In Situ, Real-Time Catabolic Gene Expression: Extraction and Characterization of Naphthalene Dioxygenase mRNA Transcripts from Groundwater

1999 ◽  
Vol 65 (1) ◽  
pp. 80-87 ◽  
Author(s):  
Mark S. Wilson ◽  
Corien Bakermans ◽  
Eugene L. Madsen
Keyword(s):  
Coal Tar ◽  
Sodium Dodecyl ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Contaminated Site ◽  
Sequence Comparisons ◽  
Degrading Bacteria ◽  
Genes Encoding ◽  
Pcr Products

ABSTRACT We developed procedures for isolating and characterizing in situ-transcribed mRNA from groundwater microorganisms catabolizing naphthalene at a coal tar waste-contaminated site. Groundwater was pumped through 0.22-μm-pore-size filters, which were then frozen in dry ice-ethanol. RNA was extracted from the frozen filters by boiling sodium dodecyl sulfate lysis and acidic phenol-chloroform extraction. Transcript characterization was performed with a series of PCR primers designed to amplify nahAc homologs. Several primer pairs were found to amplify nahAc homologs representing the entire diversity of the naphthalene-degrading genes. The environmental RNA extract was reverse transcribed, and the resultant mixture of cDNAs was amplified by PCR. A digoxigenin-labeled probe mixture was produced by PCR amplification of groundwater cDNA. This probe mixture hybridized under stringent conditions with the corresponding PCR products from naphthalene-degrading bacteria carrying a variety of nahAchomologs, indicating that diverse dioxygenase transcripts had been retrieved from groundwater. Diluted and undiluted cDNA preparations were independently amplified, and 28 of the resulting PCR products were cloned and sequenced. Sequence comparisons revealed two major groups related to the dioxygenase genes ndoB anddntAc, previously cloned from Pseudomonas putida NCIB 9816-4 and Burkholderia sp. strain DNT, respectively. A distinctive subgroup of sequences was found only in experiments performed with the undiluted cDNA preparation. To our knowledge, these results are the first to directly document in situ transcription of genes encoding naphthalene catabolism at a contaminated site by indigenous microorganisms. The retrieved sequences represent greater diversity than has been detected at the study site by culture-based approaches.

scholarly journals PCR amplification and sequence analyses of reverse transcriptase-like genes in Crinipellis perniciosa isolates

2007 ◽  
Vol 32 (5) ◽  
pp. 373-380 ◽  
Author(s):  
Jorge F. Pereira ◽  
Mariana D.C. Ignacchiti ◽  
Elza F. Araújo ◽  
Sérgio H. Brommonschenkel ◽  
Júlio C.M. Cascardo ◽  
...  
Keyword(s):  
Reverse Transcriptase ◽  
Pathogenic Fungus ◽  
Pcr Amplification ◽  
Restriction Enzymes ◽  
Sequence Comparisons ◽  
Copy Numbers ◽  
A Genome ◽  
Close Relationship ◽  
Pcr Products ◽  
Broom Disease

Reverse transcriptase (RT) sequence analysis is an important technique used to detect the presence of transposable elements in a genome. Putative RT sequences were analyzed in the genome of the pathogenic fungus C. perniciosa, the causal agent of witches' broom disease of cocoa. A 394 bp fragment was amplified from genomic DNA of different isolates of C. perniciosa belonging to C-, L-, and S-biotypes and collected from various geographical areas. The cleavage of PCR products with restriction enzymes and the sequencing of various RT fragments indicated the presence of several sequences showing transition events (G:C to A:T). Southern blot analysis revealed high copy numbers of RT signals, forming different patterns among C-, S-, and L-biotype isolates. Sequence comparisons of the predicted RT peptide indicate a close relationship with the RT protein from thegypsy family of LTR-retrotransposons. The possible role of these retrotransposons in generating genetic variability in the homothallic C. perniciosa is discussed.

scholarly journals Analysis of The Open Reading Frame (ORF) 29-TrnC (GCA) Sequence to Detect Indica and Japonica Sub Species on Upland Rice of Situ Bagendit and Inbred Rice of Ciherang

