽

...

Keyword(s):

Gene Expression ◽

Thyroid Hormone ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Binding Protein ◽

Retinoid X Receptor ◽

Mrna Levels ◽

Response Element ◽

Element Binding Protein ◽

Thyroid Hormone Receptor Β

Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1–6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (−574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-α/thyroid hormone receptor-β heterodimer bound to Site2, but retinoid X receptor-α/liver X receptor-α heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-β recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.

Download Full-text

Thyroid Hormone Induces Hypoxia-Inducible Factor 1α Gene Expression through Thyroid Hormone Receptor β/Retinoid X Receptor α-Dependent Activation of Hepatic Leukemia Factor

Endocrinology ◽

10.1210/en.2007-1238 ◽

2008 ◽

Vol 149 (5) ◽

pp. 2241-2250 ◽

Cited By ~ 31

Author(s):

Teresa Otto ◽

Joachim Fandrey

Keyword(s):

Gene Expression ◽

Thyroid Hormone ◽

Hormone Receptor ◽

Target Genes ◽

Thyroid Hormone Receptor ◽

Hypoxia Inducible Factor ◽

Retinoid X Receptor ◽

Lung Carcinoma Cells ◽

Angiogenic Proteins ◽

Thyroid Hormone Receptor Β

Thyroid hormones are important regulators of differentiation, growth, metabolism, and physiological function of virtually all tissues. Active thyroid hormone T3 affects expression of genes that encode for angiogenic proteins like adrenomedullin or vascular endothelial growth factor and erythropoietin, as well as for glucose transporters and phospho fructokinase that determine glucose use. Interestingly, those target genes are also hypoxia inducible and under the control of the oxygen-dependent transcription factor hypoxia-inducible factor (HIF)-1). We and others have reported that T3 stimulates HIF-1 activation, which intimately links T3 and HIF-1 induced gene expression. Here, we studied intracellular pathways that mediate HIF-1α regulation by T3. We found that T3-dependent HIF-1 activation is not limited to hepatoma cells but is also observed in primary human hepatocytes, kidney and lung carcinoma cells. T3 increased the HIF-1α subunit mRNA and protein within a few hours through activation of the thyroid hormone receptor β retinoid X receptor α heterodimer because knockdown of each of the partners abrogated the stimulation by T3. However, T3 had no direct effect on transcription of HIF-1α, but activation of the thyroid hormone receptor β/retinoid X receptor α heterodimer by T3 stimulated expression of the hepatic leukemia factor, which increases HIF-1α gene expression.

Download Full-text

The Effect of Ligand Affinity to the Contact Dynamics of the Ligand Binding Domain of Thyroid Hormone Receptor - Retinoid X Receptor

Journal of Molecular Graphics and Modelling ◽

10.1016/j.jmgm.2020.107829 ◽

2021 ◽

pp. 107829

Author(s):

James Peter L. Lim ◽

Mac Kevin E. Braza ◽

Ricky B. Nellas

Keyword(s):

Thyroid Hormone ◽

Ligand Binding ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Binding Domain ◽

Ligand Binding Domain ◽

Retinoid X Receptor ◽

Contact Dynamics ◽

Ligand Affinity

Download Full-text

Thyroid hormone receptor β mutations in the ‘hot-spot region’ are rare events in thyroid carcinomas

Journal of Endocrinology ◽

10.1677/joe-06-0009 ◽

2007 ◽

Vol 192 (1) ◽

pp. 83-86 ◽

Cited By ~ 12

Author(s):

Ana Sofia Rocha ◽

Ricardo Marques ◽

Inês Bento ◽

Ricardo Soares ◽

João Magalhães ◽

...

Keyword(s):

Thyroid Cancer ◽

Thyroid Hormone ◽

Transgenic Mice ◽

Cell Lines ◽

Hormone Receptor ◽

Thyroid Hormone Receptor ◽

Hot Spot ◽

Direct Sequencing ◽

Human Thyroid ◽

Thyroid Hormone Receptor Β

Thyroid cancer constitutes the most frequent endocrine neoplasia. Targeted expression of rearranged during transfection (RET)/papillary thyroid carcinoma (PTC) and V600E V-raf murine sarcoma viral oncogene homolog B1 (BRAF) to the thyroid glands of transgenic mice results in tumours similar to those of human PTC, providing evidence for the involvement of these oncogenes in PTC. Kato et al. developed a mouse model that mimics the full spectrum of the human follicular form of thyroid cancer (FTC). FTC rapidly develops in these mice through introduction of the thyroid hormone receptor β (THRB)PV mutant on the background of the inactivated THRB wt locus. Our aim was to verify if, in the context of human follicular thyroid carcinogenesis, THRB acted as a tumour suppressor gene. We screened for mutations of the THRB gene in the hot-spot region, spanning exons 7–10, in 51 thyroid tumours and six thyroid cancer cell lines by PCR and direct sequencing. We did not find mutations in any of the tumours or cell lines analysed. Our findings suggest that, in contrast to the findings on the THRB-mutant transgenic mice, THRB gene mutations are not a relevant mechanism for human thyroid carcinogenesis.

Download Full-text