2018 ◽  
Vol 10 (1) ◽  
pp. 153-159
Author(s):  
Rohma Istiana ◽  
Hermin Pancasakti Kusumaningrum ◽  
Rejeki Siti Ferniah
Keyword(s):  
Plant Breeding ◽  
Upland Rice ◽  
Pcr Amplification ◽  
Breeding Program ◽  
Abiotic Factor ◽  
Reading Frame ◽  
Plant Breeding Program ◽  
Pcr Products

The identification and the characterization of genetic diversity of rice was the first step in the rice plant breeding program. This study aimed to detect indica or japonica sub-species on upland rice Situ Bagendit and inbred rice Ciherang using molecular markers ORF 29-TrnC (GCA) on the chloroplast genome. Rice was included to the indica sub-species if the 32 bp insertion on ORF 29-TrnC (GCA) sequence was found, on the contrary, if the deletion 32 bp on ORF 29-TrnC (GCA) was found then it was included to the japonica sub-species. DNA isolation was examined from the leaves of the rice plants, and then it tested quantitatively to determine the transparency and DNA concentration from the isolation results. PCR amplification was performed using a pair of primers CP2 and it was followed by agarose gel electrophoresis. The visualization of the DNA bands used the gel documentation. Sequencing of PCR products produced a long base 390 bp in Situ Bagendit rice and 390 bp in Ciherang rice. Analysis of the sequences showed that the insertions occurred throughout the 32 bp in Situ Bagendit rice and the insertions occurred throughout the 32 bp in Ciherang rice. The results showed that upland rice Situ Bagendit and inbred rice Ciherang were included in the indica sub-species. The knowledge of variety of genetics of rice can be used as bio-information in the plant breeding program. Further, the knowledge can be used to protect in genetic power source, the selection and the composing of superior varieties of rice which is tolerant with kinds of biotic and abiotic factor.

scholarly journals PCR Detection of Genes Encoding Nitrite Reductase in Denitrifying Bacteria

1999 ◽  
Vol 65 (4) ◽  
pp. 1652-1657 ◽  
Author(s):  
Sara Hallin ◽  
Per-Eric Lindgren
Keyword(s):  
Wastewater Treatment ◽  
Activated Sludge ◽  
Nitrite Reductase ◽  
Wastewater Treatment Plants ◽  
Paracoccus Denitrificans ◽  
Pcr Primers ◽  
Genes Encoding ◽  
Pcr Products ◽  
Key Enzyme ◽  
Sequence Relationships

ABSTRACT Using consensus regions in gene sequences encoding the two forms of nitrite reductase (Nir), a key enzyme in the denitrification pathway, we designed two sets of PCR primers to amplifycd 1- and Cu-nir. The primers were evaluated by screening defined denitrifying strains, denitrifying isolates from wastewater treatment plants, and extracts from activated sludge. Sequence relationships ofnir genes were also established. Thecd 1 primers were designed to amplify a 778 to 799-bp region of cd1-nir in the six published sequences. Likewise, the Cu primers amplified a 473-bp region in seven of the eight published Cu-nir sequences. Together, the two sets of PCR primers amplified nir genes in nine species within four genera, as well as in four of the seven sludge isolates. The primers did not amplify genes of nondenitrifying strains. The Cu primers amplified the expected fragment in all 13 sludge samples, but cd1-nir fragments were only obtained in five samples. PCR products of the expected sizes were verified as nir genes after hybridization to DNA probes, except in one case. The sequenced nir fragments were related to other nir sequences, demonstrating that the primers amplified the correct gene. The selected primer sites for Cu-nir were conserved, while broad-range primers targeting conserved regions of cd1-nir seem to be difficult to find. We also report on the existence of Cu-nir in Paracoccus denitrificans Pd1222.

scholarly journals First Report of Potato mop-top virus on Potato in Poland

Plant Disease ◽  
2010 ◽  
Vol 94 (7) ◽  
pp. 920-920 ◽  
Author(s):  
M. Budziszewska ◽  
P. Wieczorek ◽  
K. Nowaczyk ◽  
N. Borodynko ◽  
H. Pospieszny ◽  
...  
Keyword(s):  
Pcr Amplification ◽  
Potato Production ◽  
Amino Acid Identity ◽  
Sequence Comparisons ◽  
First Report ◽  
Pcr Products ◽  
Potato Mop Top Virus ◽  
Negative Controls ◽  
North And South America ◽  
Das Elisa

Potato mop-top virus (PMTV) is a serious pathogen occurring in Northern Europe, North and South America, and Asia that significantly reduces potato (Solanum tuberosum) production. PMTV is transmitted by Spongospora subterranea, the casual agent of potato powdery scab, and causes the characteristic brown arcs and circles (spraing symptoms) in potato tubers, stunting of stems, shortening of internodes, and mosaic patterns (V-shaped) on leaves as well as leaf necrosis (2). S. subterranea and PMTV are mainly associated with cool, humid environments. Between 2005 and 2009, extensive surveys for PMTV were conducted in Polish potato fields with an emphasis on areas neighboring countries where the virus had previously been reported. Approximately 18,000 tubers from 39 cultivars from different regions of Poland were collected. Tubers were first visually inspected for symptoms within the flesh and then selected tubers were analyzed by double-antibody sandwich (DAS)-ELISA (3). Symptomatic samples tested by ELISA gave A405 values approximately threefold higher than negative controls and approximately two- to fivefold lower than PMTV-positive controls (supplied by J. Valkonen). Total RNA was isolated (1) from tubers testing positive for PMTV by DAS-ELISA. cDNA synthesis and subsequent PCR amplification of the CP region were carried out using primers located in RNA2: PMTV1 5′GGTTTGTTTACCACCCTTGG3′ (3) and PMTV2 5′AAAAGCCTGAGCGGTTAATTG3′ (courtesy of E. Savenkov), which amplified a 530-bp product. No PMTV was detected in Poland between 2005 and 2007. In 2008, one tuber (cv. Inwestor) from central Poland (Łódź County) tested positive for PMTV. The RT-PCR products were sequenced and the sample from 2008 was submitted to GenBank (PMTV-Pl CP, Accession No. GQ503252). In 2009, additional infected tubers were found in three Polish cultivars (Bartek, Glada, Ruta) from the same county. Sequence comparisons of PMTV-Pl revealed 99% nucleotide identity and approximately 98% amino acid identity to Czech, Swedish, and Finnish PMTV isolates. To our knowledge, this is the first report of PMTV in Poland. Poland is one of the major potato-producers in Europe with the 2008 crop around 10 million t. If PMTV spreads in Poland, the virus could threaten potato production. References: (1) S. Chang et al. Plant Mol Biol Rep. 11:113, 1993. (2) A. Germundsson et al. J. Gen. Virol. 83:1201, 2002. (3) S. Latvala-Kilby et al. Phytopathology 99:519, 2009.

High-throughput sequencing of kDNA amplicons for the analysis ofLeishmaniaminicircles and identification of Neotropical species

Parasitology ◽  
2017 ◽  
Vol 145 (5) ◽  
pp. 585-594 ◽  
Author(s):  
ARTHUR KOCHER ◽  
SOPHIE VALIÈRE ◽  
ANNE-LAURE BAÑULS ◽  
JÉRÔME MURIENNE
Keyword(s):  
High Throughput ◽  
High Throughput Sequencing ◽  
Pcr Primers ◽  
Genomic Region ◽  
Kinetoplast Dna ◽  
Sequence Comparisons ◽  
Conserved Sequence ◽  
Species Complexes ◽  
Pcr Products ◽  
Minicircle Sequence

SUMMARYLeishmaniakinetoplast DNA contains thousands of small circular molecules referred to as kinetoplast DNA (kDNA) minicercles. kDNA minicircles are the preferred targets for sensitiveLeishmaniadetection, because they are present in high copy number and contain conserved sequence blocks in which polymerase chain reaction (PCR) primers can be designed. On the other hand, the heterogenic nature of minicircle networks has hampered the use of this peculiar genomic region for strain typing. The characterization ofLeishmaniaminicirculomes used to require isolation and cloning steps prior to sequencing. Here, we show that high-throughput sequencing of single minicircle PCR products allows bypassing these laborious laboratory tasks. The 120 bp long minicircle conserved region was amplified by PCR from 18Leishmaniastrains representative of the major species complexes found in the Neotropics. High-throughput sequencing of PCR products enabled recovering significant numbers of distinct minicircle sequences from each strain, reflecting minicircle class diversity. Minicircle sequence analysis revealed patterns that are congruent with current hypothesis ofLeishmaniarelationships. Then, we show that a barcoding-like approach based on minicircle sequence comparisons may allow reliable identifications ofLeishmaniaspp. This work opens up promising perspectives for the study of kDNA minicercles and a variety of applications inLeishmaniaresearch.

scholarly journals Bifidobacterium lactis DSM 10140: Identification of the atp (atpBEFHAGDC) Operon and Analysis of Its Genetic Structure, Characteristics, and Phylogeny

2004 ◽  
Vol 70 (5) ◽  
pp. 3110-3121 ◽  
Author(s):  
Marco Ventura ◽  
Carlos Canchaya ◽  
Douwe van Sinderen ◽  
Gerald F. Fitzgerald ◽  
Ralf Zink
Keyword(s):  
Transcription Initiation ◽  
Bacterial Species ◽  
Blot Hybridization ◽  
Pcr Primers ◽  
Amino Acid Sequences ◽  
Rrna Gene ◽  
Specific Sequence ◽  
Bifidobacterium Lactis ◽  
Genes Encoding ◽  
Pcr Products

ABSTRACT The atp operon is highly conserved among eubacteria, and it has been considered a molecular marker as an alternative to the 16S rRNA gene. PCR primers were designed from the consensus sequences of the atpD gene to amplify partial atpD sequences from 12 Bifidobacterium species and nine Lactobacillus species. All PCR products were sequenced and aligned with other atpD sequences retrieved from public databases. Genes encoding the subunits of the F1F0-ATPase of Bifidobacterium lactis DSM 10140 (atpBEFHAGDC) were cloned and sequenced. The deduced amino acid sequences of these subunits showed significant homology with the sequences of other organisms. We identified specific sequence signatures for the genus Bifidobacterium and for the closely related taxa Bifidobacterium lactis and Bifidobacterium animalis and Lactobacillus gasseri and Lactobacillus johnsonii, which could provide an alternative to current methods for identification of lactic acid bacterial species. Northern blot analysis showed that there was a transcript at approximately 7.3 kb, which corresponded to the size of the atp operon, and a transcript at 4.5 kb, which corresponded to the atpC, atpD, atpG, and atpA genes. The transcription initiation sites of these two mRNAs were mapped by primer extension, and the results revealed no consensus promoter sequences. Phylogenetic analysis of the atpD genes demonstrated that the Lactobacillus atpD gene clustered with the genera Listeria, Lactococcus, Streptococcus, and Enterococcus and that the higher G+C content and highly biased codon usage with respect to the genome average support the hypothesis that there was probably horizontal gene transfer. The acid inducibility of the atp operon of B. lactis DSM 10140 was verified by slot blot hybridization by using RNA isolated from acid-treated cultures of B. lactis DSM 10140. The rapid increase in the level of atp operon transcripts upon exposure to low pH suggested that the ATPase complex of B. lactis DSM 10140 was regulated at the level of transcription and not at the enzyme assembly step.

scholarly journals Length polymorphisms of simple sequence repeat DNA in soybean.

Genetics ◽  
1992 ◽  
Vol 132 (4) ◽  
pp. 1131-1139 ◽  
Author(s):  
M S Akkaya ◽  
A A Bhagwat ◽  
P B Cregan
Keyword(s):  
Genetic Markers ◽  
Simple Sequence Repeat ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
F1 Hybrids ◽  
Sequence Repeat ◽  
Pcr Products ◽  
Soybean Genotypes ◽  
Ssr Loci ◽  
Simple Sequence

Abstract The objective of this work was to ascertain the presence and degree of simple sequence repeat (SSR) DNA length polymorphism in the soybean [Glycine max (L.) Merr.]. A search of GenBank revealed no (CA)n or (GT)n SSRs with n greater than 8 in soybean. In contrast, 5 (AT)n and 1 (ATT)n SSRs with n ranging from 14 to 27 were detected. Polymerase chain reaction (PCR) primers to regions flanking the six SSR loci were used in PCR amplification of DNA from 43 homozygous soybean genotypes. At three loci, amplification produced one PCR product per genotype and revealed 6, 7 and 8 product length variants (alleles) at the three loci, respectively. F1 hybrids between parents carrying different alleles produced two PCR products identical to the two parents. Codominant segregation of alleles among F2 progeny was demonstrated at each locus. A soybean DNA library was screened for the presence of (CA/GT)n SSRs. Sequencing of positive clones revealed that the longest such SSR was (CA)9. Thus, (CA)n SSRs with n of 15 or more are apparently much less common in soybean than in the human genome. In contrast to humans, (CA)n SSRs will probably not provide an abundant source of genetic markers in soybean. However, the apparent abundance of long (AT)n sequences should allow this SSR to serve as a source of highly polymorphic genetic markers in soybean.

scholarly journals Molecular Analysis of Carbon Monoxide-Oxidizing Bacteria Associated with Recent Hawaiian Volcanic Deposits

2004 ◽  
Vol 70 (7) ◽  
pp. 4242-4248 ◽  
Author(s):  
Kari E. Dunfield ◽  
Gary M. King
Keyword(s):  
Carbon Monoxide ◽  
Lava Flow ◽  
Large Subunit ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Clone Libraries ◽  
Tephra Deposit ◽  
Volcanic Deposits ◽  
Pcr Products ◽  
Phylogenetic Lineages

ABSTRACT Genomic DNA extracts from four sites at Kilauea Volcano were used as templates for PCR amplification of the large subunit (coxL) of aerobic carbon monoxide dehydrogenase. The sites included a 42-year-old tephra deposit, a 108-year-old lava flow, a 212-year-old partially vegetated ash-and-tephra deposit, and an approximately 300-year-old forest. PCR primers amplified coxL sequences from the OMP clade of CO oxidizers, which includes isolates such as Oligotropha carboxidovorans, Mycobacterium tuberculosis, and Pseudomonas thermocarboxydovorans. PCR products were used to create clone libraries that provide the first insights into the diversity and phylogenetic affiliations of CO oxidizers in situ. On the basis of phylogenetic and statistical analyses, clone libraries for each site were distinct. Although some clone sequences were similar to coxL sequences from known organisms, many sequences appeared to represent phylogenetic lineages not previously known to harbor CO oxidizers. On the basis of average nucleotide diversity and average pairwise difference, a forested site supported the most diverse CO-oxidizing populations, while an 1894 lava flow supported the least diverse populations. Neither parameter correlated with previous estimates of atmospheric CO uptake rates, but both parameters correlated positively with estimates of microbial biomass and respiration. Collectively, the results indicate that the CO oxidizer functional group associated with recent volcanic deposits of the remote Hawaiian Islands contains substantial and previously unsuspected diversity.

scholarly journals Genome size and microsatellites: the effect of nuclear size on amplification potential

Genome ◽  
2002 ◽  
Vol 45 (1) ◽  
pp. 212-215 ◽  
Author(s):  
Trenton WJ Garner
Keyword(s):  
Genome Size ◽  
Microsatellite Dna ◽  
Pcr Amplification ◽  
Pcr Primers ◽  
Amplification Success ◽  
Pcr Products ◽  
Negative Effect ◽  
C Value ◽  
Primer Sets ◽  
Using Data

Although the frequency of microsatellite DNA regions generally increases with increasing genome size, genome size has a negative effect on polymerase chain reaction (PCR) amplification. Thus, researchers developing sets of PCR primers, as is commonly done for microsatellite DNA regions, may encounter greater difficulty when working with species that have larger genomes. I investigated the effect of genome size on overall amplification success using data from nine different metazoan taxa. The proportion of primer sets that did not amplify PCR products was strongly and positively correlated with the haploid C value of the target species. Increasing genome size may affect amplification success negatively because of a decrease in target:nontarget DNA or by dilution of the available primer pool by nonspecific binding.Key words: microsatellites, genome size, amplification success.

Sign in / Sign up

Export Citation Format

Share Document